ID: 1172091117

View in Genome Browser
Species Human (GRCh38)
Location 20:32433641-32433663
Sequence GAGAAGCCACAGACTCAACT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172091117_1172091122 4 Left 1172091117 20:32433641-32433663 CCCAGTTGAGTCTGTGGCTTCTC 0: 1
1: 0
2: 1
3: 13
4: 184
Right 1172091122 20:32433668-32433690 CCAGGCTGAGCCAGACAACTTGG 0: 1
1: 0
2: 1
3: 17
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172091117 Original CRISPR GAGAAGCCACAGACTCAACT GGG (reversed) Exonic
901583254 1:10263813-10263835 AAGAAACCACAGTGTCAACTAGG - Intronic
902282998 1:15388163-15388185 GAGTAGAGACAGTCTCAACTGGG + Intronic
903754365 1:25650559-25650581 GAGAGGCCACAGAGTCAAGCAGG - Intronic
905052320 1:35062207-35062229 GAGAAGTCACTACCTCAACTGGG - Intronic
907540791 1:55214629-55214651 GAGAAGCCCCAGGCTCCAGTTGG - Intronic
907618661 1:55952736-55952758 GGGAAGTCAGAGACTCTACTGGG + Intergenic
908843799 1:68304381-68304403 GAGGAGACACAGTCACAACTAGG - Intergenic
908923844 1:69229457-69229479 CAGGAGCCACAGTGTCAACTTGG + Intergenic
916384175 1:164249247-164249269 GAGAAGCCACAGGATAAACATGG - Intergenic
917438419 1:175044423-175044445 TAGAAACCACAGAGGCAACTCGG + Intergenic
917469792 1:175316571-175316593 GAGAAGCCACAGAATAAACATGG - Exonic
918843921 1:189583929-189583951 GAGAAGTCACAGAGTGAACAAGG - Intergenic
919943653 1:202305054-202305076 GAGGAGCCTCAGATTCAAGTTGG - Intronic
921245050 1:213229469-213229491 AAGCAGCCACAGACTGAAATTGG - Intronic
921436742 1:215132244-215132266 CAGAAGCCACTGCCTGAACTTGG + Intronic
921923584 1:220693623-220693645 GAGAAGACACAGACATTACTTGG + Intronic
1063316412 10:5010398-5010420 GAGAAGTTACAGACTCTCCTGGG - Intronic
1063450432 10:6146508-6146530 GAGAACCCACAGAGTCAAGGTGG - Intronic
1063538583 10:6909724-6909746 GAGAAGCTACAGACTCACTTTGG + Intergenic
1065179057 10:23106752-23106774 GAGAAGCCATGGCCTCCACTAGG - Intronic
1065789063 10:29243104-29243126 GAGAAGCCCCCGTCTCAACTAGG + Intergenic
1067275156 10:44827613-44827635 CAGAAGCCACAGAGTCCACGTGG + Intergenic
1071342821 10:84664369-84664391 GAGAAGCCACAGACCCACAGGGG + Intergenic
1071495950 10:86167781-86167803 CAGAAGCACCAGACTCAGCTCGG + Intronic
1072295514 10:94005772-94005794 AAGAAACCACAGACTCAATCAGG - Intronic
1073981632 10:109160638-109160660 CAGAAGCCCCAGAATCACCTGGG + Intergenic
1075375253 10:121973756-121973778 AAGAGGCAACAGAATCAACTGGG + Intronic
1075549961 10:123384907-123384929 GAGAAGCCAAAGACACAGCAAGG - Intergenic
1075737625 10:124673751-124673773 CACAAGCCCCAGACTCACCTAGG + Intronic
1075883152 10:125872200-125872222 GAGAAGACAAAGATGCAACTGGG - Intronic
1078194536 11:9124647-9124669 AAGAAGCCACTGACTCTCCTGGG - Intronic
1078652508 11:13208828-13208850 GAGAAGGCACACACTGAAGTTGG + Intergenic
1078788430 11:14519943-14519965 GAGAAGACAGAGACTTGACTTGG - Intronic
1081129186 11:39355947-39355969 GACAAGCCAGAGGCTCACCTAGG - Intergenic
