ID: 1172074673

View in Genome Browser
Species Human (GRCh38)
Location 20:32285550-32285572
Sequence CTGAAAGGATGGTGGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172074666_1172074673 -3 Left 1172074666 20:32285530-32285552 CCATTATAGGAAATTTTGACCTG 0: 1
1: 0
2: 2
3: 12
4: 141
Right 1172074673 20:32285550-32285572 CTGAAAGGATGGTGGGAACTGGG 0: 1
1: 0
2: 0
3: 29
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172074673 Original CRISPR CTGAAAGGATGGTGGGAACT GGG Intronic
900326770 1:2111971-2111993 GTGAAAGGAAGGTGCCAACTGGG - Intronic
900433313 1:2612936-2612958 CTGAATGGAAGGAGGGAACAGGG + Intronic
900685825 1:3946898-3946920 CTGGAAGGAGTGTGGGATCTGGG + Intergenic
900875484 1:5339750-5339772 CTGACAGCATGGTGTGTACTAGG + Intergenic
901292487 1:8135039-8135061 CTGAAAGGGTGGTGGTGGCTTGG - Intergenic
902725888 1:18335658-18335680 TTGCAAGGATGCTGGGGACTTGG + Intronic
903363486 1:22792115-22792137 CTGAAAGCAGGGTGGGAAGGAGG - Intronic
905238565 1:36567146-36567168 ATGAAATGATGGTGGACACTTGG + Intergenic
906348693 1:45038471-45038493 AGGAAAGGAAGGTGGGAAATGGG + Intronic
907861605 1:58358977-58358999 CTCAAAGGATGCTGGGATCTAGG + Intronic
914340983 1:146760275-146760297 CTGGGAGGGTGGTGGGTACTGGG + Intergenic
915701957 1:157804727-157804749 CTGTGTGGATGGTGGGTACTGGG - Intronic
916001527 1:160621121-160621143 CAGTAAGGATGGTGGGAAAGTGG + Intronic
917208693 1:172607591-172607613 CTGAAAGAAAAGTGGGAACCCGG - Intronic
918013267 1:180607638-180607660 TTGAAAAGATGGGGGGAATTGGG - Intergenic
918396705 1:184120561-184120583 CTAAAAGCATTGTGGGACCTAGG - Intergenic
920117123 1:203628903-203628925 CAGGAAGGATGGTGGCAGCTTGG + Intronic
920602034 1:207336708-207336730 CTGAACTGTTGGTGGGACCTTGG - Exonic
923276409 1:232400632-232400654 CCGTAATGATGGTTGGAACTGGG - Intronic
1064348069 10:14550701-14550723 CTGATAGGATGCTGGGTTCTTGG - Intronic
1066283310 10:33939690-33939712 GTGAAAGCATTGTGGGAAGTCGG - Intergenic
1069590125 10:69636221-69636243 CTGAAAGCATGGTGGGTAGGAGG + Intergenic
1070205222 10:74252223-74252245 GTGAAAAGATGGTGAGAACTTGG + Intronic
1071195617 10:83155670-83155692 TTGAAAGGAGGGAGGGAACAAGG - Intergenic
1072722123 10:97787583-97787605 CAAAAAGGATGGAGGGAACAAGG - Intergenic
1073237620 10:102031830-102031852 GTGAGAGAATGGTGTGAACTGGG - Intronic
1073332066 10:102676926-102676948 CTCAAAGGATGGCATGAACTGGG - Exonic
1073362588 10:102912067-102912089 CTGACAGGAGGATGGTAACTAGG - Intergenic
1074138838 10:110653081-110653103 ATGAAAGGAAGGTAGGTACTGGG - Intronic
1074296133 10:112191358-112191380 AAGAAAGCACGGTGGGAACTAGG + Intronic
1075649783 10:124119822-124119844 AAGAAATGCTGGTGGGAACTAGG - Intergenic
1080767342 11:35309136-35309158 ATGATAGGCTGGTGGTAACTAGG - Intronic
1080868087 11:36213183-36213205 CTGCCAGGATGCTGGGAACCAGG - Intronic
