ID: 1172085318

View in Genome Browser
Species Human (GRCh38)
Location 20:32377564-32377586
Sequence TAGTAAGGTACCTTGAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172085318 Original CRISPR TAGTAAGGTACCTTGAGGAT GGG Intronic
901357388 1:8663071-8663093 TAGTTAAGTTTCTTGAGGATAGG - Intronic
901584103 1:10273025-10273047 TAGCAAGGTACAGTGGGGATTGG + Intronic
903908005 1:26699465-26699487 TAGTAAAGTAGCTCTAGGATGGG - Intronic
907105159 1:51876356-51876378 TAATGAGGTATCTTGGGGATGGG + Intronic
907534300 1:55135563-55135585 TAATGAGATATCTTGAGGATGGG - Intronic
907991070 1:59583493-59583515 TATGGAGGTATCTTGAGGATTGG + Intronic
908966387 1:69769593-69769615 TAATGAGATATCTTGAGGATGGG - Intronic
909018187 1:70402201-70402223 TAGTGAAATATCTTGAGGATGGG + Intergenic
910181178 1:84485020-84485042 TAATGAGGTATCTTGATGATTGG + Intronic
914912871 1:151801304-151801326 GAGTAAGGGTCCTAGAGGATGGG - Exonic
916011221 1:160707662-160707684 AGGTAAGGGGCCTTGAGGATAGG + Intronic
917691789 1:177477359-177477381 TAGTAAGGTTCTTTGGGAATAGG - Intergenic
921615768 1:217265009-217265031 TAGTATGGTTCCTTGTGCATAGG + Intergenic
921883441 1:220279385-220279407 TAACAAGGTACTTTGAGGAAGGG - Intergenic
922118337 1:222636395-222636417 GGGTAAGATTCCTTGAGGATGGG - Intronic
924720049 1:246614159-246614181 TAGTGAGATATCTTGAGGATGGG + Intronic
924948461 1:248861938-248861960 TATTAAGGGACCATGAGGAAAGG - Intergenic
1062871068 10:905060-905082 TAATGAGGTATCTTGGGGATGGG - Intronic
1063063369 10:2581399-2581421 AAGTAAGGTGACTTTAGGATAGG - Intergenic
1070495400 10:77016746-77016768 TAAGAAGGTCACTTGAGGATGGG - Intronic
1071298977 10:84242424-84242446 GAGTAGGGCACCTTGAGGAGAGG - Intergenic
1071965336 10:90846128-90846150 TAATAAAATATCTTGAGGATGGG + Intronic
1074242885 10:111656609-111656631 TAATGAGGTATCTTGGGGATGGG + Intergenic
1074469926 10:113717647-113717669 TACCAAGGTAGCTTCAGGATAGG - Intronic
1074944549 10:118268796-118268818 TAGTGAGATATCTTGAGAATGGG + Intergenic
1085137992 11:74111519-74111541 TAATAAGATATCTTGGGGATAGG - Intronic
1085956045 11:81396420-81396442 TAATAATGTGCTTTGAGGATGGG - Intergenic
1086051356 11:82594987-82595009 TAGTAAGATATCTTGAGGATAGG - Intergenic
1086169797 11:83823014-83823036 TCATAGGGTACCTTCAGGATAGG - Intronic
1087853010 11:103055034-103055056 TAATAAGATACCTTGGGGATGGG + Intergenic
1088227087 11:107633096-107633118 TAATGAGATACCTTGGGGATGGG - Intronic
1088764847 11:112963903-112963925 TGGCCCGGTACCTTGAGGATGGG + Intronic
1088997881 11:115019016-115019038 AAGTCATGTACCATGAGGATAGG + Intergenic
1089714832 11:120348929-120348951 TAGTAAGATATCTTGGGAATGGG - Intronic
1090505424 11:127307329-127307351 TTGTGATGTACTTTGAGGATTGG + Intergenic
1090986147 11:131767900-131767922 TTGTAAGGTAGTTTTAGGATAGG + Intronic
1096461549 12:51824098-51824120 CAGTAAAGTCCCTTGAGGAAGGG - Intergenic
1096750161 12:53753497-53753519 TAGGAGGGTTCCTAGAGGATAGG + Intergenic
1097104956 12:56616616-56616638 TATTAAGGAAGCTTGAGGGTAGG + Intronic
1097921945 12:65085276-65085298 TAATAAGATATCTTGGGGATGGG + Intronic
1099220107 12:79903541-79903563 TAATGAGGTATCTTGGGGATGGG - Intronic
1100340481 12:93674789-93674811 TAATGAGGTAACTTGGGGATGGG + Intergenic
1101626597 12:106449106-106449128 TAATAAGATATCTTGGGGATGGG + Intronic
