ID: 1172098049

View in Genome Browser
Species Human (GRCh38)
Location 20:32470195-32470217
Sequence CATCCCTTCTGGAGGCCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 370}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172098037_1172098049 22 Left 1172098037 20:32470150-32470172 CCTGTCTGCCCAGGAGGTGAGTA 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1172098049 20:32470195-32470217 CATCCCTTCTGGAGGCCAGACGG 0: 1
1: 0
2: 2
3: 43
4: 370
1172098040_1172098049 -5 Left 1172098040 20:32470177-32470199 CCGCTCCCTGCCCCCACGCATCC 0: 1
1: 0
2: 9
3: 123
4: 1121
Right 1172098049 20:32470195-32470217 CATCCCTTCTGGAGGCCAGACGG 0: 1
1: 0
2: 2
3: 43
4: 370
1172098038_1172098049 14 Left 1172098038 20:32470158-32470180 CCCAGGAGGTGAGTAATGTCCGC 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1172098049 20:32470195-32470217 CATCCCTTCTGGAGGCCAGACGG 0: 1
1: 0
2: 2
3: 43
4: 370
1172098041_1172098049 -10 Left 1172098041 20:32470182-32470204 CCCTGCCCCCACGCATCCCTTCT 0: 1
1: 0
2: 2
3: 46
4: 404
Right 1172098049 20:32470195-32470217 CATCCCTTCTGGAGGCCAGACGG 0: 1
1: 0
2: 2
3: 43
4: 370
1172098039_1172098049 13 Left 1172098039 20:32470159-32470181 CCAGGAGGTGAGTAATGTCCGCT 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1172098049 20:32470195-32470217 CATCCCTTCTGGAGGCCAGACGG 0: 1
1: 0
2: 2
3: 43
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172098049 Original CRISPR CATCCCTTCTGGAGGCCAGA CGG Intronic
900366162 1:2312798-2312820 CATCATTTCTGGAGGGCAGGCGG - Intergenic
900477222 1:2881660-2881682 CCTCCCTTCTCATGGCCAGAGGG - Intergenic
900483588 1:2910941-2910963 CATCTTGTCTGGAGGCCTGAGGG + Intergenic
901480469 1:9521475-9521497 CCTTCCTTCTTGAGTCCAGATGG + Intergenic
902238957 1:15075631-15075653 CCTCCCTTCTGGAGGCCCATAGG - Intronic
903780577 1:25817815-25817837 CATCTGGTCTGGAGGTCAGAGGG - Exonic
903783580 1:25839912-25839934 CAACACTTCGGGAGGCCAGGTGG - Intronic
904165918 1:28554988-28555010 CAGCACTTCGGGAGGCGAGAAGG + Intronic
904469589 1:30728210-30728232 CGTGCCTTCTCGGGGCCAGAGGG + Intergenic
904470734 1:30734402-30734424 CATCCCTTGTGGTGGCAAAAAGG - Intronic
905206341 1:36344712-36344734 CTTCCCTTCTAGAGGGGAGACGG - Intronic
905211531 1:36377771-36377793 CAGCCCTTATGGATGCCAGGGGG - Intronic
905853620 1:41292565-41292587 CATTGTTTCTGGAGGCCAGCAGG - Intergenic
906171791 1:43732257-43732279 GATCCCAGCTGGAAGCCAGAAGG - Intronic
906356580 1:45111580-45111602 CATTCCTTCTGGAGGCTCTAGGG + Intronic
906529552 1:46515709-46515731 CTTCCCTTCTTGTGGGCAGAGGG + Intergenic
907479724 1:54737071-54737093 CATCCATGCTGGGGGCCAGCAGG - Intronic
908326975 1:63032407-63032429 CGTCACTTCTTGAGGCAAGAGGG - Intergenic
910684319 1:89900915-89900937 CATGGCGACTGGAGGCCAGAGGG + Intronic
911158205 1:94656820-94656842 CAGCACTTTGGGAGGCCAGAGGG - Intergenic
911236209 1:95415165-95415187 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
912254960 1:108048910-108048932 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
912881403 1:113419812-113419834 CATTCCTTCTGGAGGCGCTAGGG + Intronic
913691273 1:121282121-121282143 CATCCCTTCAGGGTTCCAGAGGG + Intronic
914146270 1:144997860-144997882 CATCCCTTCAGGGTTCCAGAGGG - Intronic
914319774 1:146548027-146548049 ATTCCCTTCTGGAGGCTTGAGGG + Intergenic
914349854 1:146831476-146831498 CATTCCTTCCGGAGGACAGCAGG + Intergenic
915090302 1:153419506-153419528 CAGCTCTGCTGGAGGCCATAGGG - Exonic
915095191 1:153457585-153457607 CAGCTCTGCTGGAGGCCATAGGG + Intergenic
915267854 1:154731652-154731674 CATCTCTTCTGGAGGCAACGGGG + Intronic
915658344 1:157380448-157380470 CATCCCTTATGGACCACAGAAGG - Intergenic
917537317 1:175883763-175883785 CAGCCCTTTTGGTGCCCAGATGG - Intergenic
917660575 1:177173370-177173392 CTCCCCTTCTGGAGGTCAGCTGG + Intronic
918141543 1:181724199-181724221 CAAACCATCTGGGGGCCAGATGG - Intronic