1083453911 11:62765317-62765339 CTGAAAGGAAAGTGAGATCTAGG - Intronic
1083475756 11:62914309-62914331 ATGCAAGGAAGGTAGGAACTAGG + Intronic
1084733885 11:71092070-71092092 CTGTCAGGACGGTGGGAACTTGG + Intronic
1085234622 11:75004726-75004748 ATGAAAGCATGGTTTGAACTAGG + Intronic
1085241458 11:75059857-75059879 CTGAAAGTATAGTGGGCCCTAGG + Intergenic
1085503379 11:77041558-77041580 GAGAAAGGCTGGTGGGAACATGG + Exonic
1085731988 11:79007796-79007818 CTGAAAGAACAGTGGGAAGTTGG + Intronic
1086554955 11:88098423-88098445 CTGAGAGAATGTTGGGTACTGGG - Intergenic
1087078124 11:94144454-94144476 CTGACAGGGTGGAGGGGACTGGG - Intronic
1088502545 11:110497166-110497188 CTTCAAGGGTGGTGGGAATTGGG + Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089845342 11:121453932-121453954 GGGAAAGGATGGTGGTGACTGGG + Intronic
1090234965 11:125140351-125140373 CTGAAAGGAAGTAGGGAAGTGGG - Intergenic
1090428190 11:126624887-126624909 CAGTAAGGATGGTGGAAATTGGG + Intronic
1090653370 11:128825049-128825071 CTGAAAAGATGATGGTAATTCGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091158004 11:133391501-133391523 GCTAAAGGATGGTTGGAACTGGG - Intronic
1091323189 11:134665841-134665863 TTGGAAGGATGGTTGGAACTGGG - Intergenic
1091459198 12:631040-631062 CAGAAAGGTTGGTGGGGAGTGGG + Intronic
1091671276 12:2453890-2453912 CAGAAAGGAAGCTGAGAACTGGG - Intronic
1092762250 12:11820688-11820710 AGGAAAGGATGGTGGGAGCTGGG + Intronic
1093751228 12:22802808-22802830 CTGGAACTATGGTGTGAACTAGG - Intergenic
1094003145 12:25718157-25718179 CAGAAAGGATATGGGGAACTAGG - Intergenic
1094386554 12:29900719-29900741 CTGAAAGGAAGGTGGGAAACTGG + Intergenic
1095329566 12:40942138-40942160 ATGAAAGGGATGTGGGAACTTGG + Intronic
1096984267 12:55745796-55745818 CTGAGAGGGTAGAGGGAACTAGG - Intronic
1097290139 12:57907506-57907528 CTTAAAGGATGGAAGGAATTCGG - Intergenic
1097801336 12:63917781-63917803 CAGAAAGCAGGGTGGGAAATTGG - Intronic
1099275907 12:80575945-80575967 CTCAAAGGATGGTGTGAGGTTGG - Intronic
1100251630 12:92830802-92830824 CTTAAAGCATGGTTGGAACATGG + Intronic
1100644801 12:96517760-96517782 CTGAAAGGATGCTGGCAACCTGG + Intronic
1101256886 12:102987439-102987461 CAGGAAGGATGGTAGGAACTTGG + Intergenic
1101606955 12:106254301-106254323 CTGAGAGGTTGGTTGGAACCTGG + Intronic
1101888624 12:108691610-108691632 CTCAGAGAATGGTGGGATCTGGG - Intronic
1102234703 12:111287078-111287100 CAGAGAGGCTGGTGGGAACAGGG - Intronic
1102710639 12:114923327-114923349 CTGCAAGGGAGGTGGGAACTGGG + Intergenic
1103852617 12:123943236-123943258 CTGCAACGATGATGGGAGCTGGG + Intronic
1105507370 13:21022007-21022029 CTGAAAGTATAGTGGGCCCTGGG + Intronic
1109664038 13:65506244-65506266 CTGAAAGGAGGGTTGGAAAGGGG + Intergenic
1112371943 13:98802009-98802031 CTGGTAGGATGGTGAGGACTCGG + Intronic
1112399791 13:99066370-99066392 CTGAAATGATTGTGTGTACTGGG - Intronic