1081621343 11:44620678-44620700 GGGAAGCCACAGGATAAACTTGG + Intergenic
1081984674 11:47292961-47292983 GGGCAGCTACAGACTCAACATGG - Intronic
1082125625 11:48428414-48428436 GAGAAGTCACAGATGAAACTTGG - Intergenic
1082250798 11:49977796-49977818 GAGAAGTCACAGATGAAACTTGG + Intergenic
1082559240 11:54599444-54599466 GAGAAGTCACAGATGAAACTTGG - Intergenic
1084299423 11:68237071-68237093 GAGAACTCACAGACACTACTTGG - Intergenic
1086492105 11:87365899-87365921 TGGAAGCCACAGACTCAAGGTGG + Intergenic
1089362876 11:117902556-117902578 GAGAAGGCAGGGTCTCAACTAGG + Intronic
1091837793 12:3597925-3597947 GAGAAGCCACAGACCCACCTGGG + Intergenic
1092088070 12:5781407-5781429 CAGAATCCAGAGACTCAGCTAGG - Intronic
1093878786 12:24380164-24380186 TCGAAACAACAGACTCAACTGGG + Intergenic
1095377228 12:41544921-41544943 AAGAAGCCACAGAGAGAACTTGG - Intronic
1095755442 12:45761149-45761171 GAGAAGAGAAAGATTCAACTTGG - Intronic
1096529880 12:52235855-52235877 GAGAGGACACAGAGCCAACTTGG + Intronic
1099315439 12:81077928-81077950 GAGAAGCAACAGGCTAAAGTGGG - Exonic
1100021038 12:90069936-90069958 GAGAAGGCACAGAACCAACTTGG - Intergenic
1101155703 12:101925637-101925659 GAGAAGCCTCTGACTCTCCTTGG + Intronic
1103520960 12:121536987-121537009 GATCAGACACAGACTCAACTTGG - Intronic
1107040327 13:35941100-35941122 GAGAAGACACAGTCTCATCCAGG - Intronic
1107193762 13:37622430-37622452 GAGGAGCCACAGGCTCAATCTGG - Intergenic
1107312453 13:39093763-39093785 GAAAAGCAACAAACTCAACTTGG + Intergenic
1107553686 13:41499353-41499375 GAGAAGGCACAGAACCAGCTTGG - Intergenic
1111155517 13:84318083-84318105 AAGAAGCCAGAGAATGAACTAGG + Intergenic
1112742237 13:102488176-102488198 TACAAGCCACAGACTCTGCTGGG - Intergenic
1119261544 14:73240859-73240881 TAGAAGCCACAGAGGCAGCTGGG + Intronic
1121467378 14:94124674-94124696 CAGAAGCCACAGAGACAACATGG - Intergenic
1122230735 14:100305455-100305477 GAGAAGCCAGAGGCCCAACAGGG + Intronic
1124876745 15:33601932-33601954 AAGAAGCCACAGTCTCACTTGGG - Intronic
1127706592 15:61553158-61553180 GAGAAGATACAGATTCAACATGG + Intergenic
1128393327 15:67198141-67198163 GAGTAGGCACAGACTCTACAAGG + Intergenic
1129908229 15:79204911-79204933 GAGATGCCACAGACCCACATTGG - Intergenic
1132790150 16:1681538-1681560 TGGAGGCCACAGACTCAATTTGG + Intronic
1133674140 16:8053915-8053937 GCGAAGCCCCACACACAACTCGG - Intergenic
1133924910 16:10184163-10184185 GAGATGCCAGAGAGTCAGCTAGG + Intergenic
1134255188 16:12604470-12604492 GAGAATCGACAGTCTCAAGTGGG + Intergenic
1135926523 16:26698503-26698525 GTGGAGCCACAGCCTAAACTGGG - Intergenic
1136576896 16:31130497-31130519 GAGAAGCCACTGTCTGACCTGGG + Exonic
1137575765 16:49599194-49599216 GAAAAGACACAGACCCATCTAGG + Intronic
1138134768 16:54512053-54512075 GAGAGTACACATACTCAACTCGG - Intergenic
1139959749 16:70710744-70710766 TTGAAGCCACGGACCCAACTTGG + Intronic
1140049050 16:71463303-71463325 AAGAAGCCACAGAGGCAAGTGGG - Intronic