918249476 1:182688893-182688915 ATTCCCTTCTGGAGGCTGGAGGG - Intergenic
918705001 1:187649200-187649222 GAACCCTTCTGGCAGCCAGAAGG - Intergenic
920217605 1:204372327-204372349 CATCCAATCTAGAGCCCAGAGGG - Intronic
920404572 1:205699551-205699573 CAGCCCTTTTGGAGGCCAGGTGG - Intergenic
920478597 1:206300597-206300619 CATCCCTTCAGGGTTCCAGAGGG + Intronic
920558949 1:206925265-206925287 CACCCCTTCTGGACCCTAGAGGG - Intergenic
921613640 1:217241566-217241588 TATTCCTACTTGAGGCCAGAAGG + Intergenic
922200358 1:223395242-223395264 CCTCTCTCCTGGAGGCCTGAGGG - Exonic
924065680 1:240219408-240219430 CATCCCTTCTGGTAGACAAAAGG - Intronic
1064018488 10:11791102-11791124 CATTCCTTCTGGAAGCTCGAGGG + Intergenic
1064442305 10:15364701-15364723 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1065738647 10:28776659-28776681 CAGCACTTTTGGAGGCCAGGCGG + Intergenic
1065955434 10:30689503-30689525 CATACCTACCGGAAGCCAGAAGG + Intergenic
1067980688 10:51081116-51081138 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1068265087 10:54637400-54637422 TATCCCTTCTGTAGGTCAAAAGG + Intronic
1069633355 10:69911030-69911052 TACCCCTCCTGGAGGCCAGTGGG + Intronic
1069786853 10:70993952-70993974 CATGTCTTCTGAAGACCAGAGGG - Intergenic
1069798683 10:71069201-71069223 CAGCCTTTCTGGAGGGCAGCAGG - Intergenic
1069808216 10:71139175-71139197 GATCCCTTCTGGAGCCCCAAGGG - Intergenic
1070571042 10:77639140-77639162 CATCCCGTGAGGAGGGCAGATGG + Intergenic
1072200012 10:93149883-93149905 CATTCCTTCTGGAGGCTCTAAGG + Intergenic
1073298516 10:102456184-102456206 CATCCCTTCTGGAGGCTCCAGGG - Intergenic
1073406486 10:103302396-103302418 CAGCACTTTGGGAGGCCAGACGG - Intergenic
1073615494 10:104990825-104990847 CATTCCTTCTGGAGGCTCCAGGG - Intronic
1074048719 10:109863339-109863361 CAGAAATTCTGGAGGCCAGAAGG + Intergenic
1075309832 10:121404934-121404956 CAGCCCTCCTGGAGGACAAACGG + Intergenic
1075699421 10:124459537-124459559 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1075845660 10:125543208-125543230 GATCCCTTCTGAAGGGCAGGAGG + Intergenic
1075904866 10:126072335-126072357 CAGCCCTTCTAGAGCACAGAAGG - Intronic
1076227784 10:128794112-128794134 CACACCCTCTGGAAGCCAGAGGG + Intergenic
1076291886 10:129351805-129351827 CTCCCAGTCTGGAGGCCAGAAGG - Intergenic
1076451456 10:130559822-130559844 AATGCCTTCTGCAGGCCATAGGG - Intergenic
1077090491 11:776390-776412 CAGCACTTCAGGAGGCCGGAAGG - Intronic
1077133998 11:989699-989721 AAACCCTTGTGGAGGCCACATGG + Intronic
1077366961 11:2165148-2165170 CAGCCCTGCTCAAGGCCAGAAGG + Intronic
1077536110 11:3125056-3125078 CCTCCCTCCTGCAGGCCAGGTGG + Intronic
1077880313 11:6344083-6344105 CAGCACTTCGGGAGGCCAGACGG + Intergenic
1078777984 11:14411213-14411235 CATCCCTTCTGGAGGAGGGCTGG - Intergenic
1081334253 11:41844254-41844276 CAGCCCTTTGGGAGGCCAGGCGG - Intergenic
1081887926 11:46515223-46515245 CAACACTTTGGGAGGCCAGATGG + Intronic
1084005744 11:66322712-66322734 GCTCCCTTCTGGAGGCCATGGGG + Intergenic
1084538632 11:69773763-69773785 CTTCCCTTCTCTAGTCCAGAGGG - Intronic
1084815231 11:71641848-71641870 AATGCTTTCTGGAGGCTAGAAGG + Intergenic
1085051845 11:73384004-73384026 CCTAGCCTCTGGAGGCCAGAGGG + Intronic
1087193606 11:95282654-95282676 CATCTCTTCTGAATGCCAGAGGG + Intergenic
1088981997 11:114872222-114872244 CATTCCTTCTGGAGGCTTCAGGG - Intergenic
1091400744 12:179191-179213 CATCCCTTCTGGCTCCCAGTAGG - Intergenic
1091713528 12:2760071-2760093 CAGCACTTCTGGGGGCCACAGGG - Intergenic
1092337164 12:7643311-7643333 CAACACTTTGGGAGGCCAGACGG + Intergenic
1092427772 12:8388189-8388211 AATGCCTTCTGGAGGCTAAAAGG - Intergenic
1092429042 12:8395170-8395192 AATGCCTTCTGGAGGCTAAAAGG - Intergenic
1092647977 12:10600479-10600501 CATCTCTTCTGGAGGGCATTTGG - Intergenic
1092820667 12:12350478-12350500 CCTCCCTGCTGGTGGCCCGAGGG + Exonic
1093496447 12:19763295-19763317 CAGCCTTTGTGGAGCCCAGAAGG + Intergenic