1102143123 12:110633216-110633238 TAGTGAGGCCCCTTGGGGATGGG - Intronic
1104112803 12:125719350-125719372 TAGTCAGGTACCTTGACTAGTGG - Intergenic
1105646901 13:22329805-22329827 TAGTGAGATATCTTGAGGATAGG - Intergenic
1106328067 13:28713813-28713835 TAATGAGATACCTTGTGGATGGG + Intronic
1107062686 13:36176539-36176561 TAATAAGATAGCTTGGGGATGGG + Intronic
1108390366 13:49941459-49941481 GAGTAAGGGAACTTGAGGTTGGG - Intergenic
1109759542 13:66809266-66809288 TAGAAGAGTACCTTGAGGCTAGG + Intronic
1110544659 13:76743279-76743301 TAATGAGATATCTTGAGGATAGG - Intergenic
1111164411 13:84439734-84439756 TAGAAATGTACTTTGAGGGTAGG - Intergenic
1115286990 14:31725469-31725491 TAATGAGATACCTTGAGGATGGG + Intronic
1115732881 14:36290575-36290597 TAGTAAGATATCTTGGGGATGGG - Intergenic
1115735405 14:36322551-36322573 TAATAAGCTATCTTGGGGATGGG - Intergenic
1116656292 14:47657513-47657535 TAGTTAGTTTCCTTGAGGAATGG - Intronic
1119841675 14:77798154-77798176 CAGGAGGGTACCTTGAGGACAGG + Intergenic
1120445963 14:84596763-84596785 TAATGAGATATCTTGAGGATAGG + Intergenic
1121190094 14:92019935-92019957 TAATGAGATATCTTGAGGATGGG - Intronic
1121337485 14:93086209-93086231 GTGTGGGGTACCTTGAGGATAGG - Intronic
1126472214 15:49025369-49025391 TACTGAGGTACCTTGGGGATGGG + Intronic
1133191312 16:4135650-4135672 TAGGTAGGTAGCTAGAGGATAGG + Intergenic
1133529021 16:6635929-6635951 TAATGAGGTATCTTGGGGATGGG + Intronic
1135679014 16:24441068-24441090 TAGTAAGATATGTTGAGGTTGGG - Intergenic
1135900891 16:26458935-26458957 CAGTCAGCTACCATGAGGATTGG + Intergenic
1139382350 16:66541178-66541200 TAATGAGATATCTTGAGGATGGG - Intronic
1142202805 16:88769130-88769152 TAATGAGGTATCTTGGGGATGGG + Intronic
1149137534 17:53387194-53387216 TAATAAGATATCTTGGGGATGGG - Intergenic
1150087190 17:62281671-62281693 TAGGAAGATCCCTTGAGGACAGG - Intronic
1150390524 17:64787466-64787488 TAGTTAGTTACCTTGAAGACCGG - Intergenic
1150995320 17:70310529-70310551 TAGTGAGGTCCTTTGAGGAGAGG + Intergenic
1153118792 18:1694370-1694392 TAATAAGATATTTTGAGGATGGG + Intergenic
1157280846 18:46345389-46345411 TTGTCAGGGACCTTCAGGATGGG - Intronic
1158875001 18:61725081-61725103 TAGAAAGGTAGCTGGAGGAAAGG - Intergenic
1158981883 18:62770770-62770792 TAATAAGATATCTTGGGGATAGG + Intronic
1166543078 19:43618484-43618506 TAGTAGGGTACCTTGAGCACAGG - Intronic
925634056 2:5925427-5925449 TAATGAGATACCTTGAAGATGGG - Intergenic
926026700 2:9551404-9551426 TAATGAGGTATCTTGGGGATGGG + Intronic
926193311 2:10744087-10744109 TAGGAAGGTCCCTTGAGCACAGG + Intronic
927367068 2:22309525-22309547 TAGTGAGATATCTTGGGGATGGG - Intergenic
927370617 2:22350986-22351008 TAGTAATGTATCTGGAGAATAGG - Intergenic
927449589 2:23196092-23196114 TAATAAGATATCTTGGGGATGGG + Intergenic
927593127 2:24373941-24373963 TAGGTAGGTACTTTCAGGATGGG + Intergenic
929635867 2:43520778-43520800 TAGTAAGCTTCCTTGAGAACTGG - Intronic
932433625 2:71690230-71690252 AAGTAAATTACCTTGAGGAAGGG + Intergenic
933036826 2:77410552-77410574 TGGGAAAGTACATTGAGGATGGG + Intronic
937739590 2:125334076-125334098 TAGTGAGTTGCCTTGAGGCTGGG - Intergenic
940424933 2:153520210-153520232 CAGTAAGGTACCTTAAGGAATGG + Intergenic
941979958 2:171444528-171444550 TAATGAGGTATCTTGGGGATGGG - Intronic
