ID: 1172083336

View in Genome Browser
Species Human (GRCh38)
Location 20:32358985-32359007
Sequence AGGGGTGGGGAGCGCTCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172083324_1172083336 14 Left 1172083324 20:32358948-32358970 CCATCTTCCTTTAAGAACGGGAC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1172083336 20:32358985-32359007 AGGGGTGGGGAGCGCTCCGCCGG 0: 1
1: 0
2: 0
3: 15
4: 243
1172083325_1172083336 7 Left 1172083325 20:32358955-32358977 CCTTTAAGAACGGGACAGCCCCG 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1172083336 20:32358985-32359007 AGGGGTGGGGAGCGCTCCGCCGG 0: 1
1: 0
2: 0
3: 15
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172083336 Original CRISPR AGGGGTGGGGAGCGCTCCGC CGG Intronic
900136608 1:1120347-1120369 AGGGGTGGGGCGGGCACCCCAGG + Intergenic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901171875 1:7265014-7265036 AGGGGTGGGGAGGGAGCCTCAGG + Intronic
901511774 1:9721256-9721278 AGAAGTGGGGAGCGCCCAGCTGG - Intronic
902372105 1:16013508-16013530 TGGGGAGGGGAGCTCTCCGGAGG - Intergenic
902702571 1:18182738-18182760 AGGGGTGGGAAGTGCTCAGAGGG - Intronic
902809132 1:18878400-18878422 AGGGAAGGTGAGCGCTCCTCAGG - Intronic
903065393 1:20696684-20696706 AGGGGTGGGGCGGGCTGTGCAGG - Intronic
903191559 1:21659392-21659414 GGGGGTGGCGAGCGCGCGGCCGG - Intronic
905369291 1:37474668-37474690 AGCGGCAGGGAGCGCTCCGGCGG + Intronic
905401912 1:37709902-37709924 AGGTGTTGGGGGCGCTCTGCTGG - Intergenic
905515309 1:38558231-38558253 GGGGGAGGGCAGGGCTCCGCTGG - Intergenic
911440523 1:97920826-97920848 GGTGGTGGGGAGTGCTCTGCGGG - Intronic
912729493 1:112089665-112089687 AGGAGTGAGGAGTGCTCAGCAGG + Intergenic
913962721 1:143352722-143352744 AGGGGTGGGGAGTCCTGGGCCGG - Intergenic
914057076 1:144178307-144178329 AGGGGTGGGGAGTCCTGGGCCGG - Intergenic
914122070 1:144788059-144788081 AGGGGTGGGGAGTCCTGGGCCGG + Intergenic
914909620 1:151774031-151774053 AGGGTTGGGGAGGGATCCGGAGG + Exonic
916497252 1:165356753-165356775 GGGGGTGGGGTGCGCTGGGCGGG + Intergenic
921032427 1:211345349-211345371 AGGGGGGGGGAGCGCAGGGCTGG - Intronic
921850528 1:219928472-219928494 CGGGGTGGGCTGCGCTCCCCTGG - Exonic
922566605 1:226605471-226605493 AGGGGTGAGGACCCCTCCACAGG - Exonic
922686207 1:227640389-227640411 AGGGGTGGGCAGCAGTCTGCTGG + Intronic
922769367 1:228173740-228173762 AGGGATGGGCAGGGCCCCGCAGG - Intronic
924795103 1:247287348-247287370 AGGGGTGGGCAGCAGTCTGCTGG - Intergenic
1063381288 10:5587792-5587814 AGGAGGGGCGAGCGCTCCCCAGG + Intergenic
1067064287 10:43095027-43095049 GGGGGTGGGGAGAGCTCTGTGGG + Intronic
1067830836 10:49610323-49610345 AGGGGAGGGGAGCGCAGCGGCGG + Exonic