1093516347 12:19990962-19990984 CATTTCTTCTGGAGGCTTGAGGG - Intergenic
1097184502 12:57189370-57189392 TTTCCCTTATGGAGGCTAGAAGG + Intronic
1097675778 12:62601917-62601939 GATCCTTCATGGAGGCCAGAGGG - Exonic
1097954855 12:65473560-65473582 CAGCCCTTTGGGAGGCAAGATGG - Intronic
1097976616 12:65693330-65693352 CATACCTTCTGGAGGCTGGAGGG + Intergenic
1098516274 12:71379685-71379707 CATCCATTCTGGAGACCAGTTGG - Intronic
1098522335 12:71447591-71447613 CACTCCTTCTGAAGGCAAGAAGG - Intronic
1099257517 12:80332065-80332087 CATTCCTTCTGGAGGCTCTAAGG - Intronic
1100287487 12:93181413-93181435 CATCCCTTCCAGACACCAGAGGG + Intergenic
1100426136 12:94488155-94488177 CAGCACTTTTGGAGGCCAAAAGG - Intergenic
1101740394 12:107495526-107495548 CATCCCTAACGGGGGCCAGAAGG + Intronic
1101841654 12:108331836-108331858 CATCTCTTCCGGAGGCCCTAGGG - Intronic
1102299140 12:111758422-111758444 CAGCACTTCGGGAGGCCAGATGG + Intronic
1102806675 12:115787509-115787531 CAGCCCTTCTGGGGCCCAGGAGG + Intergenic
1103868772 12:124075738-124075760 CATCCCTACTGGAGTCCATCGGG - Intronic
1104006456 12:124896214-124896236 CATCCCTTCTGGAAGCTCTAGGG + Intergenic
1104289052 12:127451825-127451847 GTGCCCTTCTGGAGGCCATAGGG + Intergenic
1104600234 12:130148419-130148441 CATCTCTTCTGGTCGCCACACGG - Intergenic
1105578411 13:21673629-21673651 CAGCCCTTAAAGAGGCCAGATGG - Intronic
1105631118 13:22169580-22169602 CTTCCTTACTGGAGGACAGAGGG - Intergenic
1107590679 13:41901223-41901245 CAACCCTTGAGGAGGCCAGGTGG - Intronic
1109954235 13:69544835-69544857 CAGCCCTTTAGAAGGCCAGATGG + Intergenic
1110024742 13:70522042-70522064 CAGCACTTCGGGAGGCCAAAGGG + Intergenic
1112191349 13:97180931-97180953 CATTCCTTCTGGAGGCTCTAAGG + Intergenic
1112332798 13:98489628-98489650 CCTCCCTCCTGGAGGTTAGACGG - Intronic
1112987385 13:105467970-105467992 CATGCCTTCTGGAGGCTCCAGGG + Intronic
1113978759 13:114253438-114253460 CAGCACTTTGGGAGGCCAGAGGG + Intronic
1119690914 14:76671843-76671865 AATGCCTTCTGAAGGCCAGAGGG - Intergenic
1121742675 14:96265086-96265108 CATTCCTTCTGGAGGCTCCAGGG - Intronic
1121962727 14:98276047-98276069 CATTCCTTCTGGATATCAGAGGG + Intergenic
1122005662 14:98701504-98701526 CTTCCCTTCTGGAGGCTGGTGGG + Intergenic
1122120423 14:99550401-99550423 GTTCCCTTCTAGGGGCCAGAGGG - Intronic
1122522541 14:102355266-102355288 CAGCCCTTTGGGAGGCCAGCAGG + Intronic
1123705048 15:22945133-22945155 CATGGCTTCTGCAGGCGAGAGGG + Intronic
1124337575 15:28868762-28868784 AAACCCAGCTGGAGGCCAGAGGG + Intergenic
1124642749 15:31406684-31406706 CATTCCTTCTGGAGGCTCTAAGG + Intronic
1125340754 15:38673122-38673144 CACCCCTTCAGGAGACCAGATGG - Intergenic
1125594924 15:40878770-40878792 CATCCTTTCTGCAGGCAGGAGGG + Intergenic
1126650698 15:50918871-50918893 CATCCCTTTTGGTGGACATATGG + Intronic
1126725703 15:51629471-51629493 CATCCTGTCGGGAGGGCAGATGG + Intergenic
1127825264 15:62697355-62697377 CAGCCCTTTTGGAGGCCAAATGG - Intronic
1127912212 15:63426670-63426692 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1127956591 15:63859178-63859200 CATTCTTTCTGGAGGCCCTAGGG + Intergenic
1128509585 15:68305151-68305173 CATGCATGCTGGAGGCCAGGTGG - Intronic
1129991568 15:79968680-79968702 CATCACTTTGGGAGGCCAAAGGG + Intronic
1130032286 15:80326963-80326985 CAGCCCTTCTGGAGGCCCCACGG + Intergenic
1130764347 15:86854992-86855014 CATCTCCTCTGCATGCCAGATGG - Intronic
1131149631 15:90039028-90039050 CATCACTTTGGGAGGCCAGAGGG + Intronic
1131660594 15:94511608-94511630 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
1132678991 16:1132027-1132049 CATGCCTTCCGGAGGCCGCAGGG + Intergenic
1132848216 16:2010511-2010533 CCTGCCTTCTGGATGGCAGAGGG - Intronic
1134437930 16:14278990-14279012 CATCACTCCTGGAGTCCAGTGGG + Intergenic
1134783326 16:16918400-16918422 CATTCCATCTGGAGGCTTGAGGG + Intergenic
1135466581 16:22691572-22691594 AATCCCTTCAGTTGGCCAGATGG + Intergenic
1135532246 16:23264797-23264819 CATCTCTTCTGGAGGCTTTAGGG + Intergenic
