ID: 1172100874

View in Genome Browser
Species Human (GRCh38)
Location 20:32483514-32483536
Sequence GCCACCCCCGCCCCCGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1077
Summary {0: 1, 1: 0, 2: 13, 3: 157, 4: 906}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172100874_1172100889 16 Left 1172100874 20:32483514-32483536 CCCGGCCCGGGGGCGGGGGTGGC 0: 1
1: 0
2: 13
3: 157
4: 906
Right 1172100889 20:32483553-32483575 GCGAGCAGCGGCGGCAGCGGCGG 0: 1
1: 0
2: 34
3: 247
4: 1279
1172100874_1172100891 27 Left 1172100874 20:32483514-32483536 CCCGGCCCGGGGGCGGGGGTGGC 0: 1
1: 0
2: 13
3: 157
4: 906
Right 1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG 0: 1
1: 10
2: 192
3: 494
4: 1380
1172100874_1172100884 4 Left 1172100874 20:32483514-32483536 CCCGGCCCGGGGGCGGGGGTGGC 0: 1
1: 0
2: 13
3: 157
4: 906
Right 1172100884 20:32483541-32483563 AGGAGGGCCCAGGCGAGCAGCGG 0: 1
1: 0
2: 6
3: 38
4: 421
1172100874_1172100890 19 Left 1172100874 20:32483514-32483536 CCCGGCCCGGGGGCGGGGGTGGC 0: 1
1: 0
2: 13
3: 157
4: 906
Right 1172100890 20:32483556-32483578 AGCAGCGGCGGCAGCGGCGGCGG 0: 4
1: 55
2: 385
3: 2044
4: 3495
1172100874_1172100882 -6 Left 1172100874 20:32483514-32483536 CCCGGCCCGGGGGCGGGGGTGGC 0: 1
1: 0
2: 13
3: 157
4: 906
Right 1172100882 20:32483531-32483553 GGTGGCCAGGAGGAGGGCCCAGG 0: 1
1: 0
2: 7
3: 112
4: 720
1172100874_1172100888 13 Left 1172100874 20:32483514-32483536 CCCGGCCCGGGGGCGGGGGTGGC 0: 1
1: 0
2: 13
3: 157
4: 906
Right 1172100888 20:32483550-32483572 CAGGCGAGCAGCGGCGGCAGCGG 0: 1
1: 0
2: 2
3: 34
4: 384
1172100874_1172100885 7 Left 1172100874 20:32483514-32483536 CCCGGCCCGGGGGCGGGGGTGGC 0: 1
1: 0
2: 13
3: 157
4: 906
Right 1172100885 20:32483544-32483566 AGGGCCCAGGCGAGCAGCGGCGG 0: 1
1: 0
2: 1
3: 35
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172100874 Original CRISPR GCCACCCCCGCCCCCGGGCC GGG (reversed) Intronic
900100370 1:959884-959906 GACACCCGGGCCCCCGGGCCTGG + Intergenic
900120122 1:1045291-1045313 CTCAGCCCCGACCCCGGGCCTGG + Intronic
900161806 1:1227487-1227509 GCAGCCCCCGCCGCAGGGCCTGG - Intronic
900189878 1:1348846-1348868 GCGACCCCCGAGCCCGCGCCAGG + Intronic
900245017 1:1632661-1632683 GCCACGCCCGCTCCCAGCCCTGG + Intronic
900249301 1:1658935-1658957 GCCGCCGCCGCCGCCGGTCCCGG + Exonic
900256248 1:1699820-1699842 GCCACGCCCGCTCCCAGCCCTGG + Intronic
900265146 1:1753512-1753534 GCCAACCTCCTCCCCGGGCCAGG - Intronic
900290715 1:1922496-1922518 GCCACCTCCTCCCCTGGGACTGG + Intronic
900375081 1:2350561-2350583 GCCATCCCCACCCCAGGGACAGG - Intronic
900383286 1:2396200-2396222 GCCACCCACGTCCCCGGTGCTGG + Intronic
900400382 1:2470650-2470672 GCCACCCTCCCTCCCGCGCCTGG + Intronic
900438805 1:2643394-2643416 TCCAGCCCCGCCTCCGGGCTCGG + Intronic
900482698 1:2906886-2906908 GCCACACCCGCCCCCCAGCATGG - Intergenic
900495800 1:2975512-2975534 GCCACCCCCACCCCCGACGCCGG + Intergenic
900495806 1:2975518-2975540 CCCACCCCCGACGCCGGGCCAGG + Intergenic
900607870 1:3531803-3531825 CCCTCCCCCGCCCCGCGGCCCGG - Intronic
900621577 1:3590067-3590089 GCCTCCCCCTCCCCTGGGCCAGG + Intronic
900762674 1:4483460-4483482 CCCACCCCTGCCCTTGGGCCTGG + Intergenic
901054167 1:6440869-6440891 GGGACCCCCGCGCCCGGGCAGGG - Intronic
901065145 1:6490760-6490782 CCCACCCCCTCCCCTGAGCCCGG - Intronic
901169423 1:7245970-7245992 GCGACCCCCTCCACCGGGCAGGG + Intronic
901373257 1:8818044-8818066 GCCCCCCGCGCCCCCCGGGCTGG + Intergenic
901433895 1:9234747-9234769 GCCGCGCGCGCCCCCGGCCCGGG + Intergenic
901443497 1:9293199-9293221 TCCACCCGCTCCCCCGCGCCCGG - Intronic
901467073 1:9429063-9429085 GCCAGCCCCGCCCCCGAGGCGGG + Intergenic
901597902 1:10399429-10399451 CCCAGCCCCGCCCTCGCGCCCGG - Intronic
901633662 1:10659804-10659826 GCCCCCAGCGCCCCCGGGCCAGG - Exonic
901700779 1:11043908-11043930 TCCACCCCCGCCCCCCGCCCCGG - Intronic
901917581 1:12511730-12511752 GCTTCCCCAGCCCCTGGGCCTGG + Exonic
902383241 1:16062380-16062402 GCCCCCCCCCCCCCCGCCCCAGG + Intronic
902480142 1:16707462-16707484 GGGACCCCCGCGCCCGGGCAGGG + Intergenic