944008740 2:194945002-194945024 TAATAAGGTACAATGAGGAAGGG - Intergenic
944626714 2:201577203-201577225 TAATGAGATAGCTTGAGGATGGG - Intronic
947175262 2:227360007-227360029 TAATGAGATATCTTGAGGATGGG + Intergenic
947407322 2:229792416-229792438 TAATGAGATACCTTGGGGATGGG + Intronic
1169365573 20:4989405-4989427 TAGTGAGATATCTTGAGAATGGG + Intronic
1169797980 20:9485559-9485581 TAATAAGATATCTTGGGGATGGG - Intergenic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1172085318 20:32377564-32377586 TAGTAAGGTACCTTGAGGATGGG + Intronic
1176359747 21:5984709-5984731 TAATGAGATACCTTGGGGATAGG + Intergenic
1177079055 21:16615852-16615874 TAATAATGTACCATGAGAATTGG - Intergenic
1178054394 21:28783106-28783128 TAATAAGCTATCTTGGGGATGGG + Intergenic
1178376348 21:32070720-32070742 TGGGAATGTACCTTGAGGTTGGG - Intergenic
1178524258 21:33312731-33312753 TAGTAAGGAAACTTGAGGCCAGG + Intergenic
1179763771 21:43553841-43553863 TAATGAGATACCTTGGGGATAGG - Intronic
1183249244 22:36717669-36717691 TAATGAGGTATCTTGGGGATGGG + Intergenic
951080171 3:18444152-18444174 CAGTAAGGTGCCTGGAGGAGTGG - Intronic
960538859 3:118843112-118843134 TAGGAAGGATCCTGGAGGATAGG - Intergenic
963195636 3:142525938-142525960 TAGTAAATTACCCTGAGGCTGGG - Intronic
963510685 3:146244311-146244333 TAATGAGGTATCTTGAGAATGGG - Intronic
964858265 3:161171014-161171036 TAGTAATGTACCTTGAATATAGG - Intronic
966384517 3:179381815-179381837 TAATGAGCTATCTTGAGGATGGG - Intronic
969267818 4:6076739-6076761 GAATAAGGTATCTTGGGGATGGG + Intronic
969270527 4:6096773-6096795 TAGTGAGATATCTTGGGGATGGG + Intronic
970627203 4:17899921-17899943 TAGTAAGATATCTTGTGGATGGG - Intronic
971341695 4:25775156-25775178 TTGTAAGGTACATTTACGATGGG + Intronic
973872838 4:55183879-55183901 AAGTAAAGTGCCTTGAGGAAGGG - Intergenic
977451119 4:97199457-97199479 TTGTAAGGTTCTTTCAGGATAGG - Intronic
978332634 4:107631105-107631127 GAATGAGGTACCTTGGGGATGGG - Intronic
978508079 4:109482523-109482545 TAGTGAGATAGTTTGAGGATGGG + Intronic
979662487 4:123273806-123273828 TAATAAGTTATCTTGGGGATGGG - Intronic
982230192 4:153201592-153201614 CAGGAAGATAGCTTGAGGATGGG + Intronic
982470027 4:155777009-155777031 TAAGAAGATATCTTGAGGATGGG + Intronic
983036958 4:162878548-162878570 AAGTGAGCTACTTTGAGGATAGG + Intergenic
984513837 4:180713603-180713625 TAGTAAGGTACTTTGTGTTTAGG + Intergenic
987009975 5:13752622-13752644 TAATGAGATAACTTGAGGATGGG - Intronic
988461347 5:31440926-31440948 TAGTGAGATATCTTGGGGATAGG - Intronic
990055280 5:51568881-51568903 TAATGAGGTATCTTGGGGATGGG + Intergenic
991229360 5:64313060-64313082 TAGTAAGATATCTTGGAGATAGG + Intronic
993651435 5:90527677-90527699 TAATAAGATACATTGGGGATGGG - Intronic
993919596 5:93784280-93784302 TAGAAAGGGAGTTTGAGGATGGG + Intronic
999072837 5:148765754-148765776 TAGGAAGGTTGCTTGAGGCTAGG - Intergenic
1000818988 5:165960183-165960205 TAGTCAGGTACCTTGACTAAGGG - Intergenic
1002151434 5:177235338-177235360 TAATAAGTTATCTTGGGGATGGG - Intronic
1003562480 6:7193642-7193664 TAATGAGGTATCTTGAGGATGGG + Intronic
1003697587 6:8426234-8426256 TAGTAAGGTATCTTGGGGAATGG + Intronic
1003699142 6:8442976-8442998 TAATAAGATATCTTGAGGCTGGG + Intergenic
1004028722 6:11845217-11845239 TAGTGAGATATCTTGGGGATAGG + Intergenic