1112722438 13:102259972-102259994 CTGAAAGGGTGTCGGGAACGTGG - Intronic
1113668218 13:112155479-112155501 TTTAAAGGATGGAGGCAACTTGG - Intergenic
1113742305 13:112719953-112719975 CTGATATGATTGTGGGCACTTGG - Intronic
1114422072 14:22592683-22592705 CTGAAAGGATGAAGGGATATGGG - Intergenic
1114679787 14:24474837-24474859 CTGAAAGGGTGGTGGGATCCAGG + Intergenic
1115161673 14:30403404-30403426 ATTAAAGGATGGTTGGAGCTAGG - Intergenic
1116464468 14:45215108-45215130 CTGAAATGATGGTGGGATAAAGG + Intronic
1118872464 14:69754705-69754727 GTGAAAGGTTGGTGGGTGCTTGG + Intronic
1119932330 14:78560085-78560107 ATGAAAGGGTGGTAGGATCTAGG + Intronic
1120673145 14:87387536-87387558 GTGAAAGGCTGATGGGAAATTGG + Intergenic
1120696180 14:87648207-87648229 CTGAAATGAAGGTGTCAACTGGG - Intergenic
1120910098 14:89658564-89658586 CTGAAATCAAGGTGTGAACTGGG + Intergenic
1123148220 14:106154667-106154689 CTAAAAATATGGTGAGAACTAGG + Intergenic
1123156971 14:106236088-106236110 CTGAAAATATGGAGAGAACTAGG + Intergenic
1123188052 14:106538846-106538868 CTGAAAATATGGAGAGAACTAGG + Intergenic
1123201324 14:106667117-106667139 CTAAAAATATGGTGAGAACTAGG + Intergenic
1125375006 15:39019489-39019511 CTGAAAGTGTGGTGGGACATTGG + Intergenic
1125859016 15:42980143-42980165 CTGAAAAGATGATGGAAATTAGG - Intronic
1126676809 15:51166731-51166753 CTGACAGGATGGTGGCTACCTGG - Intergenic
1126872227 15:53002100-53002122 ATGAATGGATGGTAGGACCTAGG + Intergenic
1128138542 15:65282436-65282458 CTGAAATGATGCAGAGAACTGGG - Intronic
1128210008 15:65891366-65891388 TTGAAAGGATGTTGTGTACTAGG + Exonic
1128470637 15:67949104-67949126 CTGAAAGGTTAGTGGCAACGTGG - Intergenic
1129176432 15:73843126-73843148 GTCAGAGGGTGGTGGGAACTGGG - Intergenic
1130001129 15:80047817-80047839 CTTAAAGTATAGGGGGAACTTGG + Intergenic
1131557146 15:93409617-93409639 CTGAAAGTAGGGTGGGAGATTGG - Intergenic
1131836050 15:96392286-96392308 CTGTGAGGATGGAGTGAACTTGG + Intergenic
1133917676 16:10124006-10124028 CTGGAAAGAAGGTGGGAACAAGG - Intronic
1135248733 16:20881763-20881785 CTGAAAGGATGTTTGAAATTAGG - Intronic
1135604347 16:23810181-23810203 CAGAAAGGATGGAAAGAACTGGG + Intergenic
1135694164 16:24573381-24573403 CTGAAAGGATGTGGGGAATGAGG + Intergenic
1135758575 16:25118260-25118282 CTGAAAGGATGGCGGTGACGGGG - Intronic
1136008999 16:27350228-27350250 CTGGAAGGGAGCTGGGAACTGGG - Intronic
1136681986 16:31972966-31972988 CTAAAAATATGGTGAGAACTAGG - Intergenic
1136782293 16:32914468-32914490 CTAAAAATATGGTGAGAACTAGG - Intergenic
1136869927 16:33797643-33797665 CTGAAAATATGGAGAGAACTAGG - Intergenic
1136887493 16:33939383-33939405 CTAAAAATATGGTGAGAACTAGG + Intergenic
1139993302 16:70957131-70957153 CTGGGAGGGTGGTGGGTACTGGG - Intronic
1140716785 16:77733828-77733850 GAGAAAGGATAGTGGGTACTAGG + Intronic