902514052 1:16980505-16980527 GGCACCCTCGCCCCCGCGCCGGG + Intronic
902938302 1:19780662-19780684 GCCACACCTGCCCACGGGCCGGG - Exonic
903012819 1:20343174-20343196 GCCACCCCGGCCCCGGTGCTGGG + Exonic
903190142 1:21651826-21651848 GCCGCCGCCGCCGCCCGGCCCGG + Exonic
903349991 1:22711415-22711437 GCCCCCCCCGCCCCCCGCCACGG - Intronic
903353134 1:22730219-22730241 GCCACCCCCGCCTCCGCCCCTGG - Intronic
903750638 1:25618192-25618214 GACGCCCTCGTCCCCGGGCCTGG - Exonic
903961225 1:27059057-27059079 GACACCCCCTCCCCCAGGCTGGG + Intergenic
904130798 1:28273866-28273888 TCCACCCCCTCCCCAAGGCCTGG + Intronic
904181307 1:28668735-28668757 GCCACCGCCGCCGCCAGGCCGGG - Intronic
904461859 1:30685399-30685421 ACCGCCCCCTCCCCCGGCCCTGG + Intergenic
904642012 1:31938138-31938160 GCCGCCGCCGCCGCCGGGCCGGG - Exonic
904701837 1:32362380-32362402 GCCGAGCCCGCCCCCGTGCCAGG - Exonic
904811401 1:33165443-33165465 CCCACCTCCGCGCCCCGGCCAGG + Intronic
904891322 1:33781886-33781908 CCCTCCCCCGCCCCCTGACCTGG + Intronic
905028941 1:34868784-34868806 CCCACCCCCGGCCCTGGGGCCGG - Exonic
905028948 1:34868790-34868812 CCCGCCCCCACCCCCGGCCCTGG - Exonic
905037953 1:34929707-34929729 CCCGCCCCCGCCCCCGCGCAGGG + Intergenic
905442698 1:38005296-38005318 TCCGCCCCCGCGCCCAGGCCGGG - Intronic
905553139 1:38859735-38859757 GCCACCACCGCCACCGCCCCCGG + Exonic
905626223 1:39491934-39491956 TCCGCCGCCGCCCCTGGGCCCGG - Exonic
905867166 1:41382618-41382640 GCCTCCGCCGCCGCCGGGCCTGG + Exonic
906262830 1:44406685-44406707 CCCACCCCCGCCCCCCAACCCGG + Intronic
906345368 1:45011226-45011248 TCCAGCACCGCGCCCGGGCCAGG + Exonic
906495737 1:46302889-46302911 GCCCCCCGCGCCCCCGAGCCAGG + Intronic
906637002 1:47416472-47416494 CCCACGCCCGCGCCCGGCCCGGG + Exonic
906720009 1:47997456-47997478 GCCCCCCCGCCCCCCGCGCCAGG - Intergenic
906972680 1:50533357-50533379 GCCACCCCCGAGCCCTGGCCAGG + Intronic
907451721 1:54549695-54549717 GCCACACCCGTCCCCGTGCTGGG - Intronic
908703938 1:66930438-66930460 GGCGCCCCCGGCCCTGGGCCGGG + Intronic
910448996 1:87328537-87328559 GCCGCCGCCGCCTCCGAGCCGGG + Exonic
911176160 1:94820354-94820376 CCCAGCCCCGGCCCCGGCCCCGG + Exonic
911188726 1:94927341-94927363 GGCGGCCCCGCCCCCGGGCTAGG + Intergenic
912716868 1:111989515-111989537 GCCAGCCCGGGCCCCGCGCCCGG + Intergenic
913222134 1:116667863-116667885 GCGAGTCCCGGCCCCGGGCCTGG + Intergenic
913450200 1:118987879-118987901 GCCTCCGCCTCTCCCGGGCCGGG - Intronic
913979632 1:143497648-143497670 GCCCCCGCCGCCCCGGCGCCAGG + Intergenic
914889771 1:151612293-151612315 GCCTCCCCCGCCGCCGTTCCCGG - Exonic
914902176 1:151716683-151716705 CCCACCCCAGTCCCCGGGCCTGG + Exonic
914919543 1:151838222-151838244 GCCGCCGCCGCTCCCGGGGCGGG + Exonic
915070348 1:153261155-153261177 GCCGCCCCCGCCCCCGCCGCCGG - Exonic
915214055 1:154328604-154328626 TCCCCTCCCACCCCCGGGCCGGG - Intronic
915238270 1:154501838-154501860 GCCGCCGCCGCCCCCGGGCTTGG + Exonic
915463337 1:156082215-156082237 CCCACCCCCACCCCGGGGGCTGG - Intergenic
915473599 1:156139692-156139714 CCCACCCCTGCCCCCAGCCCCGG + Exonic
915552240 1:156642025-156642047 GCCGCCCCCGCCCCCTGGTCGGG - Exonic
915558061 1:156670871-156670893 CCCACCCCCTGCCCCGGGCCTGG + Exonic
915588983 1:156860119-156860141 GCCAGCGCCGGCCCCGGGGCAGG - Intronic
917974667 1:180230923-180230945 ACCACCCTCGCCCTCAGGCCTGG - Intronic
919748708 1:201023755-201023777 GCCAGCCCCGAGCCCAGGCCGGG + Intergenic
919910416 1:202107391-202107413 GCCTGCCCCGCCCCTGGCCCAGG + Intergenic
920228579 1:204455496-204455518 CCCACCCCCTCCCACTGGCCAGG + Intronic
921007915 1:211112303-211112325 TCCACCCCTCCCCCGGGGCCCGG + Intronic
922503079 1:226110713-226110735 GCCTCCTCCGCCCCCGCTCCGGG - Intergenic
922526500 1:226308688-226308710 CCCTCCCCCGGCCCCGGGACAGG + Intronic
922724146 1:227914763-227914785 GCCAGCCCCTCCACCTGGCCTGG + Intergenic
923126566 1:231039596-231039618 GCCGCCCCCGCCCCCAGGCCAGG + Intronic
923578288 1:235182025-235182047 GCCACCCCCTCCTCTGGGGCAGG + Exonic
924623204 1:245679986-245680008 GCCACCCCCTCCCCAGAGCCAGG - Intronic
1062932869 10:1364015-1364037 GCCGCCCGCGCCCCCAGGTCAGG + Intronic