1135884631 16:26294926-26294948 CATTCTTACTGGAGGCCTGAGGG + Intergenic
1136146964 16:28321502-28321524 CCTCCCTTCTGGAGGCTGGAGGG + Exonic
1136383285 16:29907010-29907032 CAGCCCTCCTGGAGGCCACAGGG - Exonic
1136984320 16:35084805-35084827 CCTCCCTCCTGGGTGCCAGACGG + Intergenic
1137252216 16:46748601-46748623 GATCCCTCCTGGAGCCCAGCTGG - Intronic
1137826704 16:51503694-51503716 CAACCCTTATAGAGGCAAGAGGG + Intergenic
1138480396 16:57298983-57299005 CATTCCGTCTGGAGGCCAGAAGG - Intergenic
1139984182 16:70884055-70884077 CATTCCTTCCGGAGGACAGCAGG - Exonic
1140013754 16:71162050-71162072 ATTCCCTTCTGGAGGCTTGAGGG - Intronic
1140484548 16:75283257-75283279 CCTCCTTTCTGGAGGCCCAAGGG - Intergenic
1141577560 16:84974066-84974088 CTTACCTTCCAGAGGCCAGATGG - Intergenic
1142644056 17:1300758-1300780 CACGCCGCCTGGAGGCCAGAGGG + Exonic
1143566086 17:7721632-7721654 TTTCCTTTCTGGAAGCCAGAGGG + Intronic
1143610238 17:8013865-8013887 CACCACTTCTGGAGGCATGAGGG - Exonic
1145103623 17:20096981-20097003 CCTCCTTTCTGGACCCCAGAGGG - Intronic
1146255001 17:31386992-31387014 TAACAGTTCTGGAGGCCAGAAGG + Intergenic
1146288860 17:31594051-31594073 CACCCATGCTGGAGGCCAGATGG - Intergenic
1146482818 17:33218739-33218761 CGTCCCTGCTGGAGGCAAAAGGG - Intronic
1146713994 17:35068391-35068413 CATTCCATCTTGGGGCCAGAAGG + Intronic
1148128175 17:45247512-45247534 TATCCCTGCGGGAGGCCGGAGGG + Intergenic
1148336962 17:46848438-46848460 CAGCCCTTCAGGAGCCCACAGGG + Intronic
1148455297 17:47808139-47808161 CCTCCCCTCTGCTGGCCAGAGGG - Exonic
1148541795 17:48486794-48486816 CATGCCTCCTGGAGTCAAGAAGG - Intergenic
1149458376 17:56807967-56807989 CATCCCTTTTGGAGGCATGTAGG - Intronic
1152082423 17:78196427-78196449 CAGCACTTTGGGAGGCCAGAGGG + Intronic
1152295862 17:79466534-79466556 CAGCCCTTCTGGAGACCACAGGG + Intronic
1152379968 17:79937296-79937318 CAGCTCTTTTGGAGGCCACAGGG - Exonic
1154411674 18:14145196-14145218 CAGCCCTGCTGGAGGCCTGGGGG - Intergenic
1155109492 18:22699839-22699861 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
1155288680 18:24319151-24319173 CATTCCTTCTGGAGGCTCTAAGG + Intronic
1156450047 18:37261760-37261782 CATCCCATCTGTGGGGCAGATGG + Intronic
1156578570 18:38349020-38349042 CAGCACTTCTGCTGGCCAGATGG + Intergenic
1157318937 18:46619681-46619703 CATCCCTTCTAGAGGTGACACGG + Intronic
1157440109 18:47704486-47704508 CACCCATTCAGGAGGCAAGATGG - Intergenic
1157663420 18:49465695-49465717 CATCTTTTCTGATGGCCAGAAGG - Intergenic
1159017282 18:63111475-63111497 CCTCCCTTCTGGAGGCCCTAGGG - Intergenic
1160498179 18:79387316-79387338 CCTCAGTTCTGGAGGCCAGAAGG + Intergenic
1162523337 19:11194414-11194436 CTTCAGTTCTGGAGGCCTGAGGG - Intronic
1163304465 19:16469173-16469195 CCTGCCTTCTAGAGTCCAGAAGG - Intronic
1165226227 19:34357198-34357220 CAGCAGTGCTGGAGGCCAGAGGG + Intergenic
1165296704 19:34933026-34933048 CAGCACTTTTGGAGGCCAGGTGG - Intronic
1165955155 19:39497951-39497973 CACACCTTCCGGAGGCCAAACGG + Intergenic
1166052275 19:40267425-40267447 TGTCCCTGATGGAGGCCAGAGGG - Intronic
1166530716 19:43541701-43541723 CGTTCCTTCTGGAGGCTTGAGGG - Intergenic
1166915885 19:46195986-46196008 CCTCCATTCTGGAGGAGAGAGGG + Intergenic
1166925158 19:46261803-46261825 CCTCCATTCTGGAGGAGAGAGGG - Intergenic
1167012682 19:46819266-46819288 CATCCCTTCTGGAGACTCTAGGG - Intergenic
1167192468 19:48001016-48001038 CATTCCTTCTGGAGGCTGTAGGG + Intronic
1167529019 19:50003223-50003245 GATTCCTTCTGGAGGCCGGAGGG - Intronic
1167533500 19:50033702-50033724 CGTTCCTTCTGGAGGCCCTAGGG + Intronic
1168646895 19:58065147-58065169 CATTCCTTCTGGAGGCTCTAGGG + Intronic
925497244 2:4465832-4465854 CTTCCCTTCTGGAGGCTGTATGG - Intergenic
926569322 2:14512144-14512166 CATTCCTTCTGGAGACCTGAGGG + Intergenic
926572543 2:14545097-14545119 CATCCCTTCTGGAGGCTCTAAGG - Intergenic
927523325 2:23715324-23715346 CAGCACTTCGGGAGGCCAGGTGG + Intergenic
