ID: 1172096707

View in Genome Browser
Species Human (GRCh38)
Location 20:32463999-32464021
Sequence CTGTCACAGCAGCAGCCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 1, 2: 5, 3: 61, 4: 472}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172096704_1172096707 -10 Left 1172096704 20:32463986-32464008 CCTCCATGAGACTCTGTCACAGC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1172096707 20:32463999-32464021 CTGTCACAGCAGCAGCCAGGCGG 0: 1
1: 1
2: 5
3: 61
4: 472
1172096702_1172096707 20 Left 1172096702 20:32463956-32463978 CCAGAGGTGTGGCTGCTGGAGGC 0: 1
1: 0
2: 8
3: 58
4: 394
Right 1172096707 20:32463999-32464021 CTGTCACAGCAGCAGCCAGGCGG 0: 1
1: 1
2: 5
3: 61
4: 472
1172096703_1172096707 -7 Left 1172096703 20:32463983-32464005 CCGCCTCCATGAGACTCTGTCAC 0: 1
1: 0
2: 0
3: 21
4: 216
Right 1172096707 20:32463999-32464021 CTGTCACAGCAGCAGCCAGGCGG 0: 1
1: 1
2: 5
3: 61
4: 472
1172096698_1172096707 30 Left 1172096698 20:32463946-32463968 CCTTCCGTGTCCAGAGGTGTGGC 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1172096707 20:32463999-32464021 CTGTCACAGCAGCAGCCAGGCGG 0: 1
1: 1
2: 5
3: 61
4: 472
1172096699_1172096707 26 Left 1172096699 20:32463950-32463972 CCGTGTCCAGAGGTGTGGCTGCT 0: 1
1: 0
2: 0
3: 32
4: 208
Right 1172096707 20:32463999-32464021 CTGTCACAGCAGCAGCCAGGCGG 0: 1
1: 1
2: 5
3: 61
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172096707 Original CRISPR CTGTCACAGCAGCAGCCAGG CGG Intronic
900001517 1:17322-17344 TTGTTACAGCACCAGCCAGGGGG + Intergenic
900021236 1:187844-187866 TTGTTACAGCACCAGCCAGGGGG + Intergenic
900684494 1:3939492-3939514 CTCTCATTGCAGCAGGCAGGCGG - Intergenic
900898470 1:5500587-5500609 CATTCACACCAGCCGCCAGGTGG + Intergenic
901232638 1:7649740-7649762 CTGTCACGGAAGCAGCTATGCGG - Intronic
901677182 1:10892371-10892393 CTGTCCCAGGAGCAGCAAGGAGG - Intergenic
902162799 1:14545258-14545280 TTGTCACAGAGGTAGCCAGGAGG + Intergenic
902735480 1:18397953-18397975 CTCTCAATGCAGCAGGCAGGAGG + Intergenic
904473134 1:30748091-30748113 CCGTCTCAGAAGCAGGCAGGCGG + Intronic
904877398 1:33666813-33666835 CTGTGAAATCAGCAGCCAAGAGG + Intronic
905885826 1:41491380-41491402 CACTCCCAGCAGCTGCCAGGTGG - Intergenic
907161893 1:52376802-52376824 TTGTCCCAGCAGCAGCCCGAAGG - Intronic
907287283 1:53389982-53390004 AGATCACAGCAGGAGCCAGGAGG + Intergenic
907488126 1:54791158-54791180 CTCACATAGAAGCAGCCAGGGGG - Intronic
907916539 1:58874989-58875011 CTGCAACAACAGCAGCCTGGTGG - Intergenic
908067270 1:60420461-60420483 GTGTCTCAGCAGCAGGAAGGTGG + Intergenic
909688009 1:78372598-78372620 CTGTTACAAGACCAGCCAGGGGG + Intronic
909781395 1:79551636-79551658 CAGTTACAGCACCAGCTAGGTGG + Intergenic
910141705 1:84033395-84033417 CAGTTACAGCACCAGCTAGGTGG + Intergenic
910203701 1:84725965-84725987 CTGTCACAAGAACAGCAAGGGGG - Intergenic
910349724 1:86281581-86281603 CAGTTACAGCACCAGCTAGGTGG + Intergenic
914676363 1:149909963-149909985 CTGTGACTACAGAAGCCAGGTGG - Intronic
915917552 1:159950070-159950092 CTGGCACAGGACCACCCAGGAGG - Intergenic
915962217 1:160276403-160276425 CTGACATAGCAGAGGCCAGGTGG - Intergenic
916383626 1:164242113-164242135 CTATCACAAGAGCAGCAAGGGGG - Intergenic
917235654 1:172888915-172888937 CTGTAGCATAAGCAGCCAGGAGG + Intergenic
917381599 1:174416101-174416123 CTGTCACAGCAGAAGTGAGTTGG - Intronic
919314066 1:195948643-195948665 CAGCCACAGCTGCACCCAGGAGG + Intergenic
919654492 1:200184306-200184328 CTGTTACAGCAACACTCAGGGGG - Intergenic
919983726 1:202658524-202658546 CTATGACAGCAGCTGCCAGAGGG + Intronic
920445439 1:206012639-206012661 CTGTCCCCTCAGCATCCAGGTGG - Exonic
920987750 1:210906381-210906403 CTGCCCCAGCAGCAGTCATGTGG - Intronic
922966399 1:229694490-229694512 CTGTTGTGGCAGCAGCCAGGTGG + Intergenic
923171069 1:231418022-231418044 CTTTCACAGCAGTAGGCAGGTGG - Intronic
923624217 1:235601024-235601046 CTGAAACAGCAGCAGCCATGGGG - Intronic
924564297 1:245183705-245183727 CTGTCACAGAAGCAACCTGCAGG + Intronic
924581356 1:245326691-245326713 CTCTCATAGAAGCAGTCAGGAGG + Intronic
924695612 1:246396691-246396713 CTGTCACAAGAACAGCAAGGGGG - Intronic
924783764 1:247175502-247175524 GTGTTCCAGCAGCAGACAGGAGG + Intergenic
1062816713 10:506354-506376 TTGGGACAGCAGCAGCAAGGGGG + Intronic
1063045048 10:2383309-2383331 CTGACACAGCACCAGCTATGGGG + Intergenic
1064228825 10:13511523-13511545 CTGACTCAGCAGCAGCTAGACGG + Intronic
1064955620 10:20905507-20905529 CTGTCACAACAGCAGCATGTGGG + Intronic
1066056556 10:31686475-31686497 GTGTCCCAGCAGCAGCTTGGTGG - Intergenic
1067694426 10:48524450-48524472 CTCTCCCAGGAGCCGCCAGGGGG + Intronic
1068305061 10:55198363-55198385 CTGTCACAAGAACAGCAAGGGGG - Intronic
1068604356 10:58989121-58989143 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1069731943 10:70622752-70622774 CGGTCACAGCCACACCCAGGAGG - Intergenic
1070342135 10:75507350-75507372 ATGGCACAAAAGCAGCCAGGAGG - Intronic
1070432846 10:76358558-76358580 CTGATAGAGCAGGAGCCAGGAGG + Intronic
