ID: 1172099236

View in Genome Browser
Species Human (GRCh38)
Location 20:32475489-32475511
Sequence CTCTCCTCGCTGCCGGCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172099228_1172099236 14 Left 1172099228 20:32475452-32475474 CCGGATGGCCTGCTAGAGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1172099236 20:32475489-32475511 CTCTCCTCGCTGCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 13
4: 156
1172099226_1172099236 22 Left 1172099226 20:32475444-32475466 CCAAACAGCCGGATGGCCTGCTA 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1172099236 20:32475489-32475511 CTCTCCTCGCTGCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 13
4: 156
1172099230_1172099236 -8 Left 1172099230 20:32475474-32475496 CCACGCCTGCCTCCTCTCTCCTC 0: 1
1: 0
2: 20
3: 200
4: 1718
Right 1172099236 20:32475489-32475511 CTCTCCTCGCTGCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 13
4: 156
1172099229_1172099236 6 Left 1172099229 20:32475460-32475482 CCTGCTAGAGAGGACCACGCCTG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1172099236 20:32475489-32475511 CTCTCCTCGCTGCCGGCTTCGGG 0: 1
1: 0
2: 0
3: 13
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172099236 Original CRISPR CTCTCCTCGCTGCCGGCTTC GGG Intronic
900926091 1:5707047-5707069 CTCTCCTTGCTGTATGCTTCTGG + Intergenic
902783313 1:18717869-18717891 CCCTCCTCTCTGGAGGCTTCTGG - Intronic
905453835 1:38074127-38074149 CTCTGCACTCTGCCTGCTTCAGG - Intergenic
906258199 1:44366760-44366782 CTCTCCTCGCTGCAAGCTGTGGG + Intergenic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
912758480 1:112345126-112345148 CTCTCCTAGCAGCCAGCTCCAGG + Intergenic
915064109 1:153210571-153210593 CTCTCCCCGCTGTCGCATTCTGG - Intergenic
915463558 1:156082956-156082978 CTCTCCCCGCGGCCGGGCTCCGG - Intronic
915597275 1:156902772-156902794 CCATCCCCGCAGCCGGCTTCAGG - Intronic
918344551 1:183595216-183595238 GTCTCCTCCCTGCCTCCTTCAGG - Intronic
919895289 1:202005936-202005958 CTCTCCCCGCTACAGGCTGCAGG + Exonic
920528615 1:206685688-206685710 CTCGCCTCCCTGACCGCTTCCGG + Intronic
920752338 1:208690822-208690844 CTCTCCTGGCTGACGGCCCCAGG - Intergenic
923282367 1:232456299-232456321 CTCTCCTCTCTGCATACTTCAGG + Intronic
923539776 1:234879712-234879734 CTCCCCTCACTGGCTGCTTCTGG - Intergenic
1062920072 10:1272942-1272964 CTCTCCTGGCTCCAGGCCTCCGG + Intronic
1062939542 10:1411076-1411098 CTCTCCTCTCTGCAGCCTTTGGG + Intronic
1065141484 10:22722777-22722799 TTCTCCTTGCTTCCTGCTTCTGG - Intergenic
1070569152 10:77627974-77627996 CTCTGCTGGCTGGGGGCTTCAGG - Intronic
1071503793 10:86221162-86221184 CTCTCATCCCTGCTGGCTGCAGG - Intronic