927663301 2:25011194-25011216 CAGCACTTCAGGAGGCTAGATGG + Intergenic
927808448 2:26168806-26168828 CACCCCATCTAGAGGACAGATGG - Intergenic
927968972 2:27292077-27292099 CATTTATTCTGGAGCCCAGAAGG - Intronic
928545077 2:32322068-32322090 CATCCCTACTGGAGTCAATAGGG + Intergenic
930331999 2:49996734-49996756 CATTCCTTCTGGAGGCTTTAGGG - Intronic
930469385 2:51793611-51793633 CTACCATTCTGGAGTCCAGAGGG + Intergenic
930672150 2:54162715-54162737 CAGCACTTTTGGAGGCCAGAGGG + Intronic
930776918 2:55182035-55182057 CATTCCTTCTGGAGGCTCTAAGG - Intronic
931373322 2:61684560-61684582 CAGCACTTTGGGAGGCCAGAGGG - Intergenic
932333174 2:70912411-70912433 CAGCACTTTGGGAGGCCAGAGGG + Intronic
932440395 2:71731170-71731192 CATCCCTCAGGGAGGCCAGTGGG - Intergenic
934572958 2:95383731-95383753 CACCTCCTCTGGAGGCCAGCCGG + Intronic
934729878 2:96649770-96649792 CATTCCTTCTGTAGGCCTCAAGG - Intergenic
934947918 2:98555294-98555316 TAACTCTTCTGGAGGCCAGGTGG - Intronic
935012110 2:99145089-99145111 CATTCCTTCTGGAGGCTCTAGGG + Intronic
935601173 2:104922954-104922976 CAGAAATTCTGGAGGCCAGAAGG + Intergenic
936380602 2:111982303-111982325 CAGCACTTTGGGAGGCCAGAGGG - Intronic
936528689 2:113259864-113259886 CCTTCCTTCTGCAGCCCAGAGGG - Intronic
937126241 2:119476661-119476683 TATCCCCTCTGCAGGGCAGAAGG + Intronic
938146604 2:128839609-128839631 CAGCACTTCAGGAAGCCAGATGG + Intergenic
938722630 2:134079919-134079941 CATTTCTTCTGGAGGCCATAAGG + Intergenic
939193591 2:138945269-138945291 CATCACTCCTGGAGTCCAGATGG + Intergenic
939440709 2:142245687-142245709 AATCTCATCTGGAGGCCAGAAGG - Intergenic
939961303 2:148568395-148568417 CATCTCTTCTGTAGGTCAGCTGG + Intergenic
940052957 2:149483136-149483158 CATCCTGCCTGGAGGCCAGTGGG - Intergenic
942414039 2:175739575-175739597 CACTCCTTCTGGAGGCCCTAGGG - Intergenic
942770627 2:179514150-179514172 CATTCCTTCTGGAGGCTTTAAGG + Intronic
944482519 2:200172405-200172427 CATCCCTTCTGGGCGCCATAGGG + Intergenic
945369612 2:209000789-209000811 CATCCCTTCTGGAAGTTTGAGGG + Intergenic
945742936 2:213685487-213685509 CCACACTTCTGGAGGCCAGAAGG - Intronic
947379131 2:229528167-229528189 AATCCCTTCTGTTGGCCAGAAGG + Intronic
947517743 2:230822118-230822140 CATGTCTTCTGGAAACCAGATGG - Intergenic
947807336 2:232977722-232977744 AAACCCTGCTGGTGGCCAGAGGG + Intronic
948434954 2:237946834-237946856 CATTCCTTCTGGAGGCTTCAGGG + Intergenic
948439952 2:237980334-237980356 TTTCCCTTCTGGAGGCTGGAAGG + Intronic
948482222 2:238257400-238257422 CAGCCCTTCTGCAGGCCTGTGGG + Intronic
948518927 2:238523548-238523570 CTGCGCATCTGGAGGCCAGAAGG + Intergenic
948536959 2:238653618-238653640 CATTCCTTCTGGAGGCCCTAGGG - Intergenic
1169641863 20:7761120-7761142 CATCCCTACTGAAGCCAAGAGGG + Intergenic
1169659969 20:7967694-7967716 CATTCCTTCTGGAGGCTTCAGGG - Intergenic
1170235275 20:14096614-14096636 AATCCTTTTTGGAGGCCGGATGG - Intronic
1170813815 20:19696439-19696461 CATCCATTCTGGATGCCTCAGGG + Intronic
1172098049 20:32470195-32470217 CATCCCTTCTGGAGGCCAGACGG + Intronic
1172207683 20:33176093-33176115 CCTCCCAACTGGAGGCAAGAAGG - Intronic
1172613269 20:36267031-36267053 CCTGCCTTCTGGGGGCCATAAGG - Intronic
1173052345 20:39575575-39575597 CATTCCTTCTGGAGGCTCCAGGG - Intergenic
1173377059 20:42495325-42495347 CCTCTCTTCTCTAGGCCAGAGGG + Intronic
1173428313 20:42961998-42962020 CATTCCTTCTGGAGGCTGTAGGG - Intronic
1174329817 20:49809095-49809117 CATTCATTCTGGAGGCCCTACGG - Intergenic
1175214835 20:57386597-57386619 GGTTCCTTCTGGAGGCCTGAAGG + Intergenic
1175334265 20:58184952-58184974 CATCCCTTCTGGAGGCTCTGGGG - Intergenic
1176063855 20:63184030-63184052 CTTCCCTTCTGGAAGCTGGAGGG + Intergenic
1176861387 21:14013231-14013253 CAGCCCTGCTGGAGGCCTGGGGG + Intergenic
1178549174 21:33520926-33520948 CATCTGTTCCAGAGGCCAGAAGG + Exonic
1179175102 21:39002579-39002601 TATCCCTTATGGAACCCAGAAGG + Intergenic