1067937212 10:50623101-50623123 AGAGAAGGGGAGCGCTCCTCGGG + Intronic
1069782093 10:70963257-70963279 AGGGGTGGGGAGGGGACCACGGG + Intergenic
1069834539 10:71300482-71300504 AGGGGAGGGGAGTCCTCCACGGG + Exonic
1070329118 10:75405464-75405486 AGGGGTGGGGAGGCCCCCGGGGG - Intergenic
1073178534 10:101570483-101570505 CGGGATGGGGAGTGCTCCGTGGG - Intergenic
1074465863 10:113680305-113680327 AGGGGTGGGGACCGGAACGCAGG - Intronic
1074618582 10:115093801-115093823 GGGGGTGTGGAGGGCTCGGCCGG + Exonic
1075441046 10:122479681-122479703 AGGTGTGGGGAGAGGTCTGCAGG + Intronic
1075698072 10:124450090-124450112 CGGGGCGGGGAGAGCGCCGCGGG + Exonic
1075736880 10:124669684-124669706 AGTGGTGGGGAGCTCACCCCAGG + Intronic
1075783506 10:125032623-125032645 AGGGGTGCGCTCCGCTCCGCAGG - Intronic
1076469403 10:130708157-130708179 AGGGGTGGGGGGGGCTCTGTGGG + Intergenic
1076486682 10:130824788-130824810 AGGAGTGGGGAGGCCTCCCCTGG - Intergenic
1076782111 10:132730186-132730208 GGTGGTGGGGAGGGCCCCGCAGG - Intronic
1077008067 11:368563-368585 AGTGGTGGGGCCGGCTCCGCGGG - Intergenic
1077340038 11:2022148-2022170 AGGGGAGCTGAGCGCTCTGCTGG + Intergenic
1079133436 11:17762764-17762786 AGGGGTGCAGAGCACTCAGCAGG - Intronic
1083900466 11:65640939-65640961 CGGTGTGGGGAGCCCTCGGCGGG + Exonic
1084526897 11:69703575-69703597 TGGGGTGGGGCGCGCGCAGCGGG + Intronic
1084526904 11:69703594-69703616 CGGGGTGGGGTGCGCGCGGCGGG + Intronic
1085165853 11:74398556-74398578 AGGCGTGGGGAGCGCGCTCCCGG - Intergenic
1089207121 11:116773145-116773167 AGGGCTGTGGAGCGCCCCGAAGG - Intergenic
1202823023 11_KI270721v1_random:77337-77359 AGGGGAGCTGAGCGCTCTGCTGG + Intergenic
1091793244 12:3283375-3283397 TGGGCTGGGGTGCGCTCCGGAGG + Exonic
1092229125 12:6766996-6767018 AGGGGTGGGGACGGCTGCGGGGG - Intronic
1092239686 12:6829045-6829067 GGGGCTGGGGAGCGTACCGCGGG + Intronic
1092537378 12:9402867-9402889 AGGGGTGGGAGGCACGCCGCGGG + Intergenic
1093920520 12:24854970-24854992 AGGGGCGGGGGGCACTCAGCAGG - Intronic
1094498372 12:31003268-31003290 AGGTGTGGGGACCGTTCTGCAGG + Intergenic
1094624066 12:32106620-32106642 AGCGGTGGGGCGCGCGCGGCGGG - Intergenic
1096178618 12:49538914-49538936 AAGGGAGGGGAGCCCTCCGCGGG + Intergenic
1096848210 12:54419298-54419320 AGGCGGGGGGAGGGCTCAGCCGG - Exonic
1096977572 12:55708096-55708118 AGGGGAGGAGAGCGCCGCGCAGG - Intronic
1102677560 12:114668865-114668887 AGGGGCGGGGTGCGCTGCGGGGG - Intergenic
1102904372 12:116662792-116662814 AGGGCTGTGGAGGGCTCTGCTGG + Intergenic
1106516998 13:30464889-30464911 AGGGGCGGGGGGCGCGCGGCCGG + Intronic
1108408319 13:50125461-50125483 TGGGGCGGGGAGCGCTGCGCCGG - Intronic
1108676259 13:52739824-52739846 AGGGGTGGGGACCGCTGGGCTGG - Intergenic