1140976455 16:80064350-80064372 CTGAAATGAAGGTGGGACATGGG + Intergenic
1141765356 16:86054664-86054686 CTAAAAGGGTTGTGGGATCTGGG + Intergenic
1203084958 16_KI270728v1_random:1178455-1178477 CTAAAAATATGGTGAGAACTAGG - Intergenic
1203102245 16_KI270728v1_random:1318412-1318434 CTGAAAATATGGAGAGAACTAGG + Intergenic
1143095234 17:4475338-4475360 CTGGAGGGATGGTGGGGCCTGGG + Intronic
1143585546 17:7848633-7848655 CTGAGAGGGTGGAGGGAACTTGG - Exonic
1147815637 17:43208013-43208035 CTGAAAGAAAGCTGGGAACTAGG + Intronic
1147967998 17:44204362-44204384 CTCAAAGGATGGTGGTAAGTGGG + Intergenic
1148353643 17:46959138-46959160 CTGATGAGATGGTGGGAAGTAGG + Intronic
1148969530 17:51467706-51467728 CTGAAATGAGGTTGGAAACTCGG - Intergenic
1149403244 17:56320627-56320649 CTGAAAGGAGGGTGGCAGCCAGG + Intronic
1149734655 17:58981317-58981339 CTGAAGGGATGGTGGGAAGGGGG - Exonic
1149787259 17:59446457-59446479 GTGAAAGGATGTTGGGGAATAGG + Intergenic
1150645730 17:66976456-66976478 CTGGAAGGAGGGAGGGAAGTTGG - Intronic
1151408808 17:73907205-73907227 ATGAAAGGATGGTGGGTAGTGGG + Intergenic
1152881041 17:82815445-82815467 GTGAAACCAGGGTGGGAACTGGG + Intronic
1154079239 18:11238009-11238031 CTGAAAGGATGGCAGGACATAGG + Intergenic
1155542516 18:26883210-26883232 ATGAACGGGTGGAGGGAACTGGG + Intergenic
1157831660 18:50861893-50861915 CTGACAGAATGGTGCCAACTGGG + Intergenic
1160142957 18:76341740-76341762 CTGAAAGGGTGGTGGAAAGAAGG - Intergenic
1160576962 18:79861728-79861750 CTGAAAGGAAAGAGGGAACAGGG - Intergenic
1161056751 19:2194621-2194643 CTGACAGGAGGGTGGGAGCGGGG - Intronic
1161229805 19:3168260-3168282 CTGAAAGGATCCAGGGAACCTGG - Intergenic
1161438362 19:4277467-4277489 CTGAAAGGGTGGGGGGAAGCGGG + Intergenic
1166547383 19:43641356-43641378 CAGAAAGGATACTGGGAGCTGGG - Intergenic
1166975265 19:46601868-46601890 CTGAGAGGATGCGGGGAACGGGG + Intronic
1167067523 19:47197981-47198003 GTGAGAGGATGCTGGGAACATGG - Intronic
1167163470 19:47782136-47782158 CTCAAAACATGCTGGGAACTTGG - Intronic
1168639311 19:58020219-58020241 CTGAAAGAAGGATGGGAACTGGG + Intergenic
926079855 2:9976323-9976345 CCTAAAGGATAGTGGGAACCAGG + Intronic
928767478 2:34664463-34664485 CCGAAAGAATGGTGAGAATTTGG - Intergenic
928819998 2:35350126-35350148 CAGACAAGATGGTGGGGACTAGG + Intergenic
928826511 2:35428022-35428044 CTGAAAAGGTGCTGCGAACTAGG + Intergenic
929706674 2:44220057-44220079 CTAAAAGGATGGTGGTAATTTGG + Intronic
931587813 2:63847429-63847451 CAAAAAGCTTGGTGGGAACTAGG - Intronic
931803880 2:65785873-65785895 CTGAAAGGGTGGAGGGAGCAAGG + Intergenic
932864134 2:75324135-75324157 TTGAAAAAATGGTGGAAACTAGG + Intergenic
935360737 2:102244515-102244537 ATGAATGAATGATGGGAACTTGG + Intergenic
937798465 2:126053179-126053201 CATAATGGATGGTGGGAACTTGG - Intergenic
938279571 2:130054383-130054405 GTGAGAGGATGGTGGGTATTAGG - Intergenic