1179597955 21:42455751-42455773 CCTCCCGTCTGGAGGCCAGTAGG + Intergenic
1180128788 21:45811301-45811323 CATCCCTTCTGGAGGCTCACGGG + Intronic
1180163616 21:46009097-46009119 CCTGCCTTCTTGAGGCCAGTGGG - Intergenic
1180249320 21:46570238-46570260 CTGCCCTTCTGGAGGGCAGCAGG - Intergenic
1180717081 22:17879121-17879143 CATCCCATCTGAATGCCAGATGG + Intronic
1180840544 22:18956993-18957015 CAGCCCTGCTGGAGGCAAGGTGG + Intergenic
1181060949 22:20281781-20281803 CAGCCCTGCTGGAGGCAAGGTGG - Intronic
1181453385 22:23038606-23038628 CAAGCCTTCTGGAGGCCCCAGGG - Intergenic
1181514747 22:23404102-23404124 CACCCCTTCAGGAGGCCAGGGGG - Intergenic
1181825118 22:25508778-25508800 CAGCACTTTGGGAGGCCAGACGG - Intergenic
1182154133 22:28053221-28053243 CATCCCTTCAGGATGCAGGATGG + Intronic
1182578528 22:31290139-31290161 CAGCACTTTGGGAGGCCAGACGG + Intronic
1183004697 22:34891359-34891381 GCTCCCTTTTGGTGGCCAGATGG + Intergenic
1183083747 22:35474077-35474099 CATCGCTGCTGGATGCCAGCAGG - Intergenic
1185278132 22:49958589-49958611 AATCCCATCTGGAGGCCTGGAGG + Intergenic
949675194 3:6445279-6445301 CATCCCTACTGGAGTCAATAGGG - Intergenic
950195842 3:11008595-11008617 CATGGCTGCTGGATGCCAGAGGG - Intronic
950214136 3:11146240-11146262 CATCCATTCTGGAGGAGACATGG + Intronic
950522367 3:13504836-13504858 TTTCCCTGCTGGAAGCCAGAAGG + Exonic
951168291 3:19507784-19507806 CGTACCTTCTGGAAGCCTGAAGG + Intronic
951542958 3:23800030-23800052 GGTCCTTACTGGAGGCCAGAGGG + Intergenic
952145846 3:30531284-30531306 CATCCTTTCTGGATTTCAGATGG + Intergenic
952942559 3:38455048-38455070 CGTGCCTCCTGGAGGCCCGAAGG - Intronic
953049450 3:39327609-39327631 CCCCAGTTCTGGAGGCCAGATGG - Intergenic
953509064 3:43516958-43516980 CATGTCTTCAGGAAGCCAGAAGG + Intronic
956089993 3:65656337-65656359 AAGCCCTTCGGGAGGCCAAATGG - Intronic
956395736 3:68824314-68824336 CCTGCCTTCTGGAGGCCCTAAGG + Intronic
956731852 3:72203781-72203803 CAACCCAGCTGGAAGCCAGATGG + Intergenic
957511339 3:81191594-81191616 CCCCAGTTCTGGAGGCCAGAGGG - Intergenic
959231936 3:103665951-103665973 CATTCCTTCTGGAGGCACCAGGG + Intergenic
960392814 3:117100035-117100057 CAGCACTTCGGGAAGCCAGAGGG - Intronic
960437731 3:117647682-117647704 CCTCCAGTCTGGAGGCCTGAGGG - Intergenic
961296293 3:125887153-125887175 CAGCCCTTTTGGAGGTTAGATGG - Intergenic
961509904 3:127394361-127394383 CCTCCATTCGGGGGGCCAGATGG + Intergenic
961512255 3:127410214-127410236 CATACTTTCAGGAAGCCAGAGGG - Intergenic
962864356 3:139435024-139435046 ATTGCCTCCTGGAGGCCAGAGGG - Intergenic
963509661 3:146231021-146231043 AATGCCTTCTGGAGGGCAGAAGG - Intronic
964352548 3:155817246-155817268 CAGCACTTCGGGAGGCCAGGTGG - Intergenic
964367953 3:155969840-155969862 TATGCCTTCTGGAGGCCCTAGGG + Intergenic
964392279 3:156210430-156210452 TATGCTTTCTGGAGGTCAGAGGG + Intronic
964479483 3:157127570-157127592 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
965636970 3:170792220-170792242 CATCCCTGGTGGAAGACAGATGG + Intronic
967637907 3:191825825-191825847 CATCCCTTCTTGAGGGTGGAGGG + Intergenic
968264720 3:197354087-197354109 CATGGCTTCTTGTGGCCAGAGGG + Intergenic
969114301 4:4861375-4861397 CTTCCCTGCTGGAGGCCACCGGG - Intronic
969516570 4:7651532-7651554 CATCCCTTCTGGAGTCAACAGGG - Intronic
969797079 4:9534700-9534722 AATGCTTTCTGGAGGCTAGAAGG + Intergenic
971053288 4:22885310-22885332 TATCCCACCTGGAAGCCAGATGG + Intergenic
971957149 4:33435319-33435341 CAGCCCTTTGGGAGGCCAGCTGG - Intergenic
972345106 4:38186243-38186265 TCTCCATTCTGGAGGCCAGGAGG + Intergenic
972378417 4:38495571-38495593 CAGCCCTTGTGGTAGCCAGAGGG + Intergenic
975340699 4:73236395-73236417 CAGCCCTTTGGGAGGCCAGGAGG - Intronic
977098176 4:92771995-92772017 CATCGTTTTTGGAGGCCAGTAGG - Intronic
978366827 4:107990987-107991009 CAGCACTTCGGGAGGCCAGGCGG - Intronic
978501737 4:109417364-109417386 CAGCACTTTGGGAGGCCAGATGG + Intergenic
