ID: 1172083296

View in Genome Browser
Species Human (GRCh38)
Location 20:32358887-32358909
Sequence CGCGCACCCCCCCACTGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172083276_1172083296 18 Left 1172083276 20:32358846-32358868 CCGAGGGGGGCTCCGTGGGGCCC 0: 1
1: 0
2: 0
3: 12
4: 244
Right 1172083296 20:32358887-32358909 CGCGCACCCCCCCACTGGGGGGG 0: 1
1: 0
2: 1
3: 8
4: 77
1172083288_1172083296 -2 Left 1172083288 20:32358866-32358888 CCCGGGGTGGGGGGGGCTCGCCG 0: 1
1: 0
2: 1
3: 29
4: 347
Right 1172083296 20:32358887-32358909 CGCGCACCCCCCCACTGGGGGGG 0: 1
1: 0
2: 1
3: 8
4: 77
1172083289_1172083296 -3 Left 1172083289 20:32358867-32358889 CCGGGGTGGGGGGGGCTCGCCGC 0: 1
1: 0
2: 2
3: 19
4: 221
Right 1172083296 20:32358887-32358909 CGCGCACCCCCCCACTGGGGGGG 0: 1
1: 0
2: 1
3: 8
4: 77
1172083285_1172083296 6 Left 1172083285 20:32358858-32358880 CCGTGGGGCCCGGGGTGGGGGGG 0: 1
1: 0
2: 8
3: 128
4: 959
Right 1172083296 20:32358887-32358909 CGCGCACCCCCCCACTGGGGGGG 0: 1
1: 0
2: 1
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172083296 Original CRISPR CGCGCACCCCCCCACTGGGG GGG Intronic
900438734 1:2643131-2643153 AGCGCCCTTCCCCACTGGGGCGG - Intronic
924770659 1:247077004-247077026 CTTGCACCACCTCACTGGGGTGG + Intronic
1076895368 10:133308846-133308868 CGCGCAGCCCCCGACGGCGGCGG + Exonic
1077022089 11:421450-421472 CACACACCCCCACACAGGGGAGG + Intronic
1077022120 11:421590-421612 CACACACCCCCACACAGGGGAGG + Intronic
1077390659 11:2299351-2299373 CGCGGCCCCTCCCACCGGGGAGG - Intronic
1086437541 11:86797227-86797249 CGACCCCCTCCCCACTGGGGAGG + Intronic
1089442902 11:118531240-118531262 CCCGCCCCCCGCCACCGGGGCGG - Intronic
1097173255 12:57128881-57128903 GGGGGACCCCCCAACTGGGGGGG + Exonic
1101799540 12:108008752-108008774 CCCACACCCCACCTCTGGGGAGG - Intergenic
1103761229 12:123251605-123251627 CACACACCCCCCCACTGGAGAGG - Intronic
1105696833 13:22897606-22897628 CGCGGACCCTACCACTGGGGAGG - Intergenic
1105783442 13:23724347-23724369 CCCCCACCCCCACACTAGGGAGG + Intergenic
1106143834 13:27034737-27034759 GGCCCACACACCCACTGGGGAGG + Intergenic
1107909862 13:45095621-45095643 CACACACCCAGCCACTGGGGAGG + Intergenic
1122738180 14:103855633-103855655 TCCCCACCCCCACACTGGGGAGG - Intergenic
1125611947 15:40977306-40977328 CGCGAAACCCCCAACTGGGGAGG - Intergenic
1128238607 15:66084528-66084550 AACACACCCCCCCACTGGAGAGG + Intronic
1130130134 15:81134182-81134204 CGCGCACCCTCGCCCTGGGGCGG - Intronic
1130275129 15:82472519-82472541 GGCACACCCCCTCACCGGGGTGG + Intergenic
1130467477 15:84199887-84199909 GGCACACCCCCTCACCGGGGTGG + Intergenic
1130496783 15:84473648-84473670 GGCACACCCCCTCACCGGGGTGG - Intergenic
1130589775 15:85204491-85204513 GGCACACCCCCTCACCGGGGTGG + Intergenic
1133018348 16:2955145-2955167 CCCCCACCCCCCCGCAGGGGTGG - Intergenic
1137652068 16:50129129-50129151 TGAGGACCCCCACACTGGGGAGG + Intergenic
1138023117 16:53502770-53502792 CGCGGGCCCCTCCAGTGGGGGGG + Intronic
1141828954 16:86498842-86498864 CGCGCACCCCTCCCCTGGGCTGG + Intergenic
1144583302 17:16472426-16472448 CACGTACCCCTCCAGTGGGGGGG - Intronic
1146182643 17:30707838-30707860 CCCGCACCCCCTCTCTGGGGTGG - Intergenic
1147684110 17:42276621-42276643 CGCGCACCCCCTTTCTGCGGCGG + Intronic
1147842064 17:43378917-43378939 CCCCCTCTCCCCCACTGGGGGGG + Intergenic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1149597868 17:57874767-57874789 CGCCCGCCCCCTCACTGGAGGGG + Intronic
1151707691 17:75779378-75779400 CGCGCTCCCCCTCCCGGGGGAGG - Intronic
1151967103 17:77437183-77437205 CTCGCAGGGCCCCACTGGGGTGG - Intronic