938330516 2:130445093-130445115 GTGAGAGGATGGTGGGTATTAGG - Intergenic
938359429 2:130676410-130676432 GTGAGAGGATGGTGGGTATTAGG + Intergenic
938435827 2:131283059-131283081 GTGAGAGGATGGTGGGTATTAGG + Intronic
938655996 2:133434702-133434724 CTGGAATGATGTTGGGTACTGGG - Intronic
938661064 2:133487743-133487765 CTGAGAGGATGGTGAGAAAGTGG + Intronic
939958904 2:148549108-148549130 CTGAGAGGCTGGCGGGAATTGGG - Intergenic
940238862 2:151541563-151541585 CAGAAATGATGGTGATAACTTGG - Intronic
941490460 2:166137158-166137180 GTGAAGGGCTGGTGGGAACTGGG + Intergenic
944360070 2:198843838-198843860 CTGAAAAGATGGAGGGCAATGGG - Intergenic
946716358 2:222557972-222557994 ATGAAAGGATGGTGACACCTCGG + Intronic
947354326 2:229276342-229276364 CTGAAAAGAAGATGGGAATTGGG + Intergenic
947667879 2:231918609-231918631 CTGCAAGGGTGGTGGGAGATAGG - Intergenic
948659888 2:239500567-239500589 GTGACACGAGGGTGGGAACTGGG - Intergenic
948804968 2:240449729-240449751 CTGAAAGGATGGCGGGCACCAGG - Exonic
1170272020 20:14538042-14538064 CTAAAATAATGGTGGGAACATGG - Intronic
1172074673 20:32285550-32285572 CTGAAAGGATGGTGGGAACTGGG + Intronic
1172965052 20:38828604-38828626 CTGCAGGGATGGTGGCAACAAGG + Intronic
1173131274 20:40396024-40396046 TTGAAAGGATGGTGGAAAAGGGG + Intergenic
1173326112 20:42035168-42035190 CTGAGAGGTCAGTGGGAACTAGG - Intergenic
1175499063 20:59436660-59436682 CTGTTAGGTTGGGGGGAACTGGG + Intergenic
1175510027 20:59517789-59517811 GTGAAAGGAAGGAAGGAACTTGG - Intergenic
1176282706 20:64323657-64323679 CTAAGATGCTGGTGGGAACTGGG - Intergenic
1178665420 21:34542386-34542408 CTGAAAGCATGGTGGGCAACTGG - Intronic
1180870523 22:19144201-19144223 CTGGAAGGATGGTGGCAAAGAGG - Intronic
1181439364 22:22927818-22927840 CTGCACAGATGGTGGGCACTGGG + Intergenic
1181595747 22:23913520-23913542 CAGAAAGGTGGGTGGGAAGTGGG - Intergenic
1182737962 22:32544617-32544639 CAGAAAGAAGGGTGAGAACTGGG - Intronic
1183165974 22:36147705-36147727 CTGAAAGGATGAAGGAAACCAGG + Intronic
1183698565 22:39437177-39437199 CTGAAAGGATGGTGGGCCCAAGG + Intergenic
1185004721 22:48269001-48269023 CTGAAGGGTGGGTGGGACCTTGG - Intergenic
1185206432 22:49541630-49541652 CAGAAAAGATGGTGGGAAGGGGG - Intronic
949950899 3:9227943-9227965 TTGAAAGGATGATGGTAAGTCGG + Intronic
950891563 3:16409043-16409065 ATAAAAGGAAGGTGGGATCTGGG + Intronic
952970564 3:38648320-38648342 CCTGAAGGATGGTGGGAACCTGG + Intronic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
956747105 3:72318854-72318876 CTTACAGGATGGTCGGAGCTGGG + Intergenic
956879646 3:73497953-73497975 CTGAAAGGGTGGTAGGGTCTGGG + Intronic
957947582 3:87084739-87084761 CGACATGGATGGTGGGAACTTGG + Intergenic
960185911 3:114638654-114638676 CAGAAAGGAAGGGGGGAATTTGG + Intronic
963112111 3:141696470-141696492 CTGAAAGGACTGTTGTAACTTGG - Intergenic