981291132 4:143076899-143076921 CATTCCTTCTGGAGGCTTAAGGG - Intergenic
981313625 4:143320285-143320307 CCTCCCTTCAGGAGCCCAGCAGG - Intergenic
982272432 4:153604949-153604971 CAGCACTTCTGGAGGCCAAAGGG - Intronic
982320619 4:154073188-154073210 CATTCCTTCTGGAGGCTCAAGGG - Intergenic
984285353 4:177721727-177721749 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
988255270 5:28810623-28810645 CTTTCCTTCTGGAGGGCGGAGGG + Intergenic
989729676 5:44633687-44633709 CATTCCTTCTGGAGGCTTCAGGG - Intergenic
990592607 5:57281595-57281617 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
991404212 5:66285941-66285963 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
992568783 5:78030448-78030470 TATCAGTTCTGGAAGCCAGAAGG - Intronic
993161734 5:84300133-84300155 ATTCCCTTCTGGAGGCTAGGGGG + Intronic
993282302 5:85940296-85940318 CATTCCTTCTGGAGGCACTAGGG + Intergenic
993720534 5:91317268-91317290 AATCTCTTTTGGAGCCCAGAGGG + Intergenic
995262119 5:110116362-110116384 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
995405948 5:111796095-111796117 CATGCCTTCTGGAGGCTCTATGG + Intronic
995778240 5:115748210-115748232 CATCCCTACTGGAGTCAATAGGG + Intergenic
997007670 5:129837943-129837965 AATCCCTTCTGGATGGCAAAAGG - Intergenic
997128068 5:131248383-131248405 CAGCACTTTGGGAGGCCAGATGG - Intronic
997719425 5:136065857-136065879 CACCCCATCAGAAGGCCAGAGGG + Intergenic
1000530228 5:162410254-162410276 CATAGCTACTGGAGGCAAGAAGG + Intergenic
1000977533 5:167781775-167781797 CAGCACTTTGGGAGGCCAGATGG + Intronic
1001534080 5:172486410-172486432 CAACCCTCTTGGAGGGCAGAAGG + Intergenic
1001922048 5:175608530-175608552 CATCCTTCCTTGAGCCCAGAAGG + Intergenic
1001923940 5:175622540-175622562 CATCCCTACTGGAGTCAACAGGG - Intergenic
1002056058 5:176598442-176598464 CCTCCCTTCTGGAGGACACCGGG + Exonic
1004965674 6:20848204-20848226 CATCTTTTCTGCAGGGCAGATGG - Intronic
1007439029 6:41841806-41841828 CAGCACTTCAGGAGGCCAAAGGG + Intronic
1013417330 6:109936695-109936717 CAACACTTTTGGAGGCCAGGAGG - Intergenic
1013817181 6:114112403-114112425 CATTCCTTCTGGAGGCACTAAGG - Intronic
1015820698 6:137257473-137257495 GTTCCCTTCTGGAGGCCGTACGG + Intergenic
1017248035 6:152248790-152248812 TACCCCTGCTGGAGGCCAGAAGG + Intronic
1018283552 6:162213974-162213996 CATACCCTTAGGAGGCCAGAAGG + Intronic
1020778580 7:12489639-12489661 AATGCCTTCAGGAGGCTAGAGGG + Intergenic
1022067937 7:26879972-26879994 CATTCCTTCTGGAGGCTCCAGGG - Intronic
1022676649 7:32506662-32506684 CAGCACTTCGGGAGGCCAAACGG + Intronic
1023015179 7:35961535-35961557 CATCCCTTATGGAGGGTAGTGGG + Intergenic
1023947467 7:44814667-44814689 CATCACTTCTGGAAGTCAGCTGG - Intronic
1024046819 7:45590803-45590825 CACACCCTCTGCAGGCCAGACGG - Intronic
1024065768 7:45733157-45733179 CATCCCTTATGGAGGGTAGTGGG - Intergenic
1024524054 7:50333121-50333143 CATTTGTTCTGGAGTCCAGAGGG - Intronic
1024991245 7:55235785-55235807 CATCCCTCCTGGTTGCAAGATGG - Intronic
1026129792 7:67610691-67610713 CATGGGTTCTGGAGACCAGAGGG + Intergenic
1031137471 7:117900774-117900796 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1031996210 7:128233109-128233131 CATCCTTTCTGGAGGACACTTGG - Intergenic
1032507937 7:132450054-132450076 CTTCCTTCCTGGAGGACAGAGGG - Intronic
1033160858 7:138995478-138995500 CAAACCTACTGGAAGCCAGAGGG - Intergenic
1033268910 7:139913149-139913171 CATCCCTTCAGGATGGCCGAAGG + Intronic
1033814672 7:145057429-145057451 CATCCCTTCTGGAGGCTCTGGGG + Intergenic
1034222218 7:149455500-149455522 GATCTCTTCTGCAGTCCAGAAGG - Exonic
1034674361 7:152881949-152881971 CATGCCTGCTGGAGGTCAGCAGG + Intergenic
1036701100 8:11014514-11014536 GTTCCCTCCTGGAGGCCAGGAGG + Intronic
1036835730 8:12064348-12064370 CATCCATTCTGGAGTTCAAAGGG + Intergenic
1036857573 8:12310921-12310943 CATCCATTCTGGAGTTCAAAGGG + Intergenic
1037226920 8:16603303-16603325 CATTCCTTCTGGAGACCCTAGGG - Intergenic