1071109371 10:82136911-82136933 ATCTCCCAGCAGCAGCCACGTGG - Intronic
1071823121 10:89297861-89297883 CACTCACAGCACCAGACAGGCGG - Intronic
1072537082 10:96371871-96371893 AGGTCACAGCTGCAGCCAGAGGG + Intronic
1072615407 10:97046314-97046336 CTGGCACTGCTGCAGGCAGGAGG - Intronic
1075222658 10:120598574-120598596 CAGTCACAGCGGCATGCAGGTGG - Exonic
1075873601 10:125788863-125788885 CTGACTCAGCAGCAGCCATGGGG + Exonic
1075942603 10:126404528-126404550 AAGTCACACCAGCAGCCTGGGGG + Intergenic
1076504050 10:130960191-130960213 CTGTCACAGCAAGTGCCAGGTGG - Intergenic
1076586452 10:131551672-131551694 CTGTCACAGCAGCTTTCTGGAGG - Intergenic
1076595133 10:131620473-131620495 CTGCCCCAGCCGCAGACAGGGGG - Intergenic
1076696226 10:132248670-132248692 CTGGCACAGCAGGTGCCATGTGG - Intronic
1076767161 10:132642456-132642478 CTGTCACGGCAGGAGTAAGGCGG - Intronic
1077145755 11:1043506-1043528 CTGTCTCAGCAGCTCCCCGGGGG + Intergenic
1077283846 11:1757211-1757233 CTGGCACAGCAGCAGGGAGGGGG + Intronic
1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG + Intronic
1079087203 11:17454910-17454932 CTGACCCAGTACCAGCCAGGGGG - Intronic
1079486668 11:20942277-20942299 CATTCCCAGCAGCAGCCAAGAGG - Intronic
1079637429 11:22761413-22761435 CTGACAAAGTAGCAGCCAGTGGG + Intronic
1080627421 11:34043140-34043162 CTATCACAGCAACAGCAAGAGGG + Intergenic
1081270065 11:41072442-41072464 CTGTCACAGGAACAGCAAGGGGG - Intronic
1081883267 11:46472148-46472170 CGGTCACAGCAGCAGTAAGGAGG - Intronic
1082008435 11:47434303-47434325 CTGTCACCACAGCAGCATGGGGG + Intergenic
1083506315 11:63160715-63160737 AGGTCACAAAAGCAGCCAGGAGG + Intronic
1083615103 11:64022243-64022265 CGGACACTGCAGTAGCCAGGAGG - Intronic
1084224835 11:67709686-67709708 GTGTGCCAGGAGCAGCCAGGTGG + Intergenic
1084262654 11:67989529-67989551 GTGTGCCAGGAGCAGCCAGGTGG + Intergenic
1084511649 11:69609186-69609208 CTGGCACAGCAGCAGCAACGAGG + Intergenic
1085174524 11:74474423-74474445 CTGTGTCAGCACCATCCAGGTGG - Intergenic
1085217313 11:74844029-74844051 CAGTCACAGCAACAGGCTGGGGG + Intronic
1085530558 11:77189783-77189805 CCTTCACAGCACCAGCCAGTCGG - Intronic
1085806894 11:79644691-79644713 CTATCACAGGAACAGCGAGGGGG + Intergenic
1087847850 11:102993477-102993499 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1087917766 11:103830743-103830765 ATGTCACAGCAGAAGGCAGAAGG - Intergenic
1088727913 11:112655880-112655902 CTGACACTGCAGCAGGCACGTGG + Intergenic
1089298166 11:117481880-117481902 CTATCACATCTGCATCCAGGAGG - Intronic
1089303722 11:117514098-117514120 TGGGCAAAGCAGCAGCCAGGGGG + Intronic
1089356415 11:117856952-117856974 CTGGCAGAGCAGTGGCCAGGAGG + Intronic
1089765032 11:120757054-120757076 CTGACACAGCAGCAGCATCGTGG + Intronic
1090022675 11:123141528-123141550 CTGTCACAGCACAAGGAAGGAGG - Intronic
1090452698 11:126820711-126820733 CGGGCACAGCAGCAGGCTGGAGG + Intronic
1091374602 12:17437-17459 TTGTTACAGCACCAGCCAGGGGG + Intergenic
1091588808 12:1830999-1831021 GTGTGACAGCCGCAGCCTGGAGG + Exonic
1091896946 12:4113170-4113192 CTGTTTAAGCAGCAGGCAGGGGG - Intergenic
1092002794 12:5045273-5045295 CTGGCAGAGCAGCAGCCAGGGGG + Exonic
1092527053 12:9315733-9315755 TTGTTACAGCACCAGCCAGTTGG + Intergenic
1093466807 12:19457757-19457779 ATGTCACAGCAGCATCAAGCGGG + Intronic
1093567645 12:20627447-20627469 ATGTCAGAGGAGCAGTCAGGAGG - Intronic
1094310059 12:29070408-29070430 CTGTCATAGCAGTGGCCAAGAGG - Intergenic
1094627578 12:32139179-32139201 CAGTCACCACAGCAGCCACGTGG - Intronic
1095361841 12:41351637-41351659 CTGTCACAAGATCAGCAAGGGGG + Intronic
1095421437 12:42028456-42028478 CTATCACAAGAGCAGCAAGGGGG + Intergenic
1095951618 12:47784741-47784763 TCCTCACAGCAGCAGGCAGGAGG - Intronic
1096587678 12:52633642-52633664 CTGCCACAGCAGCTCCCAGTTGG + Intergenic
1096597270 12:52703933-52703955 CTGTCACAGCATCGTCCTGGTGG + Intergenic
1098387633 12:69935637-69935659 ATGTCAGAGAAGCAGCCAGAGGG + Intronic
1098437109 12:70479600-70479622 CTGTCACAGGAACAGCTATGGGG - Intergenic
1099475982 12:83107945-83107967 CTATCACAGGAACAGCAAGGGGG - Intronic
1099979684 12:89584059-89584081 CAGTCACAGCAGGAGCGAGGTGG - Intergenic
1100159807 12:91844471-91844493 CTGTCACAGAAACAGCATGGTGG - Intergenic
1100163378 12:91888195-91888217 CTATCACAAGAGCAGCAAGGAGG + Intergenic
1100544792 12:95591315-95591337 CAGTTACAGCACCAGCCAGGTGG + Intergenic
1102565913 12:113797424-113797446 CTGTCACAGCTGCAGCCGGCTGG + Intergenic
1103159479 12:118716446-118716468 TTTCCACAGCAACAGCCAGGAGG + Intergenic
1103235008 12:119364816-119364838 CTGTCACAGGAGCAAACAGCAGG + Intronic
1103413025 12:120726009-120726031 CTGTCAGAGCCGCTGGCAGGCGG + Intronic
1104001251 12:124862107-124862129 CTGGCACTGCAGCAGCCACAAGG + Intronic
1104902576 12:132197382-132197404 GCATCACAGCAGCACCCAGGGGG + Intronic
1104905492 12:132211461-132211483 CTGTCACCACAGCAGTGAGGAGG + Intronic
1105843485 13:24275200-24275222 CACTGACAGCTGCAGCCAGGAGG + Intronic