1063363842 10:5478096-5478118 GCTACCCCCTGCCCTGGGCCTGG + Intergenic
1063371387 10:5525062-5525084 GCCACCCACGCCCCCACCCCTGG + Exonic
1063664097 10:8051501-8051523 GCCGCCGCCGCCGCAGGGCCCGG - Intergenic
1064060022 10:12129591-12129613 CCCAGCCCCGCCCCCAGGGCGGG - Intergenic
1064209074 10:13348106-13348128 GCCGCCGCCGCCGCCGGGCGCGG - Exonic
1064230918 10:13528876-13528898 GCCGCCGCCGCGCCCCGGCCCGG - Intronic
1064443056 10:15370889-15370911 GCCGCCGCCGCCTCCGCGCCAGG + Intronic
1065214829 10:23439373-23439395 CCGGCCCCCTCCCCCGGGCCCGG + Intergenic
1065533586 10:26697587-26697609 GCGAACCGCGCTCCCGGGCCTGG + Intergenic
1066180471 10:32957556-32957578 GCCGCCCCCGCCCGCGGCGCTGG + Intronic
1067068531 10:43116772-43116794 GCCTCACCCGCCCCCCGCCCCGG - Intronic
1067088383 10:43254519-43254541 CTAACCCCCGCCCCCGGACCTGG + Intronic
1067096540 10:43305057-43305079 CCCGCCCCCGCCCCCGCCCCCGG + Intergenic
1067096546 10:43305063-43305085 CCCGCCCCCGCCCCCGGGATCGG + Intergenic
1067809891 10:49418206-49418228 ACCACCCCCACCCCCAGGGCGGG - Intergenic
1069024041 10:63521329-63521351 CCCGCCCCCGCCCGCCGGCCCGG - Intergenic
1069588908 10:69630138-69630160 GCCGCCCCCAACCCTGGGCCGGG + Intergenic
1069769349 10:70887920-70887942 CCCGCCCCCGCCCCCGCCCCGGG + Intronic
1069780176 10:70950408-70950430 GCCACCCCAGCCCTGGGGACAGG - Intergenic
1070198096 10:74177184-74177206 CCCACCCGCGCCCCCGGGGGCGG + Intronic
1070333043 10:75431533-75431555 GCCGCCGCCGCCCCTCGGCCCGG - Intronic
1071695294 10:87863516-87863538 GCCCCCTCCGCCGCCGCGCCGGG - Exonic
1072608147 10:97000563-97000585 GGCACCCCCGCTCCAGAGCCTGG + Exonic
1072914628 10:99530398-99530420 GCCCCAGCCGCTCCCGGGCCAGG - Intergenic
1073180896 10:101582583-101582605 CCCACCCCCACCTCTGGGCCTGG + Intronic
1073185127 10:101611260-101611282 GCCACCCCTGCCTCTGGGCCAGG - Exonic
1073216610 10:101840051-101840073 GCCACCCCCCCCCCCCGTCCAGG - Intronic
1073287531 10:102397711-102397733 GCCACCTCTGCCACCAGGCCTGG - Intronic
1073291732 10:102416608-102416630 CCCACCCCAGCCCTTGGGCCTGG - Exonic
1073328744 10:102657387-102657409 TCCTCCCCAGCCCCCGGGCTCGG + Exonic
1073432128 10:103493768-103493790 GCCGCCCCCGCCCCCCGCCCCGG - Intergenic
1073800739 10:107038683-107038705 TCCCCCCCCGCCCCCTGCCCAGG - Intronic
1074130419 10:110568258-110568280 CCCAGGGCCGCCCCCGGGCCGGG - Intronic
1074455032 10:113589120-113589142 CCCACCCCCACTCCCGGCCCCGG + Exonic
1074592095 10:114822371-114822393 GGCACCCCCGCCCCGGCTCCTGG - Intronic
1075645441 10:124093260-124093282 GCCACCGCCACCACCGCGCCGGG + Intronic
1075682191 10:124341063-124341085 GCCAGCCCCGCTCCTGAGCCGGG + Intergenic
1075727902 10:124619985-124620007 GCCACTCACGCCCCCGCACCAGG + Exonic
1075834643 10:125443313-125443335 TCCACCCCCGTCCCCTGTCCAGG + Intergenic
1076554278 10:131311793-131311815 GCCGCCGCCGCCCCCGGACCCGG + Intergenic
1076674836 10:132142474-132142496 GCCTGCCCCGGCCCCGGCCCCGG + Intronic
1076723193 10:132401679-132401701 GCCAGCGCCGTCCCCGTGCCTGG + Intronic
1076723793 10:132404255-132404277 GCCAGACCCCTCCCCGGGCCAGG + Intronic
1076792830 10:132785995-132786017 GCCGCCCCTGCCCGCCGGCCCGG + Exonic
1076863526 10:133155302-133155324 CCAACACCCGCCCCCGTGCCCGG + Intergenic
1076869749 10:133187492-133187514 GGCACCCCCGTCCCCGGGCCAGG - Intronic
1076944969 10:133640543-133640565 TCCTCCCGCGCCCCCGGGGCTGG + Intergenic
1076991680 11:279129-279151 CCCTCCCCCGTCCCCGGACCCGG - Intronic
1077008406 11:369610-369632 GCCGCCCTCGGCCGCGGGCCCGG - Intergenic
1077010294 11:376556-376578 CCCCTCCCCGCCCCCGGGACGGG + Exonic
1077047823 11:554106-554128 GCCACCCCATCACCCAGGCCAGG - Exonic
1077056871 11:598109-598131 GCCACCCCCGCCACAGTGACTGG + Intronic
1077081449 11:726242-726264 CCTGCCCCCGCCCCCGGCCCAGG - Intronic
1077187747 11:1243061-1243083 GCCACCCCCTCCTCCAGCCCAGG + Exonic
1077188169 11:1244732-1244754 GCCACCCCCTCCTCCAGCCCAGG + Exonic
1077188703 11:1246832-1246854 GCCACCCCCTCCTCCAGCCCAGG + Exonic
1077189688 11:1250687-1250709 GCCACCCCCTCCTCCAGCCCAGG + Exonic
1077194789 11:1273921-1273943 GCCACCCTGGCACCCGGGCACGG - Intergenic