963353923 3:144186459-144186481 CTGAGAAGAAGGTGGGAAGTGGG - Intergenic
963609312 3:147445100-147445122 CAGAAAAGATAGTGGGTACTGGG - Intronic
965427444 3:168545162-168545184 CTGCAAAAATGGTGGTAACTAGG - Intergenic
965612317 3:170557345-170557367 CAGAAAGCAAGGTGGGAAATCGG + Intronic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
968747408 4:2367430-2367452 CTGAAAGGGTGGTGGGGATGGGG + Intronic
969778696 4:9379769-9379791 CTGAAAAACTGGTGGGTACTGGG - Intergenic
969924533 4:10573887-10573909 CTGAAAGGATGATGAGCATTTGG - Intronic
972426396 4:38937256-38937278 CTGAAAGCATGGTGGTATCAGGG + Intronic
974303066 4:60095167-60095189 ATAAATGGATGGTGGGAATTAGG - Intergenic
974954147 4:68617746-68617768 CAGAAAGGAAGGTTGGAGCTGGG - Intronic
974991645 4:69098779-69098801 CTGAAAGAAAGATGGGAAATGGG + Intronic
975000011 4:69212460-69212482 CTGAAAGAAAGATGGGAAGTAGG - Intronic
975005761 4:69282753-69282775 CTGAAAGAAAGATGGGAAGTAGG + Intronic
975014170 4:69391702-69391724 CTGAAAGAAAGATGGGAAGTAGG + Intronic
975015427 4:69411088-69411110 CTGAAAGAAAGATGGGAAGTAGG + Intronic
976318852 4:83688124-83688146 ATGAAAGGATGGTTGCAACCTGG - Intergenic
979172915 4:117624413-117624435 CTGAAGGGATGGAGGAATCTGGG + Intergenic
979229735 4:118334432-118334454 CTTCAAGGATGATGTGAACTGGG - Intronic
979290191 4:118971404-118971426 CTAAAAGGATGGTGGGATGTAGG - Intronic
980795323 4:137675052-137675074 CTGAGAGGATGTGGAGAACTAGG - Intergenic
980808802 4:137848890-137848912 CTGAGAGGATGTGGAGAACTAGG + Intergenic
980917043 4:139043292-139043314 CTGATAGGTGGGTGGGTACTAGG - Exonic
981248698 4:142572421-142572443 CTGAAGAGTTGGTGGGAAGTTGG + Intronic
981697140 4:147570283-147570305 CTTAAAGGAAGATGGAAACTTGG - Intergenic
982108088 4:152028768-152028790 CTGGAAGGCTGGTGGGAAGAAGG + Intergenic
984549512 4:181144064-181144086 ATGAAAGCATGGTGGGGATTGGG - Intergenic
985073723 4:186192080-186192102 CTGATCGGAGGGTGGGAACGGGG - Intronic
985501476 5:250352-250374 CTGTAGGTATGCTGGGAACTAGG - Intronic
985929820 5:3048203-3048225 TTGAAAGGATGGTGGGATGGAGG + Intergenic
986226268 5:5817399-5817421 CTGAAAATATGGTGGGGACATGG + Intergenic
987342975 5:16954723-16954745 CTAAATGTATGGTGGGATCTTGG + Intergenic
987773815 5:22338433-22338455 CTGAGAGGGTGGTGGGAAACTGG + Intronic
988840747 5:35081399-35081421 CTGACACGATGGTGGGGACATGG - Intronic
988996739 5:36722234-36722256 CTGAGAGAATGGTGGGACCAGGG - Intergenic
989333523 5:40287978-40288000 TTGAAAGGAAGGTGGGTAATAGG - Intergenic
990461854 5:56037998-56038020 CTCAAAGGAAGGTGGGAGCAGGG - Intergenic
991245885 5:64507455-64507477 CTGAAAGGGTGAGGGGAAGTAGG + Intronic
992209881 5:74468505-74468527 CTAAAAGTATGGTGTGGACTGGG - Intergenic
996470636 5:123856077-123856099 CTGGAAGAATGGTGGGAATAAGG - Intergenic
996540903 5:124629424-124629446 CTGAGGGGATGGTGGGGGCTGGG + Intergenic