1073450905 10:103608243-103608265 CCCGCCTCTCTCCCGGCTTCCGG - Intronic
1074118538 10:110476148-110476170 CTGTCCTCTCTGCCGGATACAGG - Intergenic
1075874975 10:125798593-125798615 CACTCCTGGCTGCCGGTTACCGG - Intronic
1076156089 10:128206890-128206912 CTCTCAGCACTGCCGGCTCCTGG + Intergenic
1076567635 10:131409802-131409824 CTGGCCTCTCTCCCGGCTTCCGG - Intergenic
1076915139 10:133419658-133419680 CTCTCCTCCCTGCCTCCTCCAGG - Intronic
1083840903 11:65303789-65303811 CTTTCCAAGCTGCCTGCTTCTGG - Intronic
1084891628 11:72239735-72239757 CTCTTCTAGCTGCCGGCCTCTGG - Exonic
1089452961 11:118609952-118609974 CTCTCCTCTCTTCCGCCTTTGGG + Intronic
1090576195 11:128106401-128106423 CTCTCCTCCCTGAAGGCTTCTGG + Intergenic
1091047181 11:132335048-132335070 CTCACCTCGCTGACGGCGCCTGG - Exonic
1091148342 11:133300884-133300906 TTCTCCTCTCTTCCAGCTTCTGG - Intronic
1101057853 12:100937730-100937752 CTCTCCTCTCTGGAGGCTCCAGG + Intronic
1102924922 12:116819370-116819392 CTCTGCGCGCCGCCGGCTCCGGG - Intronic
1103331257 12:120155587-120155609 CTCACCTCTCAGCCAGCTTCCGG + Exonic
1103738795 12:123077917-123077939 CTCCCCATGCTGCCGGCCTCAGG + Intronic
1103949591 12:124543595-124543617 CTCTCCTCGCTGCGGGGTGTGGG + Intronic
1104644081 12:130484713-130484735 CTCTCCACGCTGCCCACATCAGG + Intronic
1104820237 12:131672855-131672877 CTCTCCTCCTCGCTGGCTTCAGG + Intergenic
1104885031 12:132102180-132102202 CTCTCCTCCCAGCCGGGGTCAGG + Intronic
1108693724 13:52883967-52883989 CTCTCCTCTATGCCAGCTTTGGG - Intergenic
1114482376 14:23043895-23043917 CTCTCTTCCCTGCAGGCTTCCGG + Exonic
1114866059 14:26597315-26597337 CTCTTGGTGCTGCCGGCTTCAGG + Exonic
1119475055 14:74922442-74922464 CTCTGCTCTCTGCTGGCTCCAGG - Exonic
1127806224 15:62523179-62523201 CTCCCCTTGTTGCTGGCTTCGGG - Intronic
1129267739 15:74403086-74403108 CTCTCCTGGGGGCCGGCTTTCGG - Intergenic
1129665553 15:77577609-77577631 CTCTCCTGGGGGCCAGCTTCCGG + Intergenic
1131958670 15:97765303-97765325 CTTTCCTCAGTGCCAGCTTCAGG + Intergenic
1133756217 16:8764527-8764549 CTTTCCTCTCTGCCAGCCTCAGG + Intronic
1136366699 16:29812306-29812328 CTCACCTCGACGCCGGCCTCCGG - Exonic
1137802152 16:51271248-51271270 TGCTCCTGGCTGCAGGCTTCAGG + Intergenic
1138674669 16:58642405-58642427 CTCTGCTCCCTGCCTGCTGCTGG - Intergenic
1139504791 16:67393468-67393490 CTCCGCTCCCTGCCGGCTCCCGG + Intronic
1141701943 16:85646689-85646711 GTCTCCCCGCTGCAGGCTGCAGG + Intronic
1141942965 16:87290573-87290595 CTCTGGGCGCTGCCGGCTTTAGG + Intronic
1142143543 16:88483200-88483222 CTCTCCTAGCTGCAGCCTTTGGG - Intronic
1142348292 16:89568194-89568216 CTGTCCTCACTGTGGGCTTCGGG + Intergenic