1077253759 11:1571823-1571845 GCGCCCTCCGCCCCCCGGCCCGG + Intronic
1077330638 11:1982511-1982533 GCGACCCCCGCCCACAGCCCAGG - Intronic
1077359318 11:2133743-2133765 ACCACCCCTGCCCTCAGGCCAGG + Intronic
1077413643 11:2414671-2414693 TCCTCCCCCGCGCGCGGGCCCGG + Intronic
1077430852 11:2515409-2515431 GGCCTCCCCGCCCCTGGGCCAGG - Intronic
1077495497 11:2884871-2884893 CCCAGCCCCGGCCCCGGCCCCGG - Exonic
1077530024 11:3090728-3090750 GCCACCCACGCCCCCTGCCCAGG + Intronic
1077549659 11:3194470-3194492 TCCACCCCAGCCCCGGGTCCAGG + Intergenic
1080230306 11:30012582-30012604 GCCTCTCCCGCTCCCGGGCCCGG + Exonic
1080418648 11:32091645-32091667 GCCGCCGCCGCGCCCCGGCCGGG + Intronic
1080848638 11:36048379-36048401 GACACCCCCACCCCCTGCCCAGG + Intronic
1081636788 11:44727068-44727090 CCCAGCCCCGGCCCCGGCCCCGG + Intronic
1081804957 11:45885552-45885574 GCCAGCCCCGCCCCCGGAGATGG - Intergenic
1081806911 11:45895940-45895962 GCCACACCCTCCCCATGGCCTGG + Intronic
1082022476 11:47546263-47546285 CCCTCCCCCGCCCCCGCCCCCGG - Intronic
1082833870 11:57638524-57638546 GCCAGCCCCTCTCCCGGGCCGGG - Intergenic
1083033478 11:59615471-59615493 ACTCCCCCGGCCCCCGGGCCCGG + Exonic
1083593682 11:63909245-63909267 GCCCCCGCCGCCCCCGCTCCTGG - Exonic
1083594043 11:63910693-63910715 ATCACCCCCGCTCCCAGGCCAGG + Exonic
1083625444 11:64069715-64069737 GACACCCCCGGGCCCGGCCCCGG + Intronic
1083657062 11:64234771-64234793 GCCCCCCGCGCCGCCGGGCTAGG + Exonic
1083659749 11:64246615-64246637 GCGGCCCCGGCCCCCGGGCCGGG - Exonic
1083713389 11:64562182-64562204 GCCACCCCCGCCCCCATGGCAGG - Intronic
1083729198 11:64643750-64643772 GCCCGCCCCTCCCCCGCGCCTGG + Intronic
1083745736 11:64735616-64735638 ACCACCCCGGCCCCCGGTACTGG - Exonic
1083747716 11:64744870-64744892 CCCGCCCCCGCCCCCGCGCCAGG + Intronic
1083869371 11:65477500-65477522 GCCTCCCCTGCCCCCGCGCCGGG - Intergenic
1083920852 11:65780883-65780905 GCCACCCCGGCCCCCGGCGCCGG + Intergenic
1083953114 11:65967594-65967616 GCCCCTCCCACCCCCTGGCCGGG - Intronic
1083999386 11:66288052-66288074 GCCACCCGTGCCCCGGGGGCAGG + Intronic
1084192105 11:67504026-67504048 GCCAGCCCTGCCCCGGGGCTGGG - Intronic
1084192197 11:67504360-67504382 GCCGCCCGCGCCGCCGGGGCCGG + Intronic
1084295916 11:68213403-68213425 GCCCCCCGCGCCCCCGGCCTCGG + Exonic
1084310223 11:68312506-68312528 GCCACCCGCGCCCCCCGCACCGG - Intergenic
1084390430 11:68872179-68872201 GCCACCCCACCCCCCGCCCCCGG - Intergenic
1084493341 11:69489918-69489940 GGCACCCCCACCCCTGGGGCTGG - Intergenic
1084527060 11:69704171-69704193 CCCAGCCCCCTCCCCGGGCCCGG + Exonic
1084531222 11:69728955-69728977 GCCACCCTCCCTCCCAGGCCTGG - Intergenic
1084626655 11:70312888-70312910 GTCACACCCGCCCCCAGCCCCGG - Intronic
1084758077 11:71251768-71251790 GCCACCCCCGGGCCCGCACCAGG + Intronic
1085284629 11:75351733-75351755 GCCGCCGCCGCCCCCGCCCCCGG + Intergenic
1085474908 11:76783508-76783530 CCCAGCCCCGCCCCTGCGCCCGG - Intronic
1085765769 11:79280412-79280434 GCCACCACAGCTCCAGGGCCTGG + Intronic
1086926304 11:92644102-92644124 GCCACCTTGGCCCCCGGCCCTGG - Intronic
1087673191 11:101129209-101129231 CCCTCCCCCGCCCCCGACCCAGG - Exonic
1088819735 11:113447153-113447175 GCCCCACCCTCCCCGGGGCCTGG + Intronic
1088912022 11:114199196-114199218 GTCATCCCCGTCCCGGGGCCCGG - Intronic
1089046104 11:115503558-115503580 GCCGCCCCCCCCGCGGGGCCGGG + Intronic
1089432683 11:118436637-118436659 GCCACCGCCGACCGGGGGCCCGG - Exonic
1089515296 11:119028220-119028242 GCCAGCCCAGCCCCTGGGCCAGG + Exonic
1089729460 11:120511526-120511548 GCCCCCGCCGCCCCCGCGCCTGG + Intergenic
1090780352 11:130002126-130002148 GCCACCCCCAGCCCGGCGCCCGG + Intronic
1091222231 11:133936363-133936385 ACCACCCCTGCCCCCGCACCAGG + Intronic
1202813616 11_KI270721v1_random:37690-37712 GCGACCCCCGCCCACAGCCCAGG - Intergenic
1091434016 12:459902-459924 CCCGCCCCCGCCCCCGCCCCGGG - Intergenic
1091730530 12:2877093-2877115 CCCACCCCCGGCCCCGGCCCGGG - Intronic
1091919678 12:4294257-4294279 GCTGCCCCCGCCCCCAAGCCTGG - Intronic
1092228986 12:6766590-6766612 GCCGCCGCCGCCACCGCGCCAGG + Exonic