1106464979 13:30005386-30005408 ATGTTCCAGCAGCAGCCAGATGG + Intergenic
1106593964 13:31121374-31121396 CTGCCCCAGCAGCAGCCTGGTGG - Intergenic
1107447655 13:40482846-40482868 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1107811889 13:44208394-44208416 CTGTCACAGCCACAGACAGGAGG + Intergenic
1107881586 13:44836856-44836878 CTGACGCAGGAGCAGCAAGGAGG - Intergenic
1108574950 13:51782678-51782700 CTGTCACAGCCGCAGTATGGGGG + Intronic
1110317288 13:74124896-74124918 CTGTAACCCCAGCAGCAAGGCGG + Intronic
1111310650 13:86480086-86480108 CTATCACAAGAGCAGCAAGGGGG - Intergenic
1112333951 13:98498792-98498814 CAGACACAGCAGGAGCCAGTGGG + Intronic
1112512376 13:100021048-100021070 CTATCACAACAACAGCAAGGGGG - Intergenic
1112584736 13:100708292-100708314 CTATCACAGGAACAGCCAGGAGG - Intergenic
1112994486 13:105556395-105556417 CTGTCACAAGAGAAGCAAGGTGG - Intergenic
1113346803 13:109486120-109486142 CTATCACAGGAACAGCAAGGGGG - Intergenic
1113570250 13:111348709-111348731 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1113634270 13:111909245-111909267 CTGGCACAGCAGCAGCCAGGCGG + Intergenic
1114074243 14:19146331-19146353 CTGTCACAGAAGGAGCAAGGGGG + Intergenic
1114088025 14:19253644-19253666 CTGTCACAGAAGGAGCAAGGGGG - Intergenic
1114566192 14:23634822-23634844 CTATCACAAGAGCAGCAAGGGGG - Intronic
1116662870 14:47734513-47734535 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1118452219 14:65913356-65913378 CTTTCCCAGCACCAGCCATGGGG + Intergenic
1119375926 14:74192795-74192817 ATGTTCCAGCAGCAGACAGGAGG + Intronic
1119574987 14:75711935-75711957 CTGCCACAGCAGCAAGTAGGGGG + Intronic
1120958581 14:90104449-90104471 TTGGCACAGCAGCACCCAGAAGG + Intronic
1121894963 14:97638230-97638252 CTATCACAACAACAGCAAGGGGG - Intergenic
1122082930 14:99279149-99279171 CTCTCACTGCAGCAGCCACAGGG + Intergenic
1122282826 14:100634302-100634324 CTGGCATCTCAGCAGCCAGGTGG + Intergenic
1122297817 14:100714986-100715008 CTTTCTCAGAAGGAGCCAGGGGG + Intergenic
1122429692 14:101632501-101632523 CTGTCCAGGAAGCAGCCAGGCGG - Intergenic
1122577073 14:102749375-102749397 CTGTCCCAGCACCTGCCGGGTGG + Intergenic
1122685902 14:103506184-103506206 CTGGCAAGGCAGCAGCAAGGAGG + Intergenic
1122905028 14:104797657-104797679 CAGTCCCAGCAGCAGCCGTGGGG - Intergenic
1122920671 14:104878703-104878725 CTGTCACTGCAGCAGGCTGGGGG - Intronic
1122959169 14:105086809-105086831 CCGTCCCAGGAGCAGCCCGGTGG - Intergenic
1123121827 14:105920300-105920322 GGGTCCCAGCAGGAGCCAGGTGG + Intronic
1202853474 14_GL000225v1_random:36252-36274 CTGTGGCAGGTGCAGCCAGGAGG - Intergenic
1202854580 14_GL000225v1_random:42695-42717 CTGCCGCAGGTGCAGCCAGGAGG - Intergenic
1202860860 14_GL000225v1_random:80147-80169 CTGTGGCAGGTGCAGCCAGGAGG + Intergenic
1123807719 15:23892026-23892048 CTCTGAGAGCAGCAGCCAGCAGG + Intergenic
1124141920 15:27084776-27084798 CCATCACTGCAGAAGCCAGGAGG + Intronic
1125454589 15:39844479-39844501 CAGTCACAGGATCAGCCAAGAGG + Intronic
1127672160 15:61205651-61205673 CTGGCACAGGAACAGCCAGAGGG + Intronic
1128049526 15:64651671-64651693 CTGTGACAGGAGCTGTCAGGAGG + Intronic
1128063239 15:64748326-64748348 CTGGGACAGCAGCGGCCAAGTGG + Intronic
1128145550 15:65330677-65330699 CTCCCACAGCAGCTGCAAGGAGG + Exonic
1128931114 15:71705640-71705662 GTGTCAGGACAGCAGCCAGGAGG + Intronic
1129958788 15:79664354-79664376 ATGTCACAGCAACAGCAAGAAGG + Intergenic
1130041379 15:80407505-80407527 CTGTCATAGCAGAAGTCATGAGG - Intronic
1130053230 15:80501610-80501632 CTCTCCCTCCAGCAGCCAGGAGG + Intronic
1131014933 15:89050327-89050349 ATGTCTCAGCAGCAACCATGTGG + Intergenic
1131114079 15:89783609-89783631 CTGTCCCTCCACCAGCCAGGAGG - Intergenic
1131546013 15:93316052-93316074 CTGTCACAAAAGCACCAAGGGGG - Intergenic
1132215631 15:100059717-100059739 CTGCCACAGAAGGGGCCAGGAGG - Intronic
1132349590 15:101131285-101131307 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1132451993 15:101973616-101973638 TTGTTACAGCACCAGCCAGGGGG - Intergenic
1132454902 16:17005-17027 TTGTTACAGCACCAGCCAGGGGG + Exonic
1132590994 16:726422-726444 CAGTGGCAGCAGCAGCCATGGGG - Exonic
1133873598 16:9712412-9712434 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1135662162 16:24306304-24306326 TGGTCACTTCAGCAGCCAGGAGG - Intronic
1138133178 16:54499598-54499620 TTGTCCCAGCTGCAGACAGGGGG + Intergenic
1138656689 16:58495626-58495648 CCGTGACAGCACCAGCCAAGTGG + Intronic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1139840468 16:69874340-69874362 TTCTCACAGCAGCAGCCCGAGGG - Intronic
1140249771 16:73286031-73286053 CTGTCTCAGATCCAGCCAGGCGG - Intergenic
1140455026 16:75099992-75100014 CTTCCACAGCAGGAGGCAGGAGG - Intronic
1140665754 16:77225691-77225713 CTGTCACACTAACAGCAAGGGGG - Intergenic
1141168419 16:81676043-81676065 TCCTCACAGCAGCAGCCAGAGGG - Intronic
1141441931 16:84034703-84034725 TGGTCACAGCAGCATCCACGTGG + Intronic
1141449556 16:84088866-84088888 CTGTCACTTCAACAGCCAGCAGG + Intronic