1113063388 13:106349440-106349462 AGGGACCGGGAGCGCTCCCCGGG + Intergenic
1113200966 13:107867255-107867277 GGGGGGAGGGAGCGCCCCGCCGG - Intergenic
1113442631 13:110341046-110341068 AGGGGTGGGGAGGGGTGTGCTGG + Intronic
1113493963 13:110713734-110713756 CGGGAAGGGGCGCGCTCCGCTGG - Intronic
1113694331 13:112333160-112333182 AGGGATGGGGAGGCCTCCGTAGG - Intergenic
1113768502 13:112894809-112894831 AGGGGTGGGCAGAGCTCCCGGGG - Intronic
1114502680 14:23182725-23182747 AGGGGAGAGGAGGGGTCCGCGGG + Intronic
1115771469 14:36666808-36666830 AGGGGCCGGGAGCGCTCGTCAGG + Intronic
1118438352 14:65791255-65791277 GGGGGTGGGGAGGGCTGGGCTGG + Intergenic
1119265930 14:73263364-73263386 AGGGGTGGGGAGAGGTCGGGAGG - Intronic
1119872552 14:78029754-78029776 GGGGGTGGGGAGGGGCCCGCCGG - Intergenic
1121926235 14:97929961-97929983 AGGGGTGGGGCGGGCTCTGGTGG - Intronic
1122630024 14:103103501-103103523 GGGGCTGGGAACCGCTCCGCGGG - Intronic
1124251003 15:28106595-28106617 AGGAGCGGGGAGCGCACAGCAGG + Intergenic
1125744976 15:41991831-41991853 AGAGGTGGGAAGCTCTCCTCTGG + Intronic
1125887429 15:43239107-43239129 AGGGGTGGGGTGCTTTCCACGGG + Intronic
1127117467 15:55742734-55742756 GGGCGTGGGGAGCGCGCGGCGGG - Intronic
1128109598 15:65068066-65068088 AGGGCTGCGGAGCCCCCCGCGGG + Exonic
1129710132 15:77816659-77816681 AGGGGTGGGGAGCCCCTGGCTGG + Intronic
1132591514 16:728253-728275 AGGGGCGGGGAGGGCGCCCCGGG + Intronic
1132641658 16:981005-981027 AGGGGGCGGGAGCGCTGGGCGGG - Intronic
1132769360 16:1552324-1552346 AGGGGTGGGGCGCTCTTGGCAGG - Intronic
1133985263 16:10663568-10663590 AGAGGAGAGGAGCGCTCCGGAGG + Intronic
1136237876 16:28925504-28925526 AGCGAGGGGGAGCTCTCCGCAGG - Exonic
1137613601 16:49834819-49834841 GGGGGAGGGGAGCGCACAGCCGG - Intronic
1139356730 16:66371279-66371301 AGCGGTGGGGAGAGCTGCCCAGG + Intronic
1141175205 16:81713997-81714019 AGGGGTGGTGATAGCTCCCCTGG + Intergenic
1141178791 16:81738518-81738540 AGGGCTGGGGAGGCCACCGCGGG + Intergenic
1142139692 16:88467390-88467412 AGGGGTGGGGAGACCTCAGGGGG - Intronic
1142148581 16:88502920-88502942 GGGGGTGGCGAGCGCTCTGAGGG - Intronic
1142631366 17:1228741-1228763 CGGGGTGGGGGGCGCGCGGCGGG + Intronic
1143095694 17:4477167-4477189 GGGGGTGGGGGGCGCTCACCAGG + Intronic
1143174930 17:4950081-4950103 AGGGGTGGGGAGAGGGCGGCGGG + Intronic
1146736418 17:35242701-35242723 AGGCTCGGAGAGCGCTCCGCAGG - Intergenic
1146943612 17:36859981-36860003 AGGCCTGGGGAATGCTCCGCCGG + Intergenic
1147200661 17:38799498-38799520 GGGGGTGGGGATCGGTCCGGGGG - Exonic
1147789808 17:43006708-43006730 AGGGGTGGGGAAGCCTCGGCAGG + Intronic
1151557052 17:74851961-74851983 GGAGGTGGGGAGCGCTTCGGGGG - Intronic