1092229024 12:6766679-6766701 GCCAGCCCCGGCCCCGGCCCCGG + Exonic
1092843364 12:12562998-12563020 GCGGCCCCGACCCCCGGGCCGGG + Intergenic
1093931129 12:24956087-24956109 GCCCCCTCCGCCCCCGCCCCGGG + Intergenic
1094703999 12:32896965-32896987 CCCGCCCCCGCCCCCGCCCCCGG - Intergenic
1095097398 12:38155831-38155853 CCCCCCCCCGCCCCCGGGCCAGG - Intergenic
1096077773 12:48815648-48815670 CTCTCCCCCTCCCCCGGGCCAGG - Intronic
1096167342 12:49436528-49436550 GACCCCCCCGCCTCCTGGCCGGG + Intronic
1096241296 12:49961679-49961701 GCGACCCCCGCCCCCCGGCCGGG - Intergenic
1096309117 12:50504955-50504977 ACGGCCCCCGCCCCCCGGCCAGG - Intergenic
1096468942 12:51864353-51864375 GGCGCCCCCGGCCCGGGGCCCGG + Intergenic
1096570458 12:52520168-52520190 ACCACCGCCACCCCCGGACCGGG + Exonic
1096700626 12:53380497-53380519 GCTGCCCCCTCCCCCGGGGCGGG - Intronic
1096777615 12:53973787-53973809 GGCACCCCCGGCCTCGGGACTGG + Exonic
1097929671 12:65169969-65169991 GCCTCCGCCGCCCCCGCGGCTGG + Exonic
1100260524 12:92928880-92928902 GCCCTCCCCGCCCCCGGGCCGGG + Intronic
1101967623 12:109291996-109292018 GACAGCCACGGCCCCGGGCCTGG + Intronic
1102136863 12:110582939-110582961 GCCGCCGCCGCCGCCGGCCCTGG + Exonic
1102197150 12:111033960-111033982 GCCGCCGCCGCCAACGGGCCCGG - Intergenic
1102644626 12:114396144-114396166 CCCTCCCCCGCCCCCGGCCGCGG - Intronic
1102924972 12:116819537-116819559 GCCTCCTCCTCCCCCGGGCCCGG - Intronic
1102948478 12:117011213-117011235 GGCGCCCCCTCCCCTGGGCCCGG + Intronic
1103342749 12:120229876-120229898 GCCACACCAGCCCCAGCGCCAGG + Intronic
1103649639 12:122422635-122422657 GCCGCCGCCGCCGCGGGGCCGGG + Intergenic
1103722264 12:122981181-122981203 CCGACCCCCGTCCCCGGGACCGG - Exonic
1103779318 12:123388908-123388930 ACCAGCCCCCTCCCCGGGCCGGG + Intronic
1103902671 12:124311503-124311525 GCCACACCCACCCCGGAGCCCGG - Intronic
1103905792 12:124326652-124326674 GCGACCCCAGCCCCAGGGGCTGG + Intronic
1103968708 12:124656077-124656099 GCATCCCCCGCCCCCTAGCCTGG - Intergenic
1104042859 12:125141792-125141814 CCCACCCCCGCCCCCTGGCACGG - Intronic
1104568304 12:129903966-129903988 GGCCCGCCCGGCCCCGGGCCCGG + Intergenic
1104721072 12:131045512-131045534 CCCACCCCCGCCTCCCTGCCCGG + Intronic
1105011769 12:132761408-132761430 GGCCCCTCCGCCCCCGGCCCGGG + Intronic
1106269376 13:28138743-28138765 GACACCCCCGACCCCCGGCGGGG - Exonic
1106340242 13:28820239-28820261 GCCGCCCCCGCTCGAGGGCCGGG - Intergenic
1106422558 13:29595725-29595747 CCCACGCCCGCCCCCGGACCAGG + Intergenic
1108541499 13:51451737-51451759 GCCGCCGCCGCTGCCGGGCCGGG + Intronic
1108555185 13:51584635-51584657 GCCAACCGCGCCGCGGGGCCGGG - Exonic
1112752561 13:102597224-102597246 GCCGCCCGCGCCCCCGCGCCCGG - Intronic
1113378130 13:109782939-109782961 GCCGCCACCGCCGCCGGCCCCGG - Exonic
1113437901 13:110307400-110307422 GCCGCCCGAGCCCCCGGGGCCGG + Exonic
1113473283 13:110561768-110561790 CCCGCCCCCGCCCCCGCCCCCGG + Intergenic
1113639107 13:111944481-111944503 GCCACCTCCTCCCCAGGGACAGG - Intergenic
1113656039 13:112068235-112068257 GCCGCCGCCGCCACCGAGCCGGG - Exonic
1113659684 13:112097155-112097177 GCCACCTCTGCCCACGGCCCTGG + Intergenic
1113769231 13:112897978-112898000 CCCAGCCCCGGCCCCGGCCCCGG + Intronic
1113820603 13:113209722-113209744 GCCGCCCGCGCCCCCCGGCTTGG - Exonic
1113874400 13:113585156-113585178 CCCAGCCCCGGCCCCGGCCCCGG - Intronic
1113959156 13:114116215-114116237 GACACCCCTCCCCTCGGGCCAGG + Intronic
1115217193 14:31025837-31025859 CCCAGCCCCACCCCCCGGCCGGG + Intronic
1115421281 14:33198693-33198715 GGCAGCTCCGCCCCCGGACCTGG - Intronic
1115545445 14:34462008-34462030 TCCACCCCAGGCCCGGGGCCTGG + Intronic
1116003578 14:39269115-39269137 GCCATCCTAGCCCCCAGGCCAGG - Intronic
1116828405 14:49693826-49693848 GCAACCTCCGCCCCCCGCCCCGG + Intronic
1116905105 14:50396692-50396714 GCGCCCCACGCCCCCGGGACTGG + Intronic
1117029339 14:51652285-51652307 GCCTCCCCCGCTGCCGGGCTCGG - Intronic
1117251862 14:53946869-53946891 GCCCCCGCCGCCGCCGGGCCTGG + Intergenic
1117545857 14:56794587-56794609 GCCACCCCCGCCTCTGAGCGCGG + Intergenic