1142349705 16:89574575-89574597 CTCTGCCCACTGCGGGCTTCAGG + Intergenic
1142559416 17:801131-801153 CTCTCCCTCCTGACGGCTTCAGG - Exonic
1143083994 17:4402301-4402323 CTCTTCTAGCTGCTGGCTGCTGG - Intergenic
1143541991 17:7574291-7574313 CTCACCTCGATGACGCCTTCGGG - Exonic
1143914781 17:10282153-10282175 CTCTCCTAGCTTCTGGCTTTTGG + Intergenic
1144237131 17:13272461-13272483 CTCTCTTCTCTGCAGGGTTCTGG - Intergenic
1147453719 17:40521559-40521581 GTCTCCTCCCTTCGGGCTTCTGG + Intergenic
1147685242 17:42283305-42283327 CTCTCCTCTCTCCAGGCTCCTGG + Intergenic
1147820454 17:43238442-43238464 CTCACCTCACTGCGGCCTTCTGG + Intergenic
1147822566 17:43250334-43250356 CTCACCTCACTGCGGCCTTCTGG + Intergenic
1147825083 17:43265129-43265151 CTCACCTCACTGCGGCCTTCTGG + Intergenic
1147828203 17:43282649-43282671 CTCACCTCACTGCGGCCTTCTGG + Intergenic
1147829313 17:43288813-43288835 CTCACCTCACTGCGGCCTTCTGG + Intergenic
1147830403 17:43294948-43294970 CTCACCTCACTGCGGCCTTCTGG + Intergenic
1147918199 17:43900921-43900943 CTCCCCTCACAGCCAGCTTCAGG + Intronic
1148196929 17:45720602-45720624 CTCTTCTCTCTGCTGTCTTCTGG + Intergenic
1150347048 17:64412259-64412281 CTCTTCGCGCTGCCGGCTGGTGG - Intronic
1152597946 17:81247043-81247065 ATCTCCGCCCTGCCAGCTTCTGG + Exonic
1152813988 17:82396947-82396969 CACTCCCTGCAGCCGGCTTCAGG - Intronic
1154306238 18:13232863-13232885 CTCTCCCTGCTGCCAGCTTCGGG - Intronic
1160991235 19:1861141-1861163 CTCCCCTCCCTGCTGGCTTAGGG + Intronic
1161569210 19:5021167-5021189 CACCCCTGGCTGCAGGCTTCGGG + Intronic
1161707420 19:5828696-5828718 CTCTCCGCGGTGCGGGCTTCTGG + Intergenic
1164717700 19:30405496-30405518 ATCTCCTAGCTCCTGGCTTCAGG + Intronic
1166546913 19:43639559-43639581 CGCTCGTCGCTCCCGGCTCCCGG + Intronic
1167309155 19:48726920-48726942 GGCTCCTGGCTGCCGACTTCTGG - Intronic
1167645416 19:50702853-50702875 CTCTCCTGCCTCCTGGCTTCCGG + Intronic
929746836 2:44667856-44667878 CCCTCCTCCCTGCCTGCCTCAGG + Intronic
932245154 2:70190686-70190708 CTCACCTCCCGGCCGGCTTCCGG + Intronic
932537206 2:72611287-72611309 CTCGGCTCGCTGCCGCCTCCTGG - Intronic
932660631 2:73648591-73648613 CACTCCTCACTGCTGGCTGCTGG + Intergenic
933893526 2:86790967-86790989 CTCTCCTCGGCGGGGGCTTCGGG - Exonic
935794556 2:106628708-106628730 CTCTCCTCCCTGCCTGTTTGAGG - Intergenic
937516508 2:122661471-122661493 CTCTCCTGGAGGCCGGCTGCAGG + Intergenic
939535512 2:143422860-143422882 CTCTTCTTGCTTCCGGCTTGTGG - Intronic
948569178 2:238906779-238906801 CTCTCCTGGCGGCCGCCTTGGGG + Intronic
1169223676 20:3842394-3842416 CCCTCCACGCTCCCAGCTTCTGG - Intergenic
1172099236 20:32475489-32475511 CTCTCCTCGCTGCCGGCTTCGGG + Intronic