996593769 5:125178428-125178450 CTGAAAGGATTTTGGAAAGTTGG + Intergenic
996791789 5:127300952-127300974 GTGAAAGGAGGGTGGAAAGTGGG - Intronic
997599943 5:135132291-135132313 CTGCATGGGTGGTGGGAAGTGGG - Intronic
997631369 5:135371551-135371573 CACCAAAGATGGTGGGAACTAGG + Intronic
998823389 5:146077045-146077067 CTAAAAGGATGATGGGAAATTGG - Intronic
999742467 5:154566624-154566646 CTGTATGGAAGGAGGGAACTTGG - Intergenic
1000109249 5:158092122-158092144 CTGAAACGATGGTGGGGTCTAGG - Intergenic
1000561429 5:162794011-162794033 CTGAGAAGTTGGAGGGAACTGGG + Intergenic
1001655100 5:173343260-173343282 TTGCAAGGATGTTGGGAACGAGG + Intergenic
1003065185 6:2898718-2898740 GTGGAAGAATGGTGTGAACTCGG + Intronic
1005287594 6:24345413-24345435 CTGAAAAGTTTGTGGGAACCCGG - Intronic
1006610672 6:35292517-35292539 CTGTGAGGGGGGTGGGAACTGGG - Intronic
1006611290 6:35295986-35296008 CTGAAAGGATGGAGGGACCCAGG - Intergenic
1008535258 6:52502519-52502541 CCAGAAGGATGGTGTGAACTCGG - Exonic
1012359404 6:98358662-98358684 CAGCAAGGATGGTGGGAAGGAGG + Intergenic
1012378493 6:98590901-98590923 AAGAAAGGATGATGGGATCTGGG + Intergenic
1013714807 6:112946136-112946158 CTGAAAGGAAGGATGGGACTAGG - Intergenic
1015150671 6:130033181-130033203 ATGAAAGGATGACGGGAGCTGGG + Intronic
1015505603 6:133983539-133983561 CTGAACGGCTGGTGGGGAGTGGG + Intronic
1015886357 6:137922538-137922560 CTCGAAGGGTGGTGGGAAGTGGG + Intergenic
1016002914 6:139060631-139060653 CTATAAGTATTGTGGGAACTAGG - Intergenic
1016158629 6:140846530-140846552 CTTAAAAGATGGTGGCAATTTGG + Intergenic
1019894124 7:3970377-3970399 TTGACAGAATAGTGGGAACTTGG - Intronic
1020224653 7:6271240-6271262 CAGCCAGGATGGTGGGAAGTTGG - Intronic
1020355475 7:7271081-7271103 CCCAAAGGATGGTGGGAAGAAGG + Intergenic
1020816593 7:12913060-12913082 CTGAAAGGAAGGGGGAAAATTGG + Intergenic
1021422282 7:20459409-20459431 CTGAAAGAATGGTTAGATCTCGG + Intergenic
1022075623 7:26966878-26966900 CTGTAAGGATGGTGGGAGTGGGG + Intronic
1024249467 7:47495437-47495459 CTGGAAGTATGGTGGGCACAGGG + Intronic
1025157546 7:56622023-56622045 CTTAAAGAATGATGAGAACTTGG + Intergenic
1027723100 7:81769774-81769796 CAGAAAGGATGCTGGGAATAGGG + Intronic
1029935186 7:104417024-104417046 GTGAAAGAATGTTGGGAAGTGGG - Intronic
1031552988 7:123137682-123137704 CTGACAGCAGGGTGGCAACTGGG - Intronic
1031927371 7:127651656-127651678 CTAAAAGTATGGAGAGAACTTGG - Intergenic
1033508522 7:142030569-142030591 CTGAAAGGAGACTGGGAACTGGG - Intronic
1033813348 7:145043847-145043869 CAGATGGGATGGTGGGATCTAGG + Intergenic
1034009820 7:147517398-147517420 CTAAAAGGATGGGGTGAACTTGG + Intronic
1035444683 7:158932264-158932286 CTCAAAGGATGGGGGCAGCTTGG + Intronic
1035528455 8:332917-332939 CTGAAATCAGGGTGGGAACAGGG - Intergenic
1035609364 8:949670-949692 CTGCAAGGGGGGTGGGAACGAGG - Intergenic