1117647404 14:57866118-57866140 CCCACACCCGCCCCCGGCCACGG - Intronic
1117805371 14:59484716-59484738 ACCCCGCCCGCCCTCGGGCCGGG + Exonic
1117913622 14:60656094-60656116 GCCTCCCCTACCCCCGGTCCAGG + Intronic
1118339095 14:64879820-64879842 GCCGCCGCCACCCCCGGGCTCGG - Exonic
1119320524 14:73727418-73727440 GCCACCCACACCCCTCGGCCAGG + Intronic
1119435223 14:74594211-74594233 GCCACCCTACCCCCCGGGCAAGG + Intronic
1119725561 14:76920086-76920108 CCCACCCCCTCCCCCTGGCAAGG + Intergenic
1119743511 14:77028496-77028518 GCTCCCGCCGCCCCCAGGCCTGG + Exonic
1121252993 14:92513613-92513635 GCACCCCCCGCCCCGAGGCCCGG + Intergenic
1121370003 14:93347678-93347700 CACAGCCCCGCCCCCGAGCCAGG - Intronic
1121398839 14:93653752-93653774 GCCACCCCCGCCGCATTGCCGGG - Exonic
1121473466 14:94174292-94174314 GCCCGCCCCGCCCCCTCGCCGGG + Exonic
1121645752 14:95516425-95516447 GGGGCCCCCGCCCCCGCGCCGGG + Intronic
1121711013 14:96039310-96039332 GCCCCGCCCGCCCCCGCGCTCGG + Exonic
1122113289 14:99515892-99515914 GCCCCCCACCCCCCCGGGACTGG - Intronic
1122162336 14:99793440-99793462 GCCGCGCCCGCTCCCCGGCCCGG - Exonic
1122162427 14:99793764-99793786 GCCACCCCGGCTCCCGGCACTGG + Intronic
1122199682 14:100114786-100114808 CCCACCCCCACCCCCGGAGCAGG - Intronic
1122266687 14:100549965-100549987 GCCCCCCAGGCCCCCAGGCCTGG - Intronic
1122343917 14:101046253-101046275 GCCACCCCAGCCATCGGCCCGGG - Intergenic
1122347775 14:101071164-101071186 GCCACCCCCGCCCCAGGCCTTGG - Intergenic
1122399428 14:101458319-101458341 CCGACCCCCGACCACGGGCCTGG - Intergenic
1122418476 14:101561294-101561316 GCCCCCACCGGCCCCAGGCCCGG + Intergenic
1122620748 14:103056666-103056688 CCCACCCCCTCCCCCCCGCCGGG - Intronic
1122790211 14:104181193-104181215 GCCAGCCCAGCCCCCAAGCCTGG - Intergenic
1122887274 14:104715648-104715670 CCCGCCCACGCCCCAGGGCCCGG - Intronic
1122917133 14:104864589-104864611 CCCACCCCCACCCCTCGGCCAGG + Intergenic
1122947841 14:105021291-105021313 CCCGCCCCCGCCCCTGCGCCCGG + Intergenic
1122993189 14:105248593-105248615 GCGCCCCCCGCGGCCGGGCCTGG + Exonic
1123037989 14:105479074-105479096 CCCGCCCCCGCCCCCGCCCCGGG + Intronic
1123037995 14:105479080-105479102 CCCGCCCCCGCCCCGGGGCTCGG + Intronic
1123057162 14:105575947-105575969 CCCACCACGGCCCCCAGGCCCGG - Intergenic
1123081082 14:105695944-105695966 CCCACCACGGCCCCCAGGCCCGG + Intergenic
1123112150 14:105877775-105877797 CCCACCCCGGCCCCTGGCCCTGG - Intergenic
1123216393 14:106813005-106813027 GCCACTCCCGACTACGGGCCGGG + Intergenic
1202906120 14_GL000194v1_random:73296-73318 CCCACCCCCTCCCCCGACCCCGG - Intergenic
1124109466 15:26772976-26772998 GGCGCCCCCTCCCCCGTGCCGGG - Exonic
1124195203 15:27619410-27619432 TCCACCCCAGCCCCCGGCACAGG + Intergenic
1124477039 15:30044591-30044613 ACCCCCCCCGCCGCCAGGCCCGG + Intergenic
1124500450 15:30223307-30223329 GCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1124501057 15:30226107-30226129 CCCAGCCTCGCCCCCGCGCCCGG - Intergenic
1124615175 15:31236476-31236498 GCCCCCTCGGCCCCCTGGCCCGG - Intergenic
1124629030 15:31326805-31326827 GCCCCGCCCACCCCCGGGGCCGG + Intergenic
1124742512 15:32312560-32312582 CCCAGCCTCGCCCCCGCGCCCGG + Intergenic
1124743124 15:32315360-32315382 GCCGGCCCCGGCCCCGGCCCCGG + Intergenic
1124966720 15:34437397-34437419 GGCAGCCCCGCGCCCTGGCCAGG - Intronic
1124983342 15:34583515-34583537 GGCAGCCCCGCGCCCTGGCCAGG - Intronic
1125603403 15:40927596-40927618 GACTCCCCCTCCCTCGGGCCTGG + Intergenic
1126122621 15:45267373-45267395 CCCACCCCAGCCCCAGGGGCTGG - Intronic
1126348265 15:47718458-47718480 GCCATCCCCATCCCCGGCCCAGG + Intronic
1127286465 15:57538010-57538032 GCCACCCCCCGCCCCAGGGCAGG + Intronic
1127961541 15:63894358-63894380 GCCACCCGGGCGCCCAGGCCGGG + Intergenic
1128317670 15:66671270-66671292 GCCACTCCCGCCTCCTGGCTTGG + Intronic
1128370462 15:67035749-67035771 CCCACCCCCACCCCGTGGCCAGG - Intergenic
1128455672 15:67830006-67830028 GCACCCCCCACCCCCGCGCCTGG - Intronic
1129287973 15:74541158-74541180 CCCGCCCCCGCCCCCGCCCCTGG + Exonic
1129428248 15:75480693-75480715 GCCACCGCCGCCCCACAGCCGGG + Intronic