1151729854 17:75904783-75904805 AGGGGTGGGCAGCTCTGCGGGGG - Intronic
1151786161 17:76276012-76276034 GGGGGTGGGGAGAGGGCCGCAGG + Intronic
1152347061 17:79759673-79759695 AGGGGTGTGGAGTCCTCCTCAGG - Intergenic
1152569131 17:81113781-81113803 AGGGGTAGGAAGCCCTCCACTGG - Intronic
1153950501 18:10054145-10054167 AGGGGTGGGGAGGGCTTTGTAGG + Intergenic
1154139589 18:11811208-11811230 AGCCGTGGGGAGGGCTGCGCTGG - Intronic
1154241309 18:12657108-12657130 CGGGGTGGGGAGGGCATCGCAGG - Intronic
1155451580 18:25969253-25969275 AGGGGTGAGGAGCTCTTGGCAGG - Intergenic
1156954154 18:42941339-42941361 AGGGGTGGGGGGCGGTCAGCAGG - Intronic
1160578944 18:79872937-79872959 TGGGGTGGGGACCGCCCCTCCGG + Intronic
1160685080 19:430851-430873 AGGGGTGGGGAGCACAGCCCTGG + Intronic
1160763501 19:797326-797348 GGGGGCGGGGAGAGCCCCGCGGG - Exonic
1160947817 19:1651875-1651897 TGGGGTGGGGAGCGCGCGGGAGG - Intronic
1161029462 19:2051016-2051038 GGGGGCGGCGAGGGCTCCGCGGG + Intronic
1161091220 19:2360990-2361012 AGGGATGGGGAGGGCTTCGGCGG - Intergenic
1161444006 19:4307808-4307830 TGGGGTGGGGAGCCCTCAGGGGG + Intronic
1161560908 19:4971947-4971969 CGGGGCGGGGGGAGCTCCGCAGG + Intronic
1162027764 19:7904104-7904126 CGGGGCGGGGCGCGCGCCGCGGG + Intronic
1162084357 19:8239520-8239542 AGGCCTGGGGAGGCCTCCGCAGG + Intronic
1162158621 19:8696388-8696410 AGGGGAGGGGAGAGTTCTGCAGG + Intergenic
1162567550 19:11452777-11452799 TGGGGTGGGGAGCGGTGCGAGGG + Exonic
1162921638 19:13906526-13906548 GGGGGTGGGGAGGGATCCCCAGG - Intronic
1162929910 19:13952659-13952681 CGGAGTGGGGAGCGCGCCGGAGG + Intronic
1164429231 19:28172426-28172448 AGGCGTGGGGAGCTCTGCACTGG - Intergenic
1165829580 19:38723854-38723876 AGGGGTGGGGAGGGGTCCAGAGG - Intronic
1166039215 19:40191886-40191908 ATGGCTGGGGCGCCCTCCGCAGG - Exonic
1166856186 19:45783605-45783627 AGGGGTGGGAGGCGCTGGGCTGG + Exonic
1167455499 19:49595338-49595360 GGTGGTGGGGAGCCCTCCCCGGG + Exonic
1168056791 19:53868859-53868881 AGGGGAGGGGGGCGCGCCGAGGG - Intronic
1202696559 1_KI270712v1_random:130980-131002 AGGGGTGGGGAGTCCTGGGCCGG - Intergenic
925146192 2:1584814-1584836 TGGGGTGGGCAGGGCTCAGCTGG - Intergenic
925671108 2:6310799-6310821 GGGGATGGGGAGCGCCCTGCTGG - Intergenic
929501474 2:42494221-42494243 AGTGGCGGGGAGGGGTCCGCAGG + Intergenic
930124119 2:47783123-47783145 TGGGGGGAGGCGCGCTCCGCCGG - Exonic
931602742 2:64019721-64019743 GGGGGTGGCGAGGGCTACGCTGG - Intergenic
932342382 2:70974523-70974545 AGGGGTGGGGAGCTCTGCTCAGG - Intronic
932475323 2:72002437-72002459 AGGGGTGGGGAGCGGGCCCGGGG - Intergenic
934277717 2:91588005-91588027 AGGGGTGGGGAGTCCTGGGCCGG - Intergenic
934529223 2:95074851-95074873 CGGGGCAGGGAGGGCTCCGCAGG - Intergenic