1036276143 8:7353742-7353764 CTGAAAAACTGGTGGGTACTGGG - Intergenic
1036345205 8:7956604-7956626 CTGAAAAACTGGTGGGTACTGGG + Intergenic
1036623630 8:10446020-10446042 CTGGAAGGATGGAGGGAGGTGGG + Intergenic
1036840537 8:12117372-12117394 CTGAAAAACTGGTGGGTACTGGG + Intergenic
1036862336 8:12363616-12363638 CTGAAAAACTGGTGGGTACTGGG + Intergenic
1039564281 8:38539065-38539087 ATGAAAGGATAATGGGAAGTGGG - Intergenic
1039982167 8:42416927-42416949 CTGCAAGGTGGGTGGGATCTGGG + Exonic
1040374349 8:46809422-46809444 CTTAAAGAATGGTAAGAACTTGG - Intergenic
1041185341 8:55294389-55294411 CTGAAAAGGTGGTAGGAACACGG - Intronic
1042547190 8:69961303-69961325 CTGAGAGGAGGGTGGGAATGGGG - Intergenic
1042745111 8:72098787-72098809 CTGAAAGAATGGAGGGAAGCTGG - Intronic
1043088297 8:75865561-75865583 ATCAAAGGATGGTTGGAGCTAGG - Intergenic
1044739099 8:95307296-95307318 CTGAAAAAATGGTAAGAACTTGG + Intergenic
1045361457 8:101437420-101437442 CTGAAATAATCGAGGGAACTCGG - Intergenic
1045918530 8:107502444-107502466 CTAAAAGGAGGGAGGGCACTTGG + Intergenic
1046842671 8:118877512-118877534 CTAAAAGCACAGTGGGAACTGGG + Intergenic
1046849838 8:118959759-118959781 CTGAACACATTGTGGGAACTTGG - Intergenic
1046850747 8:118969943-118969965 CTGAAATGAGGGTGTGGACTTGG - Intergenic
1047274410 8:123395123-123395145 CTGAGAGAAGGTTGGGAACTTGG - Intronic
1050089558 9:2003767-2003789 CTGAAAGGATGTGGTGAAATTGG + Intergenic
1050426167 9:5515107-5515129 CAGAAATGCTTGTGGGAACTTGG - Intronic
1051716882 9:19994394-19994416 CAGAAAGGAGGGTGAGAGCTTGG - Intergenic
1052029372 9:23610975-23610997 ATGAAAGGAAGGAAGGAACTAGG + Intergenic
1053535432 9:38920714-38920736 GTGGGAGAATGGTGGGAACTTGG + Intergenic
1054207652 9:62145118-62145140 GTGGGAGAATGGTGGGAACTTGG + Intergenic
1054630699 9:67443236-67443258 GTGGGAGAATGGTGGGAACTTGG - Intergenic
1055303071 9:74902395-74902417 GTGTAAGGATGGAGGGAACCCGG - Intergenic
1055766353 9:79667656-79667678 GTGAAAGGAAGGTGGGGAGTTGG + Intronic
1055968576 9:81889115-81889137 CTAAAAGTATCATGGGAACTTGG + Intergenic
1056319049 9:85419502-85419524 ATGAAAGATTGGTGGGAAATTGG - Intergenic
1056690034 9:88800175-88800197 TTGCAAGGATGTTGGGAGCTAGG - Intergenic
1057978578 9:99634322-99634344 CTGAGAGCATGGTGGGAATTAGG - Intergenic
1061710434 9:132483647-132483669 CTGACAGTATGGTGGGAGCTGGG - Intronic
1062153276 9:135032373-135032395 CTGAATGGATGGTGGGCATGAGG - Intergenic
1062166576 9:135110760-135110782 CTGAATGGGTGGTGGGAAAGAGG - Intronic
1062475809 9:136726614-136726636 CTGAAGGGATAGTGGGAAGGTGG - Intergenic
1188290353 X:28380004-28380026 CTGAAACTATAGTGGAAACTGGG + Intergenic
1198437767 X:136633718-136633740 GTGAGAGGATGGGGGGAATTGGG + Intergenic
1199496774 X:148460872-148460894 CTAAAAGTAGGCTGGGAACTGGG + Intergenic
1199590969 X:149468164-149468186 AAGCAAGGATGCTGGGAACTAGG + Intergenic