1175715903 20:61253744-61253766 CCCTCCGCGGTGCCGGCGTCGGG + Intronic
1179891904 21:44339447-44339469 CTCTGCTCGCTGCGCGCTTCCGG - Intergenic
1180195168 21:46189732-46189754 TTCCCCTCCCTGCCGCCTTCTGG - Exonic
1181100376 22:20534924-20534946 CTCGCCTCCCTTCAGGCTTCAGG + Intronic
1184589945 22:45475431-45475453 CTCTCCTCTCTGCCCTCCTCTGG - Intergenic
1185047778 22:48537584-48537606 AGCTCCTTGCTGCCAGCTTCTGG - Intronic
949730856 3:7111113-7111135 CTCTCATCACTTCCTGCTTCAGG - Intronic
952983361 3:38756261-38756283 CTCTTTTGGCTGCCTGCTTCTGG + Intronic
954178455 3:48862653-48862675 CTCTCCTCCCTCCCAGATTCAGG - Exonic
956688152 3:71851303-71851325 CTCTTCTCTATGCTGGCTTCAGG - Intergenic
961344636 3:126256156-126256178 CCCTCCACACTGCAGGCTTCTGG - Intergenic
961366004 3:126399840-126399862 TTCTCCTTGCTGCCTGCTGCAGG - Intronic
966378891 3:179323556-179323578 GTCTCCTTGGCGCCGGCTTCTGG + Intronic
967556333 3:190863030-190863052 CTCGCCTCGGTCCCGGCTGCGGG - Intronic
969105991 4:4807446-4807468 CTCTGCTACCTGCCAGCTTCAGG + Intergenic
973567454 4:52202520-52202542 CTCTCCTTTATGCCAGCTTCAGG + Intergenic
978757493 4:112319163-112319185 CTCTTCTTGCTGCCTGCTTCAGG - Intronic
981782768 4:148445195-148445217 CTGACCTCGCGCCCGGCTTCAGG + Intergenic
984472208 4:180190627-180190649 CTCTTCTCACTTCCTGCTTCTGG + Intergenic
984873747 4:184349647-184349669 CTCTCCTCGCAGCCCTCTTGAGG + Intergenic
985432251 4:189892772-189892794 CCCTCCTTGCTCCCGGCATCTGG + Intergenic
985715777 5:1460231-1460253 CTCTCCTCCCAGCCAGCTTCTGG + Intronic
985730999 5:1548876-1548898 CCCTCCTCACTGCAGGCTACAGG + Intergenic
985764689 5:1770699-1770721 CTCTCCTTTCTCCAGGCTTCTGG + Intergenic
997428581 5:133821703-133821725 AGCTCCTCCCTGCTGGCTTCTGG - Intergenic
997534557 5:134608415-134608437 CTCTCTTCACTGATGGCTTCAGG + Exonic
998282978 5:140830014-140830036 CTCTCCGCGCCACCGGCTGCTGG + Exonic
1001527057 5:172436549-172436571 CTTTCCTCCCTGCTGGCTACAGG - Intronic
1006071256 6:31499206-31499228 CTCCCCTCGCCTCCGGCTCCGGG + Intronic
1007503159 6:42313973-42313995 TTCTCATCTCTCCCGGCTTCCGG - Intronic
1007614080 6:43170519-43170541 CTCTCCTCCCTGCCCGCCTCAGG + Intergenic
1018067379 6:160133588-160133610 CACTCCCCTCTGCCTGCTTCAGG - Intronic
1018746347 6:166765051-166765073 TTCTCCTCCCTGCCAGCTCCAGG + Intronic
1018974652 6:168555724-168555746 CACTCCCCGCTGCAGGCTGCTGG - Intronic
1019210584 6:170401460-170401482 CTCTCTTCTCTGCCAGCTTCTGG - Intronic
1019588807 7:1818791-1818813 ACCTCCTCTCTGCCGGCCTCAGG + Intronic
1019972308 7:4550781-4550803 CTCTCCTCCCTCCCTGCTTTTGG - Intergenic