937052763 2:118905827-118905849 AGGGCTGGGGAGAGCACCCCGGG + Intergenic
937104043 2:119293952-119293974 AGGGATGGGGAGCACCCAGCAGG + Intergenic
940038017 2:149330433-149330455 GGGGGAGCGGAGCCCTCCGCGGG - Intronic
948101152 2:235374126-235374148 AGGGGTGGTGAGTGCTATGCGGG - Intergenic
948476597 2:238224809-238224831 AGGGGTCGCGGGCGCTCCTCCGG - Intronic
948485672 2:238279392-238279414 AGGGGTGGGTAGCTCACCCCAGG + Intronic
948806957 2:240457136-240457158 AGGGGGAGGGAGTCCTCCGCAGG - Intronic
948866203 2:240776037-240776059 AGGGGCGGGGCCCGCTCTGCTGG + Intronic
949023077 2:241752255-241752277 AGGGCTGGGGTGCGGTCGGCTGG + Intronic
1168757099 20:325509-325531 AGGGGTGGTGCGCGCGCCGGCGG + Exonic
1168973573 20:1947515-1947537 AGGGGTGGGGAGAGGGCCGCAGG - Intergenic
1172083336 20:32358985-32359007 AGGGGTGGGGAGCGCTCCGCCGG + Intronic
1172764937 20:37346252-37346274 AGGGGCGGGGGGCGCTCACCTGG - Exonic
1173498565 20:43536033-43536055 AGGGCTGAGGAGGGCTCAGCGGG + Intronic
1175856356 20:62122848-62122870 CGGGGCGGGGAGGGCACCGCAGG - Intronic
1178351027 21:31873319-31873341 CGGGGTGGGGCGCGGTCCGGCGG - Exonic
1178544177 21:33479645-33479667 AGGGGCGGCGGGGGCTCCGCGGG + Intronic
1178953886 21:37006589-37006611 AGGGGTGCGGAGGGGGCCGCAGG - Exonic
1179559203 21:42202105-42202127 AGGGGTGGGGATCCATCCGTGGG - Intronic
1180154456 21:45971305-45971327 AGGGGTGAGGAGGGCTCAGGAGG - Intergenic
1180190689 21:46161181-46161203 AGGGGTGAGAAGCACTCCGCAGG + Exonic
1180649873 22:17369297-17369319 AGGGGCGGGGCGCGCGCCCCCGG - Intronic
1180969961 22:19810203-19810225 TGGGGTGGGGAGGGCTGCGGAGG + Intronic
1180972852 22:19824664-19824686 AGGGGTCCAGAGCGCTCCTCTGG + Intronic
1181151040 22:20883763-20883785 AGAGGTGGGGAGGGCTCGGCTGG - Intronic
1182355471 22:29720616-29720638 GGGGGCGGGGGGCGGTCCGCAGG + Intronic
1182755557 22:32676113-32676135 AGGGGCTGGGAGGGCTCCTCAGG - Intronic
1183463342 22:37966419-37966441 AAGGGTGGGGAGGGCTGGGCAGG + Intronic
1183522909 22:38306276-38306298 AGGGGTGGGGGACGCTTCACTGG + Intronic
1183669256 22:39262685-39262707 GGGGGTGGGGAGGCCTCCCCAGG - Intergenic
1184802406 22:46769611-46769633 AGGAGTGGGGAGCGCTTGACTGG + Intronic
1185236499 22:49716593-49716615 AGGGGAGGGGAGCGCTCCAGGGG + Intergenic
954370996 3:50169537-50169559 GGGGGTGGGGAGCCCTTCCCAGG + Intronic
954401291 3:50321187-50321209 AGGGCTAGAGCGCGCTCCGCCGG + Exonic
954757070 3:52846482-52846504 AGCGGTGCCGCGCGCTCCGCTGG - Intronic
961635551 3:128330596-128330618 AGGGGTGAGGAGAGCTGGGCAGG + Intronic
964737024 3:159927934-159927956 AGGAGTGGCGAGGGCTCAGCTGG - Intergenic
966182129 3:177197299-177197321 GGGGGCGGGGAGCGCGGCGCGGG + Intronic
966874576 3:184314872-184314894 GGGGGTGGGGAGCGCAGGGCCGG + Intronic