1152523306 17:80872973-80872995 CGGGCCCCCCACCACTGAGGAGG + Intronic
1152866977 17:82729847-82729869 CGCTCACCTCCCCACCGGGTAGG + Intronic
1162976178 19:14207968-14207990 CCCGCACCCCCTCTCTGGGGTGG + Intergenic
1167485973 19:49763172-49763194 CGGGGACACCCCCACGGGGGTGG - Exonic
1167643754 19:50695200-50695222 CGCGCACCCCCTCCCGCGGGAGG + Intronic
924973455 2:152386-152408 CGCCCACTCCCGCACTGTGGAGG + Intergenic
926932447 2:18053897-18053919 GGCCCACCCCCACCCTGGGGGGG + Intronic
927178364 2:20426094-20426116 GGCGCCCACCCACACTGGGGAGG - Intergenic
935671657 2:105561583-105561605 CGCACCGCCCTCCACTGGGGTGG - Intergenic
940883544 2:158969269-158969291 CGCGCACCCCAACACTCCGGGGG - Intronic
948703901 2:239777714-239777736 AGAGCACCCACCCACTGGGGTGG - Intronic
949042385 2:241855289-241855311 CCAGCACCCCCACACTGGGTGGG - Intronic
1169343576 20:4813468-4813490 TGGCCACCCTCCCACTGGGGTGG - Intronic
1171999234 20:31759306-31759328 CTCCCACCACCCCACTGAGGAGG + Intronic
1172083296 20:32358887-32358909 CGCGCACCCCCCCACTGGGGGGG + Intronic
1174246811 20:49188047-49188069 CGCCCACCTCCCCACCGCGGCGG + Intronic
1175552195 20:59824769-59824791 CCCCCGCCCCCCCACTGGTGGGG - Intronic
1176129440 20:63490464-63490486 AGCGCAGCCCCCCACCTGGGAGG + Exonic
1183617452 22:38954321-38954343 CCCCCATACCCCCACTGGGGTGG - Intronic
1183939627 22:41286025-41286047 CGCGCCTCCGCCCTCTGGGGCGG + Intronic
958892554 3:99796643-99796665 AGGGCCCCCTCCCACTGGGGCGG - Exonic
960993285 3:123325377-123325399 CGCTCAGCCCCCCAGTGTGGTGG + Exonic
962164956 3:133038720-133038742 CCCGCACCCTCCACCTGGGGAGG - Intronic
964131066 3:153287433-153287455 AGCTCACCTCCCCATTGGGGAGG - Intergenic
965390281 3:168095717-168095739 CGCGCACCCCCTCCCTTAGGTGG - Exonic
968448054 4:662381-662403 CGCGCACCCCAGCCCTGCGGTGG + Intronic
968660135 4:1795420-1795442 CGCCCACCCCTCCCCCGGGGCGG + Intronic
968829604 4:2926134-2926156 CGTGCACCCTCCCACAGTGGCGG - Intronic
969607606 4:8210310-8210332 CCCCCAACCCCCCGCTGGGGAGG + Intronic
970520530 4:16879448-16879470 GGTGCCCACCCCCACTGGGGAGG - Intronic
984111048 4:175614932-175614954 GGCGCATCCCCCCAATGCGGGGG - Intergenic
988517889 5:31920390-31920412 GCCCCCCCCCCCCACTGGGGTGG + Intronic
1004395579 6:15244854-15244876 CGCGCACGCCCCCACGCGCGGGG - Intergenic
1007477015 6:42125615-42125637 CTCACACCCCCTCACTGGTGAGG - Intronic
1022164222 7:27741645-27741667 CGCGCACCACCACACTGAAGGGG + Intronic
1025261858 7:57425345-57425367 GGAGCCCCCGCCCACTGGGGCGG + Intergenic
1025615590 7:63113938-63113960 GGAGCCCCCGCCCACTGGGGCGG - Intergenic
1026000544 7:66557032-66557054 GGAGCCCCCACCCACTGGGGCGG + Intergenic
1026947589 7:74326340-74326362 CAGGCACCCCACCCCTGGGGAGG - Intronic
1031213318 7:118858780-118858802 CCCGCCCCCCGCCACTGCGGCGG - Intergenic
1032464220 7:132133807-132133829 TGCGCAACCCCCCTCTGGTGGGG - Intronic
1035252508 7:157606336-157606358 CCCCCACCCCCACGCTGGGGAGG - Intronic
1041166251 8:55095696-55095718 TGCCCAAGCCCCCACTGGGGTGG + Intergenic
1044581997 8:93833753-93833775 CGCCCACTTCCCCAATGGGGCGG + Intergenic
1049234385 8:141505085-141505107 GGAGCACCCCACCACTGGAGTGG - Intergenic
1049290133 8:141797452-141797474 CGCTCCCACCTCCACTGGGGGGG - Intergenic
1056712834 9:89005060-89005082 TGCGCACCCCTGCAGTGGGGAGG - Intergenic
1060920093 9:127414436-127414458 CACCCCCCCCCCCACCGGGGTGG + Intergenic
1061540911 9:131277511-131277533 CGCGCACGCCCCCACTCGGGCGG + Intergenic
1062546318 9:137065147-137065169 GGAGCCCCCGCCCACTGGGGCGG - Exonic
1192438136 X:71155132-71155154 CCCGCACCCACCCCCTGGGCTGG + Intronic
1200150721 X:153950096-153950118 CACACAGCCCCCCACGGGGGTGG - Intronic