ID: 1172079249

View in Genome Browser
Species Human (GRCh38)
Location 20:32326300-32326322
Sequence CAGCTTGGACAACGAGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172079245_1172079249 4 Left 1172079245 20:32326273-32326295 CCTGGTCAGTTAGAATGGGAAAT 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1172079249 20:32326300-32326322 CAGCTTGGACAACGAGCCATGGG 0: 1
1: 0
2: 0
3: 1
4: 64
1172079242_1172079249 16 Left 1172079242 20:32326261-32326283 CCTGCTTTTTATCCTGGTCAGTT 0: 1
1: 0
2: 1
3: 15
4: 198
Right 1172079249 20:32326300-32326322 CAGCTTGGACAACGAGCCATGGG 0: 1
1: 0
2: 0
3: 1
4: 64
1172079240_1172079249 25 Left 1172079240 20:32326252-32326274 CCACTTAGTCCTGCTTTTTATCC 0: 1
1: 2
2: 3
3: 29
4: 310
Right 1172079249 20:32326300-32326322 CAGCTTGGACAACGAGCCATGGG 0: 1
1: 0
2: 0
3: 1
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172079249 Original CRISPR CAGCTTGGACAACGAGCCAT GGG Intronic
903262219 1:22137451-22137473 CAGATTGGCCAGGGAGCCATGGG - Intronic
903750892 1:25619792-25619814 CAGCTTTGAGAAAGAGCTATGGG - Intronic
906069179 1:43005303-43005325 CAGGTTGAACAAAGAGCCCTGGG + Intergenic
907557242 1:55354909-55354931 CAGCAAGGACAAAGTGCCATGGG - Intergenic
908588354 1:65599390-65599412 CAGATCGGACAACCAGCCAAAGG - Intronic
910194367 1:84624949-84624971 CAGTTTGGACACCCAGCCACCGG + Intergenic
917515494 1:175704399-175704421 GAGCTTGGAGAAAGAGGCATTGG + Intronic
918668175 1:187178291-187178313 CAGCTTGCAAAAGCAGCCATGGG - Intergenic
923915026 1:238492307-238492329 CAGCTTGGAGAACCAGCCTGAGG + Intergenic
1080285392 11:30605799-30605821 CAGCTTCGACAAAGAGTAATGGG + Intergenic
1081863204 11:46345938-46345960 GAGCTTGGAGTAAGAGCCATTGG + Intronic
1089864872 11:121622952-121622974 CAGCATAGGCAAAGAGCCATGGG + Intronic
1090448756 11:126787643-126787665 CAGCTTGGACAGCCAGCCTCCGG + Intronic
1095810344 12:46367936-46367958 CAGCTTGGACAACATAACATAGG + Intronic
1096002418 12:48140823-48140845 CATCATGGACAACGAGCACTCGG - Exonic
1108787971 13:53929434-53929456 CAGCTTGAACAACTATCAATAGG - Intergenic
1121817064 14:96936650-96936672 CAGCTTGGACATGGAGAGATGGG + Intergenic
1121817232 14:96938096-96938118 CAGCTTGGACATGGAGAGATGGG - Intergenic
1202856986 14_GL000225v1_random:57966-57988 CTGCCTGGACAACCAGCCAGCGG - Intergenic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1136564900 16:31063995-31064017 GAGCTTGGAGAGCGCGCCATAGG + Exonic
1137509672 16:49087964-49087986 CTGCATGGTCAACGAGCCACAGG - Intergenic
1142294441 16:89211285-89211307 CAGGTTGGACAATGAGGCATTGG - Intergenic
1146618891 17:34380777-34380799 CAGCCTGGAAAAGGAGACATGGG - Intergenic
1165393925 19:35553730-35553752 CAGATTGGTCAACGAGCCCCTGG - Exonic
928099536 2:28427969-28427991 AAGCTTGGACAACTGGACATTGG + Intergenic