968288942 3:197524375-197524397 AGGGGTGGAAAGTCCTCCGCTGG + Intronic
968739907 4:2322205-2322227 AGAGGTGGGGAGCGGCCCCCGGG + Intronic
969858505 4:10018673-10018695 TGGGGTGGGGGGCGATCCTCTGG - Intronic
972336051 4:38107911-38107933 AGGGGTGGGGAGAGTTGTGCTGG - Intronic
972484382 4:39527754-39527776 AGGGGACGGGGGCGCGCCGCAGG + Intronic
977716563 4:100190248-100190270 GGGGCCGGGGGGCGCTCCGCGGG - Intronic
978127175 4:105147852-105147874 GGGGGTGGGGAGCGCAGCGTTGG + Intronic
981531959 4:145761935-145761957 GGGAGTGGGGAGGGCTCCGAGGG - Intronic
984761042 4:183363342-183363364 AGGGGTGGGTAGTACTCAGCAGG - Intergenic
985550033 5:528293-528315 AGGGCTGGGGACGGCGCCGCAGG + Intergenic
985574970 5:669771-669793 ACGGGCGGGGAGCTCTCCCCAGG + Intronic
985684634 5:1275568-1275590 AGGGGTGTGGAGGCCTCCCCTGG - Intronic
985891960 5:2723104-2723126 AGAGGTTGGGAGCGCCCTGCAGG - Intergenic
986015389 5:3752955-3752977 CAGGGTGGTGAGCGCTCCGTAGG - Intergenic
987132570 5:14872282-14872304 AGGGCTGGGGAGCGGGGCGCGGG + Intergenic
990184810 5:53201515-53201537 AGGGGTGGGCAGCAGTCTGCTGG - Intergenic
990954793 5:61331522-61331544 GGTGGTGGGGAGAGCTCCCCTGG + Intergenic
992990039 5:82274584-82274606 CGGGGTGGGCAGCTCTCCCCGGG - Exonic
1000659378 5:163919427-163919449 AGGGCTGGGGAGGCCTCCCCAGG - Intergenic
1000888916 5:166781203-166781225 AGGGGTGGGGAGAGCCCATCTGG + Intergenic
1001939352 5:175729599-175729621 AGGAGTGGGGAGCGGTGGGCGGG - Intergenic
1002401755 5:178994975-178994997 AGGGGCGGGGAGCGCTCTGAGGG + Exonic
1002691367 5:181052991-181053013 AGGGGGCGGGGGCGCGCCGCGGG - Intronic
1002697590 5:181100944-181100966 AGGGGTGGGGAGGGGTGGGCAGG - Intergenic
1002777731 6:342955-342977 AGGTGTGGGGAGCTCCCAGCTGG + Intronic
1003651869 6:7968448-7968470 GGGGGCCAGGAGCGCTCCGCAGG - Intronic
1006613417 6:35309594-35309616 AGAGGTGGGGAGCAGTCCTCTGG + Intronic
1007403623 6:41619120-41619142 AGGGGTGGGGTGTGCCCGGCAGG - Intergenic
1010707087 6:79127805-79127827 AGGGGTGGGGAGGCCCCTGCTGG - Intergenic
1011607330 6:89117981-89118003 AGGGGTGGGGGTCGCGCCGGGGG - Exonic
1013459155 6:110358438-110358460 AGCGGCGGGGCGCGCTCGGCAGG - Intergenic
1015603435 6:134932883-134932905 TGCAGTGGGGAGCGCTCAGCTGG + Exonic
1015999668 6:139029559-139029581 AGGGCTGGGGAGCGCGGGGCTGG - Intronic
1016461869 6:144286337-144286359 CTGGCTGGGAAGCGCTCCGCTGG - Intronic
1017324620 6:153131136-153131158 AGGTGTGGGCAGCGCGCCGATGG + Intronic
1018727642 6:166626558-166626580 AGTGGCGCGGAGCGCTCCGCGGG - Intronic
1019039734 6:169093962-169093984 GGGGGTGGGAAGTGCTCCCCAGG + Intergenic
1019349997 7:550127-550149 AGGGGTGGGGTGGGCCCCCCAGG + Exonic
1022813113 7:33888293-33888315 AGGGGTGAGGAGCCGTCAGCTGG - Intergenic