1145830695 17:27913869-27913891 CAGCAGCCACAGAATCCACTTGG + Intergenic
1146006904 17:29166240-29166262 GAGAAGCCAAAGTCTCCAGTGGG + Exonic
1147741992 17:42675160-42675182 GAGAGGCCACAAACCCAACCCGG + Intronic
1147872600 17:43598190-43598212 GAGAAGACACAGCCTCATCCAGG + Intergenic
1148683089 17:49485900-49485922 GGGAAGCCACCGACTCAGCTGGG - Intergenic
1149755648 17:59183247-59183269 GAGAAGACACAGCCTCTGCTGGG - Intronic
1150983352 17:70168968-70168990 GAGAAGCCACTGAGTCAATGGGG - Intronic
1151679451 17:75615840-75615862 GAGAAGCCACAGCGTGACCTGGG + Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1151944289 17:77311118-77311140 GAGAGGCCACAGACACACCGGGG + Intronic
1152292301 17:79446926-79446948 GAGAAGCCAAGGACTCTCCTGGG + Intronic
1153185420 18:2480793-2480815 CACAAGCCATAGACTAAACTCGG - Intergenic
1156844145 18:41644432-41644454 CATAAGCCAAAGTCTCAACTAGG + Intergenic
1158721482 18:59929179-59929201 GAGAATGCAAAGACTCCACTGGG - Intergenic
1159025409 18:63178628-63178650 GAGGAGCCCCAGACTCACTTGGG + Intronic
1160246194 18:77162144-77162166 GTGAAGACACAGACTCCACAGGG + Intergenic
1162796486 19:13090020-13090042 CAGAAGCCACAGTCTCAGCCAGG - Intronic
1166374519 19:42320161-42320183 CAGAAGCCAGAGACTGAAATGGG - Intronic
1168365566 19:55784103-55784125 GAGAAGCCCCAGACTCACTGAGG + Intergenic
928461246 2:31474921-31474943 GAGAAGCCAAAGAATCAAGCTGG - Intergenic
935113246 2:100111040-100111062 CAAAAGCCACAGACTAAAGTTGG + Intronic
936606159 2:113956841-113956863 GCAAAGTCACAAACTCAACTAGG - Intronic
936919420 2:117672365-117672387 GAAAACCCATAGACTCAAGTGGG + Intergenic
941368198 2:164632723-164632745 GAGAAGCAACATTTTCAACTTGG - Intergenic
941593966 2:167452584-167452606 GAGAATCCACAGACTCTTCAAGG - Intergenic
945443576 2:209909733-209909755 GAGGAGTCACAGAGTCAACTAGG + Intronic
946662379 2:222015301-222015323 GGGAAGTCACCAACTCAACTGGG - Intergenic
948146712 2:235713677-235713699 CTGATGCCACAGCCTCAACTGGG - Intronic
1168938470 20:1688463-1688485 AAGAAGCCACAGACTCAGTTAGG + Intergenic
1169737121 20:8849155-8849177 GAGAAGCCAAACACTCAAGTGGG + Intronic
1169985936 20:11444515-11444537 GCCAAGTCACAGACTCAACACGG - Intergenic
1171013531 20:21521588-21521610 GAGAAGCCCCTGTCTCCACTGGG + Intergenic
1171228502 20:23461750-23461772 GACAAGCTACAGACTGAAATAGG - Intergenic
1171455719 20:25271057-25271079 GCGAGGCCTCAGCCTCAACTGGG + Intronic
1172091117 20:32433641-32433663 GAGAAGCCACAGACTCAACTGGG - Exonic
1172370021 20:34382129-34382151 GAAAATCTACAGACTCAAATTGG + Intronic
1173086961 20:39930803-39930825 GACAAGCCACAGACTGGACAAGG + Intergenic
1174286204 20:49475463-49475485 GAGAAGCCAAACTCTGAACTTGG + Intronic
1179357489 21:40674193-40674215 GAGAAGGAATACACTCAACTTGG + Intronic
1179808508 21:43855135-43855157 GACAGGCCACAGACTGAACTTGG - Intergenic
1181372776 22:22431540-22431562 GAGGAGACACAGACACCACTTGG + Intergenic
1181530287 22:23513450-23513472 GAGAAGTCACAGACTCAGACAGG + Intergenic