1129670813 15:77606789-77606811 GCCGCCCCCGCCCCTGGGAATGG + Intergenic
1129761575 15:78131734-78131756 GCCGCCCCCGCCCCAGGTCAAGG - Intronic
1129871646 15:78945160-78945182 GCCGCCCCCTCCCGCGAGCCCGG - Intronic
1130901072 15:88207118-88207140 GCATCCCCAGCCCTCGGGCCAGG + Intronic
1131157704 15:90085093-90085115 GCAACCCCCGTCCCCAGGGCCGG - Exonic
1131232107 15:90666845-90666867 GACATCCCTGCCCCCAGGCCTGG - Intergenic
1131517610 15:93089316-93089338 GCGCCCCCCGCCCGCGGCCCGGG - Intergenic
1131832214 15:96361215-96361237 GGCCTCCCCGCCCCCGGCCCCGG + Intergenic
1131837998 15:96409468-96409490 GCTTCCCCCGACCCCGGACCCGG + Intergenic
1132147781 15:99438497-99438519 GCCTCCCCCGACCCCCGTCCTGG - Intergenic
1132419386 15:101652383-101652405 GCGCGCCCCGCCCCCCGGCCCGG - Intronic
1132475949 16:138280-138302 GCCCCCTCCGCCCCCGGCCCCGG - Exonic
1132527755 16:426021-426043 GCCGGCCTCGCCCCCGGGCTCGG + Exonic
1132551850 16:556852-556874 GTCAGCCCCGCACCCGGCCCAGG + Intergenic
1132573247 16:653235-653257 GCCACCCCCTCTCCCTGGGCTGG + Intronic
1132575240 16:661000-661022 GCCCCCCCCCCCCCCCGGCCCGG + Intronic
1132579185 16:677401-677423 CGCACCCCCGCCCCCTGCCCTGG + Intronic
1132590973 16:726333-726355 GCCACCACAGGCCCCAGGCCTGG - Exonic
1132600039 16:769208-769230 CCCAACCCCGGCCCCGGCCCCGG + Intergenic
1132656569 16:1044047-1044069 GCCCCCGCCGCCGCCGGCCCAGG - Intergenic
1132683580 16:1153347-1153369 TCCGCCCCCGGCCCCGGCCCCGG - Exonic
1132700719 16:1220953-1220975 GCCACCCCTGCCCCAGGGGGTGG + Exonic
1132736594 16:1389051-1389073 CCCTCCCCCGGCCCCGGCCCCGG + Intronic
1132816624 16:1831891-1831913 ACCATCCCCGCCCCCCGACCCGG + Intronic
1132828962 16:1918338-1918360 GCTGCCCCCGCTCCCGGGCCTGG - Exonic
1132831245 16:1929540-1929562 GCCACCCCCGCCCCCGCCCCTGG + Intergenic
1132862789 16:2079749-2079771 GCCACCCCGGCCCCTGGGCTCGG - Intronic
1132973603 16:2700862-2700884 GTCACCCCGGCCCCCGGCCTAGG - Intronic
1132987946 16:2777630-2777652 GTCACCCCCGCTCCCTGACCCGG + Intergenic
1133033488 16:3022446-3022468 CTCACCCCCGCCCCCGCGGCTGG - Intergenic
1133171169 16:3983287-3983309 GCCTCCCCCGCCCGCCGCCCTGG - Exonic
1133634672 16:7653915-7653937 GGCGCCCCCGCCCCCGATCCCGG + Exonic
1133661646 16:7924176-7924198 GCCACCCCCGACCCCAGCTCAGG + Intergenic
1133771273 16:8868496-8868518 CCCACCTCCCCCGCCGGGCCTGG + Intronic
1133908081 16:10039643-10039665 GCCGCCCCCGCTCCCGGGTGCGG - Intronic
1134065279 16:11224473-11224495 GCCACCGCCGGCCCTGGCCCGGG + Intergenic
1134628129 16:15737435-15737457 GCCAGCCCCGCTACCTGGCCAGG + Exonic
1135135819 16:19884916-19884938 CCCGCCCCCGCCCCCGCCCCCGG + Exonic
1136110947 16:28063425-28063447 GCCGCCCGCGCCGCCGGGACGGG + Exonic
1136146800 16:28320925-28320947 GCCTCCGCCGCCCTCGGACCCGG + Exonic
1136316188 16:29455765-29455787 GCCTCCACCGCCCCAGGCCCCGG + Exonic
1136366232 16:29810472-29810494 GCCACCCCTGCCCACTGTCCAGG - Exonic
1136430765 16:30195107-30195129 GCCTCCACCGCCCCAGGCCCCGG + Exonic
1136784283 16:32925519-32925541 GCCCCCGCCGCCGCCGGCCCGGG - Intergenic
1136858641 16:33681136-33681158 CCCCCCCCCACCCCCGGCCCCGG - Intergenic
1136885501 16:33928287-33928309 GCCCCCGCCGCCGCCGGCCCGGG + Intergenic
1137285637 16:47013978-47014000 GGCACCCGCGGCCCCAGGCCTGG + Intergenic
1137456638 16:48622859-48622881 GCCTTCCCTGCTCCCGGGCCAGG + Intergenic
1137691304 16:50429974-50429996 GCCACCTCTGCCCCTGGGCCTGG - Intergenic
1137785255 16:51133231-51133253 CCCACCCCCACCCCCGGTCTGGG - Intergenic
1138023161 16:53502882-53502904 GCCCCCCTCTCCCTCGGGCCGGG + Intronic
1138360747 16:56425437-56425459 GCCGCCGCCGCCGCCGCGCCGGG + Exonic
1138492179 16:57383096-57383118 CCCACCCCCACCCAAGGGCCTGG + Exonic
1138503359 16:57462872-57462894 TACACCCCCGCCCCCTGCCCCGG - Intronic
1138606261 16:58091344-58091366 ACCACACCCACCACCGGGCCCGG + Intergenic
1139436267 16:66938270-66938292 CCCACCCCTGCCCCAGGGCCTGG - Intronic
1139750341 16:69106142-69106164 GCCTCCCCCGGCCCTGGGGCCGG - Intronic
1139777982 16:69329241-69329263 CCTACCCCTGCCCCCGGTCCTGG + Intronic
1140067894 16:71626138-71626160 GCCCGCCCCGCCCCCGGGCTTGG + Intergenic