1021959582 7:25858611-25858633 CTCTCCCCGCAGCCCGCTGCAGG + Intergenic
1022028256 7:26468376-26468398 GTCACCTCTCTGCCAGCTTCGGG - Intergenic
1022381747 7:29866843-29866865 CTCTCCGCTCTCCCAGCTTCAGG + Intronic
1023136531 7:37058493-37058515 CTCTCTTCTCTGCCCACTTCTGG - Intronic
1023881843 7:44325274-44325296 CCCTCCGCGCCGCCGGCTCCAGG - Intronic
1023983253 7:45081647-45081669 GTCTCCTCACTGCCGCCTGCTGG + Exonic
1024061226 7:45700060-45700082 CTCTCCTCCCTGCAGGGCTCTGG - Intronic
1024960630 7:54971015-54971037 GTCTCATCTCTGCCAGCTTCTGG + Intergenic
1026160861 7:67867617-67867639 CTCTCCTGGCTGGTGGCCTCAGG - Intergenic
1028833428 7:95349154-95349176 CTCATCTCCCTGCAGGCTTCAGG + Intergenic
1029650815 7:101890203-101890225 CTCTAAACACTGCCGGCTTCAGG - Intronic
1031586204 7:123534675-123534697 CCCTCCCCGCTGCCCTCTTCTGG - Intronic
1031596494 7:123655886-123655908 CTTGCCTCCCTGCCTGCTTCTGG + Exonic
1031960741 7:127987428-127987450 CTCTGCTCGCTGCCAGCATGTGG + Intronic
1034427390 7:151021275-151021297 TGGTCCTGGCTGCCGGCTTCTGG - Exonic
1034844794 7:154434455-154434477 CTCTGCTTGCTGCTGGCTTTGGG + Intronic
1035324217 7:158054603-158054625 CTCTCCTGGTTGCCAGATTCTGG - Intronic
1035734730 8:1879918-1879940 CTGTCCTGGCTGGGGGCTTCTGG - Intronic
1036038910 8:5052456-5052478 CTCTCCTCCCTGCCAGGTGCAGG + Intergenic
1037997043 8:23360265-23360287 CTCTCCTCTCTGCCTCCTTCAGG - Exonic
1040575916 8:48651430-48651452 CTCCCCCGGCTGCCAGCTTCCGG + Intergenic
1044727715 8:95206980-95207002 GTCTCCTCTCTGCCGTCTTTGGG - Intergenic
1051669221 9:19493581-19493603 CTGTTCTCGCTGCCGACTTCTGG + Intergenic
1051684013 9:19638170-19638192 CTCTCATCCCTGCAGGCTTGAGG + Intronic
1057173344 9:92976726-92976748 CTGTCCCCGCTGCGGGCTGCAGG + Intronic
1057186303 9:93059127-93059149 CTCTCCACGCCGCAGGCTCCGGG + Intronic
1057294147 9:93825689-93825711 CTGTCCTCTCTGCCGTCTGCAGG + Intergenic
1057489725 9:95511359-95511381 CTCTCCTCCTCCCCGGCTTCAGG + Intronic
1059724112 9:116989296-116989318 CTCTCCTCTCTGACCCCTTCTGG - Intronic
1060019869 9:120120032-120120054 CTATCCATGCTGCCGGCTGCTGG - Intergenic
1060049031 9:120363746-120363768 CTCTCCTCACTGCAGGATCCAGG - Intergenic
1060343160 9:122794299-122794321 CTGTCCTCACTGCCTGCTTTAGG - Intergenic
1060595327 9:124844382-124844404 CTCTCTTCTCTACTGGCTTCTGG - Intergenic
1060810808 9:126610706-126610728 CGCTCCACGCAGGCGGCTTCGGG - Intergenic
1190458272 X:50645869-50645891 CTCTCCTGGGAGCCAGCTTCTGG - Intronic
1195364804 X:104115506-104115528 CTCTCTTCTCTGCTGGCTTAAGG + Exonic
1199767239 X:150950119-150950141 CTCTTCTCCCTGGCTGCTTCTGG - Intergenic
1200863210 Y:8014954-8014976 CTCTCCTATATGCTGGCTTCAGG + Intergenic