1141552289 16:84814040-84814062 CAGTCACAGAAGTATCCAGGGGG - Intergenic
1142155646 16:88531829-88531851 CTGTCACAGGACCATCCAGGAGG + Intronic
1142194977 16:88735208-88735230 CTGGCGCAGCAGGAGCCAGAAGG + Exonic
1142200900 16:88760708-88760730 TTGACGCAGCAGCACCCAGGGGG + Intronic
1142570266 17:869021-869043 CTATCACTGCAGACGCCAGGTGG + Intronic
1142678497 17:1531044-1531066 CCTTCACAGCAAAAGCCAGGAGG + Intronic
1142715687 17:1745696-1745718 CTGTCCCTGCAGGAGCCTGGTGG + Exonic
1142877515 17:2860957-2860979 AGGTCACAGAAGCAGGCAGGGGG - Intronic
1142898305 17:2996260-2996282 CTGTCAGAGCAGCAAACGGGGGG - Intronic
1144060730 17:11581742-11581764 CAGTTACAGCATCAGCTAGGTGG + Intergenic
1144512404 17:15888310-15888332 CAGTCCCAGCCGCAGCCATGAGG - Intergenic
1144584115 17:16477665-16477687 CCTTCCCAGCAGGAGCCAGGAGG + Intronic
1145002493 17:19315004-19315026 TGGTCACACCAGGAGCCAGGTGG + Intronic
1145042035 17:19584173-19584195 TTGTGACAGCAGAAGCCACGGGG + Intergenic
1145960874 17:28885944-28885966 CAGTCTGAGGAGCAGCCAGGGGG + Intronic
1146157185 17:30534614-30534636 CTGTCAAGGCAGCAGCGGGGAGG + Intergenic
1146271706 17:31489214-31489236 CTGCCAGAGCAGGAGGCAGGTGG + Intronic
1146480764 17:33203192-33203214 CTGTCTCAGAAGCAGCCCGAAGG + Intronic
1146626942 17:34442092-34442114 CTGTCACTGCCCCTGCCAGGGGG + Intergenic
1147957951 17:44147973-44147995 GTGTAACAGCAGCAGCCTGGAGG - Exonic
1147988597 17:44320233-44320255 CCTCCGCAGCAGCAGCCAGGTGG + Exonic
1148196106 17:45714466-45714488 CTGTCACAGCACCAGCTGGCAGG + Intergenic
1148655030 17:49276869-49276891 CTGAAACATCAGAAGCCAGGTGG - Intergenic
1150497308 17:65617765-65617787 CTGCCAAAGGAGCAGCCACGTGG + Intronic
1150876564 17:68977198-68977220 TGGTCACAGGAGCCGCCAGGTGG + Intronic
1151507556 17:74539547-74539569 CTGTGACAGCAGGAGCCATTGGG - Intergenic
1151509094 17:74547392-74547414 CTGTGACAGCAGGAGCCATTGGG - Intergenic
1151675871 17:75597041-75597063 CTGGGACAGCAGCAGCGAAGGGG + Intergenic
1151868080 17:76818127-76818149 CTGGCACAACAACAGCCAGGAGG + Intergenic
1152103185 17:78314521-78314543 CTGTGACTGGGGCAGCCAGGAGG - Intergenic
1152234067 17:79129487-79129509 CTGGCTCAGCAGGAGCCTGGGGG - Intronic
1152521773 17:80860558-80860580 GTGTCACAGCTGAAGTCAGGGGG + Intronic
1152640722 17:81448184-81448206 CTGGCAGAGCAGGAGGCAGGCGG - Intronic
1152793406 17:82293749-82293771 CTTTCACCGCAGAATCCAGGCGG - Intergenic
1153240764 18:3029522-3029544 CTGTGACAGCATCAGCTATGAGG - Intergenic
1154065351 18:11102450-11102472 CTGCCACTGCACCAGCCTGGTGG - Intronic
1155561095 18:27078026-27078048 CTATCACAACAACAGCAAGGGGG + Intronic
1156477192 18:37413060-37413082 CTGTGACAGGAGCAGCTAGCTGG - Intronic
1157600148 18:48888706-48888728 CTGTGACAGCAGCACACAAGGGG - Intergenic
1159560120 18:69984593-69984615 CTTACACGGCAGAAGCCAGGAGG + Intergenic
1160805205 19:989595-989617 CTGTCAGGGCAGCGGCCAGCAGG - Intronic
1160851437 19:1194759-1194781 CTGGCCCCGCAGCAGCCAGAGGG - Intronic
1160950994 19:1667388-1667410 GTGTCCAAGCAGCAGCGAGGAGG - Intergenic
1161506342 19:4645892-4645914 TTGTTACAGGAACAGCCAGGAGG - Intronic
1161668477 19:5590911-5590933 CTGAGAAAGCAGCAGCCTGGTGG - Intronic
1161953351 19:7479537-7479559 CTGCCGGAGCATCAGCCAGGAGG - Intronic
1163029941 19:14537368-14537390 CTGTTTCAGCCGCACCCAGGTGG + Intronic
1163109418 19:15150405-15150427 CTGGTACAGGAGCAGCAAGGAGG + Intergenic
1163420814 19:17212728-17212750 CTGTCAGAGCAGAAGCCACTAGG + Exonic
1163578867 19:18126301-18126323 CTGGTCCAGCAGTAGCCAGGGGG + Intronic
1163721724 19:18901076-18901098 CGCTCACAGGAGCAGCCATGAGG + Intronic
1165068293 19:33241370-33241392 CTTTCACAGCAGCAACCGTGAGG + Intergenic
1165391923 19:35543769-35543791 CTGTAAAAGCAGCAGCCAAGGGG + Exonic
1166117767 19:40666527-40666549 CTGACTCAGCACCTGCCAGGCGG - Exonic
1166275173 19:41748533-41748555 CTGCACCTGCAGCAGCCAGGTGG + Intronic
1166280191 19:41787329-41787351 CTGCACCTGCAGCAGCCAGGTGG + Intergenic
1166412516 19:42565612-42565634 CTGCACCTGCAGCAGCCAGGTGG - Intergenic
925181884 2:1822741-1822763 TGGACACAGCAGCAGCCATGAGG - Intronic
925259457 2:2517204-2517226 CTGTGCCAGCTGGAGCCAGGAGG + Intergenic
925369704 2:3335701-3335723 CTGTCACAAGAACAGCAAGGGGG - Intronic
925482457 2:4291523-4291545 CTGTCACAATAACAGCAAGGGGG - Intergenic
925904408 2:8530941-8530963 CACTCACAGCACCCGCCAGGTGG + Intergenic
926149104 2:10414880-10414902 CTGTTACAGCGGCAGACGGGAGG + Intronic
926643764 2:15266049-15266071 CTATCACAGCAGCAGCATGGGGG - Intronic
926971744 2:18473602-18473624 CTGAGACAGCAGCAGCATGGAGG - Intergenic
929314963 2:40465975-40465997 CTCACATAGCAGAAGCCAGGAGG - Intronic
930678743 2:54232815-54232837 CTATCACAGGAACAGCAAGGGGG + Intronic
932892971 2:75611933-75611955 CTGTCCCAGCAGCAGTAGGGAGG - Intergenic
934517827 2:94999753-94999775 CAGGCACAGCAGCAGCCAGGTGG + Intergenic
934994229 2:98942397-98942419 CTGTCACCACAACATCCAGGTGG + Intergenic
936083038 2:109447987-109448009 TTCTCCCAGCAGCAGCCTGGAGG - Intronic