1181644729 22:24225227-24225249 CAGGAGCCCCAGACTCACCTGGG + Exonic
1181909383 22:26226387-26226409 GAGAAGCCACTAAGTGAACTTGG - Intronic
1182547355 22:31083926-31083948 GAGAAGCCACAGAATCCATAAGG - Intronic
1183097162 22:35559739-35559761 GAGGAGCCACAGCCAGAACTAGG - Intergenic
1184410350 22:44322658-44322680 GAGGAGTCACAGCCTGAACTCGG + Intergenic
952487578 3:33830227-33830249 GTGAAGCCCCAGACACATCTGGG - Intronic
954883654 3:53853481-53853503 GAGAATCTACAGACTCCAGTTGG + Intronic
959029678 3:101283589-101283611 CAGAAGCCACAGAGTAGACTTGG + Intronic
959630834 3:108505602-108505624 GAGATGCCACTGACTCACTTCGG - Intronic
959687451 3:109163119-109163141 GACAAGCCATACACCCAACTGGG - Intergenic
961090605 3:124107973-124107995 GAGAAGCCACATAATCAGATTGG - Intronic
962349082 3:134643809-134643831 AAGAAGCAGGAGACTCAACTGGG - Intronic
965791032 3:172388026-172388048 GAGAAAGCCAAGACTCAACTAGG - Intronic
966148630 3:176841175-176841197 GAGAAGAGACACACTCAAGTAGG - Intergenic
966843354 3:184106709-184106731 GAGAAGCTCCAGACTGAAGTTGG - Intronic
968264523 3:197352527-197352549 GTGAAGCCACAGTCTCATCCTGG + Intergenic
975382901 4:73723065-73723087 AAGAAGCCACAGGATCAACGTGG - Intergenic
975853911 4:78602492-78602514 GAGAGGCCACAGGATCTACTGGG - Intronic
977553776 4:98468524-98468546 GAGAAGCCAAACTCTGAACTTGG - Intergenic
978994212 4:115130391-115130413 GAGAAGTCACAGAAAGAACTAGG + Intergenic
982135956 4:152274304-152274326 GAGATGACACAGTCTTAACTTGG - Intergenic
984477811 4:180259261-180259283 GAGGAGCCAAACACTAAACTGGG + Intergenic
986587645 5:9335387-9335409 GAGAAGCCACAGAGCAAATTAGG - Intronic
988909907 5:35828801-35828823 CAGAAGCAACAGCCTCAGCTGGG - Intergenic
988938100 5:36110586-36110608 CAAAAGCCCCAGACTCAAGTAGG + Intronic
988999555 5:36745687-36745709 GTGAAGCCACGGACTAAACTCGG - Intergenic
992819825 5:80485236-80485258 AAGCAGCCCCAGACTCAAGTTGG + Intergenic
994138466 5:96316028-96316050 GAGAAGGCTCAGGCTCAGCTGGG - Intergenic
995097281 5:108252960-108252982 GAGGATCCACAGATTCTACTTGG - Intronic
996974364 5:129412875-129412897 GAGAAATCACAGAATCATCTAGG - Intergenic
997016777 5:129945334-129945356 GAAAAGCCACAGAATAAACATGG + Intronic
1002854119 6:1022562-1022584 GAGATTCCACAGAGTCATCTTGG - Intergenic
1003850547 6:10218099-10218121 CAGAAGCCACAGAAAGAACTGGG - Intergenic
1004900824 6:20192353-20192375 GAGAAAGAAGAGACTCAACTTGG - Intronic
1005725886 6:28648283-28648305 AAGAAGCCACAGAATCAGCACGG - Intergenic
1006237183 6:32643878-32643900 TAGAAGCCACAGACATATCTAGG + Intronic
1007553120 6:42745514-42745536 GAGAAACCGCAGACCCAGCTGGG + Exonic
1008474562 6:51922408-51922430 GAGAATGGACAGACTCAAGTGGG - Intronic
1008579613 6:52895035-52895057 GAGAAGACACAGACACAAAGAGG + Intronic
1013005830 6:106072641-106072663 GAGAAGCCACACACACATCCGGG - Intergenic
1014145303 6:117990800-117990822 GAGAAGACCCAGACTCAGCTGGG + Intronic