1037280749 8:17239304-17239326 CAGCACTTCGGGAGGCCAGTTGG - Intronic
1037420667 8:18698577-18698599 TATTCCTTCTGGAGGCTCGAGGG - Intronic
1038056779 8:23866125-23866147 ATTCTCTTCTGGATGCCAGAAGG - Intergenic
1039010789 8:33090667-33090689 CATTCCTTGTGGATGCCAGATGG + Intergenic
1039758656 8:40550183-40550205 GACCCCTTCTGGAAACCAGAGGG + Intronic
1041029106 8:53718112-53718134 CATCCCTTCCAGAGGCCTGAGGG + Intronic
1041125633 8:54635796-54635818 CACCCCTTCAGGAGGGAAGAGGG + Intergenic
1041427502 8:57738962-57738984 CAGCCTGTCTGGAGGCCAGGGGG - Intergenic
1041865431 8:62567728-62567750 CATTCCTTCTGGAGGCCATAGGG - Intronic
1044237838 8:89852412-89852434 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
1044879408 8:96707800-96707822 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1045042533 8:98240244-98240266 CATGTCTTCTGAAGGCCAGAGGG - Intronic
1045246996 8:100451290-100451312 CAACACTTTTGGAGGCCAGTTGG + Intergenic
1045406266 8:101869419-101869441 CATTCCTTCTGGATGCCCTATGG - Intronic
1045644339 8:104285405-104285427 CATCCCTACTGGAGTCAATAGGG - Intergenic
1045645383 8:104292426-104292448 CATCCCTACTGGAGTCAATAGGG - Intergenic
1046692249 8:117298956-117298978 CATTCCTTCTGGAGGCTCCAGGG - Intergenic
1046845269 8:118908434-118908456 CACTGATTCTGGAGGCCAGAAGG - Intergenic
1047407166 8:124595397-124595419 CATTCCTTCTGGAGGCTGCAGGG + Intronic
1048061588 8:130924613-130924635 CATCCCTACTGGATGCAATAGGG + Intronic
1048440103 8:134453444-134453466 CATCCCTTCTGGAGGCTCCAGGG + Intergenic
1048737640 8:137519421-137519443 GATCCATTCTGGAGGCAGGAAGG + Intergenic
1051510644 9:17874283-17874305 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
1051599957 9:18862788-18862810 CTTCCCTCCTGCAGGCCAGGTGG + Intronic
1052278143 9:26702078-26702100 CATTCCTTCTGGAGGCTCAAAGG - Intergenic
1052415330 9:28170662-28170684 CATTCCTTCTTGAGGCCATAGGG + Intronic
1056923714 9:90814548-90814570 CATCCCCTGAGGAGCCCAGAAGG + Intronic
1056983780 9:91342153-91342175 CATTCCTTCTGGAGGCACTAGGG + Intronic
1058411566 9:104738817-104738839 CAGCCCTTTGAGAGGCCAGAGGG - Intergenic
1059463817 9:114452759-114452781 CCTCCCTGATGGAGGGCAGATGG + Intronic
1059573048 9:115460766-115460788 CATTCCTTCTGGAGCCCCTAGGG - Intergenic
1059704794 9:116812501-116812523 CATTCCTTCTGGAGGCCTTAGGG - Intronic
1060214444 9:121730236-121730258 CCACCCTTCCCGAGGCCAGAAGG + Intronic
1060818852 9:126650308-126650330 CATCTTTTCTAGGGGCCAGAGGG + Intronic
1060848703 9:126857768-126857790 GGTCCCTTGTGGAGGCCAGAAGG + Intergenic
1061158299 9:128878689-128878711 AATGACTTCTGGAGTCCAGACGG + Intronic
1062043649 9:134415447-134415469 AAACCCATCTGGAAGCCAGAGGG + Intronic
1185670473 X:1805481-1805503 CAGCACTTCGGGAGGCCAAAGGG - Intergenic
1186575900 X:10765434-10765456 CATTTCTTCTGGAAGACAGAAGG - Intronic
1187447749 X:19373407-19373429 CTTCCCTTCTGCAGGGCAGTAGG - Intronic
1187576866 X:20566110-20566132 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1188543272 X:31272785-31272807 CCTCCCTTATGGAGTCAAGAAGG - Intronic
1190416278 X:50183385-50183407 CATACCTACTGGGGGGCAGATGG - Intergenic
1190517007 X:51234255-51234277 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
1191852982 X:65599760-65599782 TCTGCCTTCTGGAGGGCAGAGGG + Intronic
1192319861 X:70081928-70081950 CATCCTTTCTGGTCGCCTGAGGG - Intergenic
1193056096 X:77152859-77152881 CATCCATTGTGGAAGACAGAGGG + Intergenic
1194956472 X:100186858-100186880 AAACCCTACTGGAAGCCAGAGGG + Intergenic
1195057033 X:101156256-101156278 CAGCACTTAGGGAGGCCAGAGGG - Intronic
1197226040 X:123957421-123957443 CAGCCCTTTGGGAGGCCAGGCGG + Intergenic
1197723257 X:129759223-129759245 CTTACCTTCTGGAAGGCAGAGGG - Exonic
1197900510 X:131366926-131366948 CCTCCCTTCTGCATGACAGAAGG + Intronic
1199109434 X:143912293-143912315 CAGCACTTCGGGAGGCCAAAGGG - Intergenic
1199510026 X:148611509-148611531 CATTCCTTCTGGAGGCTCTAGGG + Intronic