936159082 2:110070594-110070616 CCGGAACAGCAGCAGCCAGCTGG - Intergenic
936185579 2:110300738-110300760 CCGGAACAGCAGCAGCCAGCTGG + Intergenic
936568208 2:113596092-113596114 TTGTTACAGCACCAGCCAGGGGG - Intergenic
937176737 2:119944129-119944151 GTGCCACATCAGCAGCCATGTGG + Intronic
938408601 2:131046150-131046172 CTGGCACAGCATCAGCCGGCTGG + Exonic
938488570 2:131742829-131742851 CTGTCACAGAAGGAGCAAGGGGG + Intronic
938701622 2:133885034-133885056 TAGTCAAAGCAGCAGCCATGGGG + Intergenic
938901072 2:135798778-135798800 CATTCCCAGCAGCAGCCAGTGGG - Intronic
939405193 2:141746501-141746523 ATCTCCCAGCAGCAGCCACGTGG - Intronic
943112711 2:183625397-183625419 CTGTCACAAGAACAGCAAGGGGG - Intergenic
943353483 2:186822515-186822537 GGGTCAGAGTAGCAGCCAGGAGG + Intergenic
946147127 2:217739492-217739514 CTGTCAGCTCAGCATCCAGGAGG + Exonic
946700048 2:222403335-222403357 CTGCTACACCAGCAGTCAGGTGG - Intergenic
947170892 2:227310234-227310256 CTGTCATAGCTGCACGCAGGTGG + Intronic
947474284 2:230428785-230428807 CTGTCACAAGAACAGCAAGGGGG + Intronic
947913347 2:233816906-233816928 ATGTCAGAGCAGCAGGCTGGGGG - Intronic
948259302 2:236591042-236591064 CTGTCTGAGCAGGAGGCAGGAGG - Intergenic
948663002 2:239518251-239518273 CTGTCACACCGTCAGCTAGGAGG + Intergenic
948674338 2:239588259-239588281 CTGTCACAGCAAAGGCCAGGGGG - Intergenic
948901400 2:240958496-240958518 CTGGCACAGGGGCAGCCATGTGG + Intronic
1168853127 20:990073-990095 CATTCACAGGAGGAGCCAGGAGG + Intronic
1169916226 20:10686582-10686604 CTGTCAGAGCAGGAGCCACCTGG + Intergenic
1170000476 20:11608551-11608573 CTGCCAGAGCATCAGCCATGTGG - Intergenic
1170117287 20:12873812-12873834 CTGTCACAGCAGCAAAAAGCAGG + Intergenic
1170696663 20:18665253-18665275 CTGTCACAGAAGCAGACACTGGG - Intronic
1170993073 20:21323056-21323078 CAGTCACAGCAACAGCCAGATGG - Intronic
1171317702 20:24209876-24209898 CTGGGAGAGCAGGAGCCAGGAGG + Intergenic
1171490805 20:25515699-25515721 CTGTCACAAAAACAGCAAGGGGG - Intronic
1172096707 20:32463999-32464021 CTGTCACAGCAGCAGCCAGGCGG + Intronic
1172704560 20:36873281-36873303 CTGTCCCAGAGGCACCCAGGTGG + Intergenic
1172914285 20:38432154-38432176 CTGGCACAGAAGCCACCAGGTGG + Intergenic
1172973533 20:38890238-38890260 CTGTCCACGCAGCAGCCATGGGG + Intronic
1175171087 20:57082032-57082054 CTCTGCCAGCAGCTGCCAGGAGG + Intergenic
1175264653 20:57695341-57695363 CTGTCCCAGCCCCAGCCAGGGGG - Intronic
1175618689 20:60424801-60424823 CTGTCCCGGCAGGAGCCAAGAGG - Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1175874990 20:62225157-62225179 GTGTCACAGCAGCGGACAGCAGG + Intergenic
1175877685 20:62238282-62238304 CAGTCACAGCAGGAGAGAGGCGG - Intronic
1176249789 20:64115033-64115055 CTGCCTTGGCAGCAGCCAGGAGG + Intergenic
1176264822 20:64203649-64203671 CTGGCTCAACAGCAGCCATGGGG - Intronic
1177278943 21:18952602-18952624 CAGTAAGAGCAGCAGCCAGGTGG - Intergenic
1177930066 21:27270343-27270365 CTGTCACAAAAACAGCAAGGGGG + Intergenic
1178398140 21:32260612-32260634 CCGGCAAAGCAGCAGCAAGGAGG + Intergenic
1180045897 21:45305002-45305024 CTCTCATAGCAGAAGGCAGGAGG - Intergenic
1180082507 21:45493318-45493340 GTGTCACAGCAGCAGCCGGGGGG - Intronic
1180289887 22:10839271-10839293 CTGTCACAGAAGGAGCAAGGGGG + Intergenic
1180492684 22:15868693-15868715 CTGTCACAGAAGGAGCAAGGGGG + Intergenic
1181280074 22:21713452-21713474 CTGTCACAGCTACAGCATGGAGG + Intronic
1181456773 22:23064306-23064328 CTGTCACTGCAGCTGCCTGCTGG - Intronic
1181493131 22:23273218-23273240 TTGTCATAGCTGCAGCCAAGGGG + Intronic
1181891381 22:26066606-26066628 GAGACACAGCAGCAGTCAGGGGG + Intergenic
1182264504 22:29103265-29103287 CAGACCCAGCAGGAGCCAGGGGG + Intronic
1182718969 22:32382593-32382615 CTATCACCTCTGCAGCCAGGTGG + Intergenic
1183174427 22:36212499-36212521 CTGTAAGTGCAGCAGCAAGGAGG - Intergenic
1183290941 22:37001814-37001836 GTGTCATAGCAGGGGCCAGGAGG - Intronic
1183373669 22:37449838-37449860 CTGTCGCAGCCTCAGCCACGGGG + Intergenic
1183385744 22:37513521-37513543 CTGTCCCAGCAGCCCCCAGATGG + Intronic
1184552616 22:45212536-45212558 CTGGGACTGCCGCAGCCAGGGGG - Intronic
1184669753 22:46006498-46006520 GTGTCACTGCAGCCACCAGGGGG + Intergenic
1185269761 22:49923896-49923918 CAGTCCCAGCAGCAGGGAGGAGG + Intronic
1185297290 22:50060690-50060712 CTGTCACAGCAGCGGCCACGTGG + Exonic
949875127 3:8621495-8621517 CTGTCAGAGGAGAGGCCAGGGGG + Intronic
950335081 3:12187135-12187157 CAGCCACAGCAGCAGTCAGCAGG - Intronic
950424749 3:12919114-12919136 GTGTCCAAGCAGCAGCCAGGAGG - Intronic
950508152 3:13408932-13408954 CAGTCTCAGCAGCCGTCAGGTGG - Intronic
950764235 3:15261456-15261478 TGGTCACAGCCCCAGCCAGGAGG - Intronic
951492584 3:23288914-23288936 ATGCCCCAGCAGCAGCCACGTGG - Intronic
951896177 3:27611924-27611946 GTGTCACAGCAGGACCTAGGGGG + Intergenic
952321581 3:32282807-32282829 GTGTCACAAAAGCAGCAAGGGGG - Intronic
952735183 3:36682110-36682132 CTGTCACAACAGCAGCACTGAGG + Intergenic