1004072882 6:12318143-12318165 TAATAAGATATCTTGGGGATGGG + Intergenic
1004644936 6:17551800-17551822 TAGTACACTACCTTGAGAATCGG - Intronic
1005188581 6:23191846-23191868 TAGTCAAATATCTTGAGGATAGG + Intergenic
1007729669 6:43938203-43938225 TAGGATGATACCTTGATGATAGG + Intergenic
1007888924 6:45267073-45267095 TAATGAGATACCTTGAGGATGGG - Intronic
1009647046 6:66418421-66418443 TCGTAAGCTACATTGAGGTTTGG + Intergenic
1013674243 6:112439678-112439700 TATTAAGGTATATTAAGGATAGG - Intergenic
1014456311 6:121638541-121638563 TAGTGAGATATCTTGGGGATGGG + Intergenic
1019720600 7:2568322-2568344 TAATGAGGTATCTTGGGGATGGG - Intronic
1021242187 7:18216923-18216945 CAGTAAAGTATCTTGAGGAAGGG + Intronic
1021329717 7:19320989-19321011 TAATGAGATACCTTGGGGATAGG - Intergenic
1026414576 7:70165122-70165144 GAATAAGTGACCTTGAGGATAGG + Intronic
1029912623 7:104170945-104170967 TAGTAAGAGACATTGAGGAAAGG - Intronic
1030520959 7:110597574-110597596 TAGAAAGGGGCCTTGGGGATTGG - Intergenic
1031316222 7:120260836-120260858 TAGAAAGGTAACTTGAGGCCGGG - Intergenic
1032183686 7:129704625-129704647 TAGTGAGATATCTTGGGGATAGG + Intronic
1033856626 7:145569478-145569500 TAATGAGATATCTTGAGGATGGG + Intergenic
1034912133 7:155005379-155005401 TAATAAGATATCTTGGGGATGGG - Intergenic
1035556112 8:568626-568648 TAGCAAGATTCCTTGAGGGTTGG + Intergenic
1040458973 8:47628644-47628666 TAATAAGATATCTTGGGGATGGG - Intronic
1043456161 8:80414420-80414442 TAGAAAGCTACCATGAGGAGTGG + Intergenic
1043911921 8:85874021-85874043 TAGTGAGGTTCCTTGGGCATGGG + Intergenic
1043993308 8:86782046-86782068 TAATAAGGTATCTTGGAGATGGG + Intergenic
1045262372 8:100587811-100587833 TAATGAGATATCTTGAGGATGGG - Intronic
1047467129 8:125127805-125127827 TAATGAGATACCTTGGGGATGGG + Intronic
1048471787 8:134710644-134710666 TAGTGAGATAACCTGAGGATGGG + Intronic
1050152000 9:2626198-2626220 TAATAAGGTATCTTGGGGATGGG + Intronic
1052090157 9:24317648-24317670 TTATAAAGTACCTTGAGCATTGG - Intergenic
1059676111 9:116541578-116541600 TACTAAGGTACCAGGAAGATAGG + Intronic
1059936277 9:119314287-119314309 TAGAGAGGTACCTTGTGGAGAGG + Intronic
1060456702 9:123805344-123805366 TAATGAGATATCTTGAGGATGGG + Intronic
1060614275 9:124997351-124997373 TAGTAAGGTACCTTAGGGATGGG - Intronic
1186576700 X:10774371-10774393 TAGAAAGGTACCTGCAGGACTGG - Intronic
1187095430 X:16142960-16142982 AAGAAAGGAAACTTGAGGATAGG - Intronic
1187350523 X:18511023-18511045 TAATGAGATACCTTGGGGATGGG + Intronic
1187806966 X:23131262-23131284 TAGTATGGTAGCTGGAGGGTGGG - Intergenic
1188699436 X:33240011-33240033 TAATAAGGTATCTTGGGCATGGG - Intronic
1188874132 X:35409385-35409407 TAATGAGATATCTTGAGGATAGG - Intergenic
1191205484 X:57828959-57828981 TATTAATATACCTTGGGGATGGG - Intergenic
1193064065 X:77238860-77238882 TGGGAAGGTATCTTGAGGCTGGG + Intergenic
1193305125 X:79940760-79940782 TAATAAAATATCTTGAGGATGGG - Intergenic
1195843330 X:109198402-109198424 TAGGAAGGTACCTGGAGAATAGG - Intergenic
1201794125 Y:17876309-17876331 TAGTAAGGAACGTGGAGGGTTGG - Intergenic
1201807429 Y:18029676-18029698 TAGTAAGGAACGTGGAGGGTTGG + Intergenic
1202355507 Y:24044122-24044144 TAGTAAGGAACGTGGAGGGTTGG - Intergenic
1202515271 Y:25625987-25626009 TAGTAAGGAACGTGGAGGGTTGG + Intergenic