928559227 2:32461504-32461526 AAGCTTGGTCAATGAGCAATTGG - Intronic
928826560 2:35428760-35428782 CAGCTTGGCCAAGAAGCAATGGG - Intergenic
930034648 2:47077922-47077944 CAGCTATGACCAGGAGCCATGGG + Intronic
937944303 2:127318260-127318282 CTGCTTGGCCAAGGAGCCTTTGG - Exonic
941167608 2:162099640-162099662 AAGCATGCACAACTAGCCATTGG - Intergenic
946058362 2:216920303-216920325 CAGCTGGGAGGACCAGCCATGGG + Intergenic
1172079249 20:32326300-32326322 CAGCTTGGACAACGAGCCATGGG + Intronic
1177955847 21:27598113-27598135 CAGCTTGGAGAACTAGACACTGG - Intergenic
1179005680 21:37512091-37512113 CACCATGGACAACAAGCCTTGGG + Exonic
1184542308 22:45134653-45134675 CAGCATGGAAAATGAGCCCTGGG - Intergenic
952510753 3:34052581-34052603 CAGCTTCCACAACAAGCCTTTGG - Intergenic
954419144 3:50409392-50409414 CTACTTGGTCAACCAGCCATGGG - Intronic
954707738 3:52489985-52490007 CAGCTTCCACAAGGAGACATGGG - Intronic
961805437 3:129486011-129486033 CAAGTAGGACAACGAGCCCTAGG + Intronic
990245922 5:53863403-53863425 AAGCTTGGACAACGGAACATGGG - Intergenic
991632896 5:68674523-68674545 CACCTTGGACAACTAGCAGTGGG - Intergenic
993358790 5:86947286-86947308 CAGCTTCCACAAGAAGCCATGGG - Intergenic
995108421 5:108400939-108400961 CAGATTGGATAAAGAGTCATTGG + Intergenic
1001158362 5:169292624-169292646 CAACTTGGATAAAGATCCATAGG + Intronic
1002475262 5:179461648-179461670 CAGCATGGCAGACGAGCCATCGG - Intergenic
1004569454 6:16831353-16831375 CATCTTGGGCACCAAGCCATGGG - Intergenic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1006093840 6:31643936-31643958 CATCTGGGCCAACGAGGCATTGG + Exonic
1007933566 6:45713817-45713839 CAGCTTGGAGAACCAACCTTGGG + Intergenic
1011988070 6:93475216-93475238 CAGCTTTGACAAAGGGCCAGAGG + Intergenic
1012334154 6:98032947-98032969 CAGCATGGACAAAAAGCCAGAGG + Intergenic
1021401990 7:20219915-20219937 CAGCTGGGACAGTGAGTCATTGG - Intergenic
1024749923 7:52453599-52453621 CATGTTTAACAACGAGCCATTGG - Intergenic
1032840922 7:135712971-135712993 CAGCCTGGACAGCTAGCCAAGGG - Intronic
1033977166 7:147116513-147116535 CAGCTGGGACAACCTGCCCTGGG + Intronic
1034161656 7:148998279-148998301 CAGCTTGGAGAAGGAGTCGTGGG - Intergenic
1035655313 8:1300945-1300967 CAGAGTGGACACCGAGCCACAGG - Intergenic
1043206228 8:77445245-77445267 CAAGTTGAACAAAGAGCCATAGG - Intergenic
1046956613 8:120068948-120068970 CTGCTTTAACAAAGAGCCATGGG + Intronic
1047830085 8:128619840-128619862 CTGCTAGGAAAACGAGCAATTGG - Intergenic
1049382306 8:142323405-142323427 CAGAGTGGACAGTGAGCCATCGG + Intronic
1054748655 9:68881813-68881835 CTGCTTGGGCAACCAGCTATGGG + Intronic
1056692942 9:88823653-88823675 CAGCTTGGACCAAGAACCAAGGG + Intergenic
1060027390 9:120184762-120184784 CACCTTGGACAACTTGCCTTTGG - Intergenic
1200519716 Y:4195710-4195732 CAGCTGGCACAACCAGCCCTGGG - Intergenic