952862423 3:37824491-37824513 CTGTCACAGGATGAGACAGGGGG - Intergenic
953535156 3:43771531-43771553 CTCACACAGGAGCAGGCAGGGGG + Intergenic
953673296 3:44980572-44980594 CTTTCACTGCAGCAGGAAGGTGG - Intronic
953890914 3:46750907-46750929 CCGTCTCCGCAGCCGCCAGGTGG - Intronic
954366110 3:50147024-50147046 CTGGCACCCCAGTAGCCAGGGGG + Intergenic
954447514 3:50554541-50554563 CAGGCACAGCAGCATCCAGGAGG - Intergenic
955217288 3:56994884-56994906 CTGTCACAAGAACAGCAAGGGGG - Intronic
955889030 3:63631159-63631181 CTTTCACGGAAGCACCCAGGAGG - Intergenic
957078087 3:75617471-75617493 GTGTGCCAGGAGCAGCCAGGTGG + Intergenic
957552957 3:81730616-81730638 GTTTCACAACAGAAGCCAGGAGG + Intronic
957711195 3:83861171-83861193 CTATCACAAGAGCAGCAAGGGGG + Intergenic
957746420 3:84348670-84348692 CTGTCACAAGAACAGCAAGGGGG + Intergenic
958926131 3:100159057-100159079 ATGTCACAGAAGCTGCCAGATGG - Intronic
959507792 3:107175166-107175188 CTATCACAGAAACAGCAAGGGGG - Intergenic
959901168 3:111663229-111663251 CTATCACAAGAGCAGCAAGGGGG + Intronic
959932484 3:111999303-111999325 CTGGCCCAGCAGCAGCAAAGAGG - Exonic
961103340 3:124220728-124220750 CTGTCCCAGCAGATCCCAGGAGG + Intronic
961307924 3:125972243-125972265 TTGTCATGGCTGCAGCCAGGGGG + Intronic
961343567 3:126246508-126246530 CTGACACAGCAACAGCGAGCAGG + Intergenic
961493200 3:127270793-127270815 CTCACACAGCACCAGCCAGGTGG - Intergenic
961589080 3:127961832-127961854 CTATCACTGCATCAGTCAGGTGG - Intronic
964154263 3:153565177-153565199 CTGTCACAAGAACAGCAAGGGGG - Intergenic
964179213 3:153864233-153864255 ATCTCCCAGCAGCAGCCATGTGG + Intergenic
966209234 3:177435436-177435458 GTGTCAAAGAAGCAGCCAAGAGG + Intergenic
966261534 3:177984652-177984674 CTGTCACAGCAGCAGGCTAACGG - Intergenic
966823625 3:183944956-183944978 CTGTCACGGGAACAGCAAGGGGG - Intronic
967791418 3:193553012-193553034 CAGACACAGCAACAGGCAGGTGG + Intronic
968594462 4:1475086-1475108 CTGTTAGAGAAGCAGCCCGGGGG - Intergenic
968934210 4:3601517-3601539 CTCTCAGAGCACCAGCCATGCGG - Intergenic
969732699 4:8965976-8965998 GTGTGCCAGGAGCAGCCAGGTGG - Intergenic
969792282 4:9500055-9500077 ATGTGCCAGGAGCAGCCAGGTGG - Intergenic
970249897 4:14103070-14103092 CAGTCAGAGCAGCAGCCTGAAGG - Intergenic
970571359 4:17386335-17386357 CTATCACAGGACCAGCAAGGGGG + Intergenic
971033638 4:22668884-22668906 CTGGCAGAACAGCAGCCAGTAGG - Intergenic
971868432 4:32203965-32203987 CTGTCATAGCAGCAGACAATGGG + Intergenic
971945538 4:33271455-33271477 CTGTCACAAGAACAGCAAGGGGG + Intergenic
972318288 4:37948191-37948213 ATGTCAGAGGAGCAGCAAGGCGG + Intronic
973090399 4:46128650-46128672 CTGTCTCAGCAGCACTCTGGAGG - Intergenic
973227348 4:47801673-47801695 CTGTCACAGCAGAAAGCAGAGGG + Intronic
974125810 4:57693867-57693889 CTGTCACAAGAACAGCCTGGGGG - Intergenic
974311167 4:60211163-60211185 CTGTCACAAGAACAGCAAGGGGG + Intergenic
975626873 4:76359021-76359043 CTGTCACAAGAACAGCAAGGGGG - Intronic
976154554 4:82128576-82128598 CAGCCATTGCAGCAGCCAGGGGG + Intergenic
977052082 4:92141330-92141352 CAGTTACAGCATCAGCTAGGTGG + Intergenic
977093455 4:92708825-92708847 CTGACACAGGAGTATCCAGGCGG + Intronic
977167013 4:93711748-93711770 ATGCCCCAGCAGCAGCCATGTGG - Intronic
977282718 4:95061900-95061922 CTGTCACAAGAACAGCAAGGGGG - Intronic
978295594 4:107200962-107200984 CTATCACAGAAGCTGCAAGGAGG + Intronic
983419574 4:167500520-167500542 CAGTCACGAAAGCAGCCAGGAGG - Intergenic
983875996 4:172874976-172874998 CTGGCAGAGCAGCTGCCAGCTGG + Intronic
984073502 4:175146918-175146940 CTGTCACTGGAGGAGGCAGGCGG - Intergenic
984372299 4:178883203-178883225 CTATCACAGGAACAGCAAGGGGG - Intergenic
984563750 4:181302286-181302308 CTGTTACTGCCTCAGCCAGGTGG + Intergenic
986003685 5:3649962-3649984 CTGTCACAGAAACAGCATGGGGG - Intergenic
986093749 5:4536193-4536215 CTGCACCAGCAGAAGCCAGGAGG + Intergenic
986250209 5:6048905-6048927 CGGGCACACCAGCAGCCAGCAGG + Intergenic
986737557 5:10679504-10679526 CTTTCGGAGCAGCACCCAGGAGG - Exonic
986905044 5:12485832-12485854 CTATCACAGCAACAGCAAGGGGG - Intergenic
989434797 5:41398258-41398280 CTATCACAAAAACAGCCAGGGGG - Intronic
990335507 5:54768447-54768469 CTGTCACAGCAGCTGCAAGTGGG - Intergenic
992640443 5:78764260-78764282 CTGTGAAAGCAGGAGCCAGGTGG - Intronic
993593722 5:89827005-89827027 CAGTCACGGCAGCAGCAAGAAGG + Intergenic
993861273 5:93139897-93139919 CTGACACAGCAGAAGCCAGATGG - Intergenic
994081605 5:95713388-95713410 CTGTCACAAGATCAGCAAGGGGG - Intergenic
994150665 5:96444087-96444109 GTGTCACAGAAGCAGCCACAGGG + Intergenic
995181773 5:109236455-109236477 CCTTCACAGCAGCACCCAGATGG - Intergenic
996001392 5:118368657-118368679 ATGTCTCAGCAGGGGCCAGGTGG - Intergenic
996565905 5:124879788-124879810 CCGGCACACCAGCAGCTAGGTGG - Intergenic
997182443 5:131844138-131844160 CTGTCACAAGAACAGCAAGGGGG + Intronic
998092789 5:139380871-139380893 CTGGAACAGCGGCAGCCTGGAGG + Exonic
999291344 5:150428402-150428424 CTTTCACAGCAAGAGTCAGGAGG - Intergenic