1014437353 6:121435592-121435614 TTCAAGCCACTGACTCAACTGGG - Intergenic
1014677542 6:124385597-124385619 GTGAAGACCCAGACTGAACTGGG - Intronic
1016029679 6:139324452-139324474 GAGAAGACACAGAATAAACAAGG - Intergenic
1016314230 6:142769375-142769397 AAGAAGCCACTGACTGCACTTGG - Intronic
1016516534 6:144898542-144898564 GAAAAGCAACAGACTCACCATGG + Intergenic
1017569140 6:155724271-155724293 GTGAAGCCACAGAACAAACTTGG + Intergenic
1017782133 6:157723788-157723810 GGGAAGCCTCAGACTGAATTAGG + Intronic
1018460805 6:163996725-163996747 GAGAAGGCACAGGCCCAAGTGGG - Intergenic
1024364956 7:48509907-48509929 GAGAAGTCACAGCCTGAACGAGG + Intronic
1028850552 7:95532852-95532874 GAGATGCCAGAGACTCATCAAGG + Intronic
1029350831 7:100011777-100011799 GAGAAGCCACAGCTTCCAATAGG + Intergenic
1030820346 7:114085695-114085717 AAGAAGCAGCAGACACAACTCGG + Intergenic
1033441976 7:141388192-141388214 GAGGAGCCAAAGACACACCTGGG - Intronic
1034592409 7:152152828-152152850 CAGTAGCCACAGAATCAACCCGG - Exonic
1035013504 7:155742146-155742168 AAGAAGCCTTAGAATCAACTTGG + Intronic
1035026025 7:155826712-155826734 CAGAAGCCACACACACAATTAGG + Intergenic
1039555700 8:38473252-38473274 GAAAATCCACAAACTCATCTGGG + Intergenic
1040505029 8:48039595-48039617 GATAAGCCACAGACTGAAAAAGG - Intronic
1044607715 8:94061531-94061553 GACAAGCCACACACACAGCTGGG - Intergenic
1045555722 8:103213092-103213114 TTGCAGCCACAGAATCAACTGGG + Intronic
1045906095 8:107346905-107346927 CAGAGTCCACAGACTCAACAAGG - Intronic
1046499560 8:115058483-115058505 GAGATGCCTCAGTCTGAACTAGG - Intergenic
1049263666 8:141653451-141653473 GGGAACCCACAGACTCACTTGGG - Intergenic
1054869377 9:70035290-70035312 GAGGAGCAACAGACTGAACAGGG - Intergenic
1057968620 9:99530531-99530553 GAGAAGACACAGTCTGAGCTGGG - Intergenic
1058482752 9:105413733-105413755 GAAAAGCCAGTGACTCCACTAGG - Intronic
1058578280 9:106426442-106426464 GAGAAGCCACAGAGAAAAATGGG - Intergenic
1058654887 9:107211279-107211301 GAGCAGCCTCAGCCTCACCTAGG - Intergenic
1061009914 9:127948738-127948760 GTGAAGCCACACACTCACCCCGG + Intronic
1061498680 9:130990173-130990195 GAGAGGCCACAGCCTCTCCTCGG + Intergenic
1061617294 9:131788647-131788669 GAGGAGCCCCCGACTCAGCTTGG + Intergenic
1061753671 9:132798111-132798133 GACAAGCAACAGACCCCACTGGG + Intronic
1062407188 9:136402585-136402607 TAGAAACCACAGAGACAACTCGG + Exonic
1186789860 X:12986395-12986417 GAGAAGCCAGAGACTAAAAATGG - Intergenic
1187438081 X:19290908-19290930 GAAAAGCTACTGACTCGACTTGG + Intergenic
1189698009 X:43685669-43685691 CAGTAGCCCCAGAATCAACTGGG + Intronic
1193653415 X:84168112-84168134 CAGAAGCTAAAGACTCAAATAGG - Intronic
1195704508 X:107729282-107729304 CAGCAGCCACAGACTCTTCTGGG - Intronic
1197749439 X:129954537-129954559 CAGAAGCAACAGAGACAACTGGG + Intergenic
1199059568 X:143338445-143338467 GAAAAGCTACAGAGGCAACTGGG - Intergenic
1201634100 Y:16103322-16103344 CAGAAGGCACATCCTCAACTAGG - Intergenic