1023269845 7:38450534-38450556 AGTGTTGGGGAGTGCTCCGAAGG - Intronic
1024502783 7:50130708-50130730 AGGTGTGGGGAGGCCTCCCCAGG + Intronic
1025829750 7:65038622-65038644 CGGGGTGGGGAGCGCGCGGCGGG + Intergenic
1025917005 7:65873622-65873644 CGGGGTGGGGAGCGCGCGGCGGG + Intronic
1026732773 7:72925629-72925651 GGCGGTGGGGAGCGCGGCGCCGG - Intronic
1027773989 7:82443246-82443268 GGGGGTGGGGAGCGAGCGGCCGG - Intronic
1032476651 7:132215746-132215768 AGGGGTTGGGAGAGCTTCCCTGG + Intronic
1035133270 7:156675358-156675380 AGGGGTGGGGAGAGGTCAGACGG + Intronic
1035336913 7:158135621-158135643 AGGGGCAGGGAGCGCTCTGGGGG - Intronic
1037273842 8:17156881-17156903 CGGGGTGGGCTGCGCTGCGCTGG - Intronic
1037863656 8:22425567-22425589 AGTGGTTGGGAGCGATCCACAGG + Intronic
1044839222 8:96323617-96323639 AGGCCTGGGGAGCCCTCCACGGG - Intronic
1049414504 8:142489107-142489129 AGAGGTGGGGAGCCCTGGGCAGG + Exonic
1049537562 8:143189452-143189474 AGGGGTGGGGAGAGCCCAGAGGG - Intergenic
1049735468 8:144202620-144202642 AGGGGTGGGGAGGGGAGCGCAGG + Intronic
1053313726 9:37035403-37035425 AGGGCGGGGGAGCGCTCCGTAGG + Intergenic
1056586344 9:87929888-87929910 AGGGGTGGGGAGGAGTACGCTGG - Intergenic
1056610538 9:88123055-88123077 AGGGGTGGGGAGGAGTACGCTGG + Intergenic
1056736530 9:89214745-89214767 AGGGGAGATGGGCGCTCCGCTGG + Intergenic
1057618986 9:96619029-96619051 CGGGGCGGGGGGCGCTCCTCAGG + Intronic
1057836702 9:98451186-98451208 AGGGGTGGGGAGAGGGCTGCAGG + Intronic
1059123450 9:111662042-111662064 AGGGCTGGGGAGGCCACCGCAGG + Intronic
1059145585 9:111896783-111896805 AGGAGTGGGGCGCGAGCCGCCGG + Exonic
1060514543 9:124257833-124257855 AGGGGCGGGGGGCGCCCCGGCGG - Intronic
1060547645 9:124470436-124470458 AGGCCTGGGGAGCTCCCCGCAGG - Intronic
1060841440 9:126796256-126796278 AGGGTTGGGGAGATCTCGGCTGG - Intergenic
1060936130 9:127517245-127517267 GGGGCTGGAGAGCGCTCAGCTGG + Intronic
1061006594 9:127931560-127931582 GGGGGAGGGGAGCGCTCTGTTGG - Intergenic
1061120147 9:128637027-128637049 AGGGTTGGGGACGTCTCCGCAGG - Exonic
1061207593 9:129173831-129173853 AGGGGAGGGGAGCCCTCGTCTGG + Intergenic
1061239144 9:129359070-129359092 AGGGGTCGGGAGCTCTCTGGAGG - Intergenic
1062008831 9:134256232-134256254 GGGGGAGGGGAGGGCTCAGCAGG + Intergenic
1062529228 9:136992587-136992609 AGGGGTGCAGGGAGCTCCGCGGG + Intronic
1062551540 9:137089750-137089772 TGGGGGGAGGAGTGCTCCGCAGG + Intronic
1203444698 Un_GL000219v1:44592-44614 AGGGCCGGTGAGCGCCCCGCAGG + Intergenic
1188770337 X:34146953-34146975 GGGGGTGGGTCGCGCTCCGCAGG - Intergenic
1192908811 X:75581303-75581325 AGGGGTGGGGAGAGCTATGAGGG + Intergenic
1195370353 X:104166834-104166856 AGGAGTGGGAAGGGCTCCTCGGG - Exonic