999681017 5:154060092-154060114 CAGTCACAGAAGCAGGCAGGGGG + Intronic
1000026392 5:157362724-157362746 CTGTTACAGCAAGAGCTAGGAGG + Intronic
1000999679 5:167994047-167994069 CTGACAGAGCAGCAGCCTTGGGG - Intronic
1001553453 5:172620666-172620688 CTGCCATGGCAGCAGCCAGGGGG - Intergenic
1002802126 6:533669-533691 TTGTCTCACCAGCAGGCAGGAGG + Intronic
1003798142 6:9629470-9629492 CTATCACAAGAACAGCCAGGGGG - Intronic
1006034974 6:31204235-31204257 CTGTAAAAGCAGCAGCCAAATGG - Intergenic
1006152302 6:31996046-31996068 CTGTCCCAGCAGCAGGCTGACGG + Exonic
1006158605 6:32028784-32028806 CTGTCCCAGCAGCAGGCTGACGG + Exonic
1006315197 6:33287348-33287370 CACTCACAGCTGTAGCCAGGAGG + Exonic
1006340356 6:33443348-33443370 CTGGCCCATCAGCAGCCATGTGG - Exonic
1007814175 6:44508587-44508609 CATTCACAGCAGCAGCAAGCAGG - Intergenic
1009598691 6:65770106-65770128 TTGTCAAAGCAGCTGCCAGGTGG - Intergenic
1011343131 6:86339762-86339784 ATTACACAGCAGCAGCCATGTGG + Intergenic
1011975086 6:93285954-93285976 TTGGCACAGAAGCAGCCAGAGGG - Intronic
1012310045 6:97712437-97712459 CTGTCACAGCAGAGGCCATGGGG + Intergenic
1013373979 6:109496345-109496367 CAGTGCCTGCAGCAGCCAGGAGG - Intronic
1013396037 6:109740996-109741018 CTGTCACAAAAACAGCAAGGGGG + Intronic
1015160762 6:130150262-130150284 CAGTTACAGCACCAGCTAGGTGG + Intronic
1015862213 6:137692794-137692816 CAGTTACAGCACCAGCTAGGTGG + Intergenic
1015985347 6:138879053-138879075 GTGTTTCAGCAGCAGGCAGGAGG - Intronic
1016264435 6:142214485-142214507 CTGTCACAAGAACAGCAAGGGGG + Intronic
1016378722 6:143450869-143450891 CTGTCACCGGAGCGGCAAGGGGG - Intronic
1017379343 6:153810384-153810406 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1017954564 6:159167990-159168012 CTGTCTCACCAGCAGCCACCCGG - Intergenic
1018029033 6:159827491-159827513 CTGTTCCAGCTGCAGCCATGTGG + Intergenic
1018064882 6:160117921-160117943 CTGGGACAGCAGCAGGCATGGGG - Intergenic
1018875342 6:167817596-167817618 CTGTGACAACTGAAGCCAGGTGG + Intergenic
1018946496 6:168350146-168350168 CTGTCACAGGAACAGCATGGGGG + Intergenic
1018954882 6:168402726-168402748 CAGTTACAGCATCAGCTAGGTGG - Intergenic
1019004045 6:168781330-168781352 CTGGCACTGCCTCAGCCAGGAGG + Intergenic
1019119256 6:169790321-169790343 CTGGTAAAGCAGCGGCCAGGGGG + Intergenic
1019350964 7:553797-553819 CTGTCACAGGGGCTGCCAGTTGG - Intronic
1019464055 7:1176775-1176797 CTGACTCATCAGAAGCCAGGTGG - Intergenic
1019484193 7:1281144-1281166 CAGCAGCAGCAGCAGCCAGGAGG + Intergenic
1019507637 7:1400684-1400706 CATGCACAGCAGCAGCCCGGGGG - Intergenic
1019849329 7:3538678-3538700 CTGGCACAGAAGTAGCCGGGTGG - Intronic
1019985187 7:4650471-4650493 ATATCACAGCAGAAGCGAGGGGG - Intergenic
1020308584 7:6853474-6853496 GTGTGCCAGGAGCAGCCAGGTGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1021970873 7:25964805-25964827 CTGCCTCACCAGCAGCAAGGCGG + Intergenic
1022161299 7:27713792-27713814 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1023706912 7:42950584-42950606 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1024171955 7:46798018-46798040 CTATCACAACAACAGCCAGGGGG + Intergenic
1024483929 7:49894732-49894754 GAGACACAGGAGCAGCCAGGAGG + Intronic
1025973820 7:66353713-66353735 CACTGACAGCAGCAGCCTGGAGG - Intronic
1026824750 7:73574382-73574404 CCTTCAGAGCTGCAGCCAGGAGG + Exonic
1027405527 7:77855836-77855858 CATTCCCAGCAGCAGCCACGTGG - Intronic
1028915300 7:96252484-96252506 CTCTCACAGAAGCAGCAGGGAGG + Intronic
1029799956 7:102936076-102936098 ATCCCACAGCAGCAGCCATGTGG + Intronic
1029869302 7:103672946-103672968 ATGTAACAGAAGCAGCAAGGAGG - Intronic
1031452652 7:121940894-121940916 CTGGTATAGCAGCAGGCAGGGGG - Intronic
1031991311 7:128201066-128201088 CGGTGGCAGGAGCAGCCAGGAGG + Intergenic
1032807520 7:135371908-135371930 ATGTCAAAGCAGCAGCCTGGAGG + Intronic
1032808269 7:135380531-135380553 CTGTGACAACAGCTGCCAGCTGG + Intronic
1032863624 7:135904672-135904694 CTTTCAATGCAGCAGCCAGGGGG - Intergenic
1033069936 7:138192783-138192805 CTGTCATGGCAGCAGGCAGGAGG - Intergenic
1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG + Intergenic
1035070370 7:156140246-156140268 CTGGCAGCCCAGCAGCCAGGAGG + Intergenic
1035295697 7:157865841-157865863 CTGTCAGAGGAGCAGACGGGAGG + Intronic
1035927674 8:3745914-3745936 TGGTCACAGCAGCAGGCCGGGGG + Intronic
1036255293 8:7201406-7201428 CTGTAAGAGAAGCATCCAGGGGG - Intergenic
1036362196 8:8086090-8086112 CTGTAAGAGAAGCATCCAGGGGG + Intergenic
1036674032 8:10814361-10814383 CAGACACAGCAGCTGTCAGGAGG - Intronic
1037150518 8:15629584-15629606 CTGACACAGAAGGACCCAGGAGG - Intronic
1038454271 8:27662327-27662349 CAGTTACAGCACCAGCTAGGTGG - Intronic
1039527079 8:38226428-38226450 CAGTTACAGCACCAGCTAGGTGG - Intronic
1039679007 8:39708731-39708753 CTGGCACTGAAGCAGCCAGCTGG - Intronic
1040081583 8:43291424-43291446 CTGGCACAGCTGCCTCCAGGAGG + Intergenic
1041193056 8:55372905-55372927 CTGTCAGAGCAGATGCAAGGGGG + Intronic
1042506921 8:69570804-69570826 CTGTCACAGCATCCGCCTGCAGG + Intronic
1042898260 8:73694746-73694768 CACTCCCAGCAGCAGCCATGTGG + Intronic
1043030867 8:75131660-75131682 CTGTCACAAAAACAGCCCGGGGG - Intergenic
1043992917 8:86778155-86778177 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1044998298 8:97858056-97858078 GTGTTGCAGCAGCAGACAGGAGG - Intergenic
1045055709 8:98366724-98366746 CAGTCTCAGCTGAAGCCAGGTGG - Intergenic
1045270229 8:100655152-100655174 CTGCCACAACAGCACACAGGAGG + Intronic
1046110038 8:109711873-109711895 CTGTCACAGCAGTGGCCAGATGG - Intergenic
1046438770 8:114230963-114230985 CCCTCACAGCAGCTTCCAGGTGG - Intergenic
1047402530 8:124558646-124558668 CTGTCTGAGCAGCAGGCAGGGGG + Intronic
1047946771 8:129888154-129888176 CTATCACAACAGCAGCAAGGGGG - Intronic
1048021711 8:130545786-130545808 CTGACACAGCAGCAGGCACATGG - Intergenic
1048342112 8:133548238-133548260 CTCTCTTGGCAGCAGCCAGGGGG + Intronic
1048375853 8:133821929-133821951 CTGTCACAAGAACAGCAAGGGGG + Intergenic
1048629579 8:136227378-136227400 CTGTCAAGGAAGAAGCCAGGTGG + Intergenic
1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG + Intronic
1049098116 8:140560692-140560714 CTGTGACAGCAGCAGGCTGGGGG + Intronic
1049105667 8:140610835-140610857 CTCTCACAGACTCAGCCAGGCGG + Intronic
1049360588 8:142210867-142210889 CCCTCACACCTGCAGCCAGGAGG + Intergenic
1049389920 8:142362448-142362470 CTGTTACAGCAGCAGAAAGTGGG - Intronic
1049688665 8:143949403-143949425 CTGTACCAGCAGGACCCAGGTGG - Intronic
1049884323 9:17433-17455 TTGTTACAGCACCAGCCAGGGGG + Intergenic
1050471083 9:5991364-5991386 ATATCAGAGCAGAAGCCAGGAGG - Intronic
1051742486 9:20265197-20265219 CTGTCAGAGCAGCCGGCAGTGGG + Intergenic
1051991961 9:23162648-23162670 CTGTCCCAGCAGCAGCCATTCGG + Intergenic
1052044433 9:23777957-23777979 CATAAACAGCAGCAGCCAGGTGG + Intronic
1052952828 9:34227686-34227708 CTGCCACAACCGCAGCCATGAGG + Intronic
1053083538 9:35197686-35197708 CTGTCACAAGAACAGCAAGGGGG - Intronic
1053519588 9:38764275-38764297 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1054455943 9:65430463-65430485 CTCTCAGAGCACCAGCCATGCGG + Intergenic
1054744085 9:68836785-68836807 CTGTCTTACCAGAAGCCAGGTGG + Intronic
1055397311 9:75889786-75889808 CTGTGACTGCAGCAGGCAGGAGG - Intergenic
1055720442 9:79167298-79167320 ATGTCACAGCAGCACTCAGTGGG - Intergenic
1056287939 9:85110246-85110268 GTGTTCCAGGAGCAGCCAGGAGG - Intergenic
1058545908 9:106059987-106060009 CAGGCACAGCAGCAGCCACCTGG - Intergenic
1058711365 9:107682124-107682146 CTCAGAAAGCAGCAGCCAGGAGG + Intergenic
1059453452 9:114385395-114385417 CCATAACAGCAGGAGCCAGGAGG - Intronic
1059747697 9:117219099-117219121 CTATGACAGAAGCAGCCAGATGG - Intronic
1060436546 9:123597970-123597992 ATGCCCCAGTAGCAGCCAGGAGG + Intronic
1060549303 9:124477607-124477629 CAGGCACAGCAGTAGCCACGCGG + Intronic
1060561845 9:124551899-124551921 CTTTCGCAGCACCAACCAGGAGG + Intronic
1060593635 9:124834949-124834971 CTGTCTCAGGTGCAGTCAGGTGG - Intergenic
1061178357 9:129010395-129010417 CTGTCACTGCAGCTGCCTGTGGG - Intronic
1061199862 9:129131557-129131579 CAGGCACAGCAGCTGCCAGATGG - Exonic
1061527166 9:131175577-131175599 CTGCCGCAGCAGCACTCAGGCGG + Exonic
1061767697 9:132892207-132892229 GGGTCACAGCAGCAGCCTAGGGG + Exonic
1062147317 9:134996846-134996868 CTGTCTCAGCAGCTGCGAGGTGG + Intergenic
1062272864 9:135717767-135717789 TGGTCTCAGCAGCAGCCTGGGGG + Intronic
1062357416 9:136171386-136171408 CTGACAGACCAGCAGACAGGCGG - Intergenic
1062393295 9:136342553-136342575 CTCCCACAGCGGCAGCCGGGCGG - Intronic
1203790233 EBV:147518-147540 CTGACCCAACAGAAGCCAGGTGG - Intergenic
1186977359 X:14922682-14922704 CTCTGACAGCAGCAAGCAGGAGG + Intergenic
1187522375 X:20025144-20025166 CTCACACAGCAGCTGCCAGTTGG + Intronic
1188629315 X:32332592-32332614 CTGTGAAAGCAGCAGCAAAGGGG + Intronic
1188962256 X:36507142-36507164 CTGTGACAACAGCACCAAGGAGG + Intergenic
1189166140 X:38863025-38863047 ATGGCGCAGCAGCAGGCAGGAGG + Intergenic
1189201056 X:39195896-39195918 CTGTCCAACCAGCACCCAGGAGG + Intergenic
1190366649 X:49700939-49700961 CTGTTACAGGAACAGCAAGGGGG - Intergenic
1191024066 X:55894632-55894654 CTGTCACAGCACCAGCAAGGTGG - Intergenic
1191833098 X:65436201-65436223 CTGTCACAAGAACAGCAAGGGGG + Intronic
1191851881 X:65591374-65591396 CTGTGACAGCAGCAGTGAGCTGG - Intronic
1191902945 X:66057186-66057208 CTTACACAGCAGCAGGCAAGAGG + Intergenic
1194450582 X:94040617-94040639 CTGTCACAAGAACAGCAAGGGGG - Intergenic
1194561454 X:95427252-95427274 CACCCACAGCAGCAGCCTGGTGG + Intergenic
1196771750 X:119301374-119301396 CTCTGACAGCACCAGGCAGGAGG + Intergenic
1197011469 X:121569922-121569944 ATTTCCCAGCAGCAGCCACGTGG + Intergenic
1197134525 X:123045592-123045614 CTATTACAGGAGCAGCAAGGGGG - Intergenic
1197988846 X:132295554-132295576 CTGTTACAGCACCAGCCAGCTGG - Intergenic
1199779457 X:151044854-151044876 CTATCACAGGAACAGCAAGGGGG - Intergenic
1200401482 X:156022723-156022745 TTGTTACAGCACCAGCCAGGGGG - Intergenic