1140223131 16:73058233-73058255 GCCGCCGCCGCCGCCGAGCCCGG - Intronic
1141054418 16:80803472-80803494 GCCACCCCCACGCCCGAGCCCGG + Intronic
1141116815 16:81315680-81315702 GTCACCCCCTCGCCCAGGCCGGG + Intronic
1141620872 16:85235959-85235981 GCCCCCTCCGGCGCCGGGCCTGG + Intergenic
1141621522 16:85238893-85238915 GCCACCTGCACACCCGGGCCTGG + Intergenic
1141683395 16:85556749-85556771 GCCCCCCCCCCCCCCAGTCCTGG + Intergenic
1141828633 16:86497617-86497639 GCCCGCCCCGCCCCCGCCCCCGG + Intergenic
1141972496 16:87492896-87492918 GCCGCCGCCGCGCTCGGGCCCGG - Intergenic
1141989556 16:87602412-87602434 CCCGCCCCCGCCCCCGCCCCCGG - Intronic
1142033858 16:87851926-87851948 CCCACCCCCACCCCAGGGCCAGG + Intronic
1142219848 16:88848747-88848769 GCCACCCCCGCCCCCGGTGAGGG - Intronic
1142397378 16:89839860-89839882 GCCACCAGGGCCCCCTGGCCAGG - Intronic
1203086940 16_KI270728v1_random:1189525-1189547 GCCCCCGCCGCCGCCGGCCCGGG - Intergenic
1203120211 16_KI270728v1_random:1529630-1529652 CCCCCCCCCACCCCCGGCCCTGG - Intergenic
1142570227 17:868826-868848 GCCAGCACCGACCCTGGGCCGGG + Intronic
1142586856 17:979449-979471 GCCGCCCCGGCCCCCGCTCCCGG + Exonic
1142617058 17:1142864-1142886 GCCACCCTCACCCCGAGGCCTGG + Intronic
1142670548 17:1485759-1485781 GCCGCCACCGCCGCCGAGCCCGG - Intronic
1142752637 17:1998034-1998056 CCCACCCCCGCCTCCGCCCCAGG + Intronic
1142810266 17:2392841-2392863 GCCAGCCCCGCCCCCTGGCCGGG + Intronic
1143014679 17:3885376-3885398 GCCACATCTCCCCCCGGGCCTGG - Exonic
1143030358 17:3964133-3964155 GCGGCCCCCGCTCCCCGGCCCGG + Intronic
1143119662 17:4598961-4598983 ACCACCCCGGCCCCTGAGCCTGG + Intronic
1143201455 17:5116259-5116281 GCCACTCCCGGCCCCGCTCCGGG + Intronic
1143452534 17:7044059-7044081 GCTCCCCCCTCCCCCGGGCCTGG - Intergenic
1143512345 17:7403781-7403803 GGCACCCCCCCCCCCGCCCCAGG + Intronic
1143554367 17:7651476-7651498 GCAACCCCCCGCCCCGCGCCCGG + Exonic
1143585555 17:7848667-7848689 ACCACCCCCACCCCCCAGCCCGG + Exonic
1143634442 17:8156367-8156389 TCCAAACCCGCCCACGGGCCGGG + Intronic
1144574162 17:16418450-16418472 GCAGGCCCCGCCCCCGGGCAGGG - Intronic
1144586743 17:16491929-16491951 GCCAGCCCCGGCGCCGCGCCGGG - Exonic
1144770688 17:17757810-17757832 GCCTCTCCCGCCCCGGCGCCTGG - Intronic
1144782213 17:17813943-17813965 CCCACACCCGCCACCGGCCCGGG + Intronic
1144782938 17:17816945-17816967 GCCAGCCCCTTACCCGGGCCAGG + Exonic
1144838666 17:18172135-18172157 GCCACCCCCTCTCCCTGCCCAGG + Exonic
1144958340 17:19030932-19030954 GCCAGCCCTGTCCCAGGGCCTGG - Intronic
1144976818 17:19143592-19143614 GCCAGCCCTGTCCCAGGGCCTGG + Intronic
1145230883 17:21172427-21172449 CCCACCCCACCCCCGGGGCCAGG - Intronic
1145254950 17:21317308-21317330 GCCCCCCCCTCCCCCGAGGCCGG + Intergenic
1145815736 17:27793768-27793790 GCAGCCCCCGCCCCGGGGGCGGG + Intronic
1145815740 17:27793774-27793796 GCTCGCCCCGCCCCCGGGGCGGG - Intronic
1146650609 17:34603889-34603911 GCCCCCTCCGCCACCAGGCCTGG + Intronic
1146652208 17:34613777-34613799 GCCACCAACCCCCCAGGGCCTGG - Intronic
1147139722 17:38454156-38454178 GCCTGCCCCGGCCCCGGCCCCGG - Intronic
1147144574 17:38477666-38477688 GCCCCCGCCGCCGCCGGCCCGGG - Exonic
1147168559 17:38605581-38605603 GCCGCCCCCGCCCCCGGCCGAGG + Intronic
1147184257 17:38705196-38705218 GCCCCCCCGGCCCCCCTGCCCGG - Intergenic
1147199403 17:38789937-38789959 GCACCCCCCGCCCCCTGGCCAGG - Intronic
1147339091 17:39743225-39743247 GCTATCTCCGCCCACGGGCCAGG - Exonic
1147609620 17:41793835-41793857 GCCACCCCCTCCCCCAGCCCTGG - Intergenic
1147719807 17:42532127-42532149 GGCGCCGCCGCCGCCGGGCCGGG + Intergenic
1147720398 17:42536319-42536341 GCCTGCCGCGCCCCCGGCCCCGG - Exonic
1147754792 17:42761201-42761223 GGCGCCCCCACACCCGGGCCCGG + Exonic
1147792476 17:43022093-43022115 GCGCCCCCGGCCCCTGGGCCCGG - Exonic
1147976188 17:44249522-44249544 CCCACCCCCACCCCAGGGCAGGG + Exonic
1147994629 17:44354041-44354063 GCCGCCCGCGCCCCCGCGCCTGG - Exonic
1148111590 17:45147539-45147561 CCCCCGCCCGCCCCCGGCCCCGG + Intergenic
1148123500 17:45225352-45225374 GCCACTCCCACCTCCGGGACAGG + Intronic
1148178015 17:45584690-45584712 GCCCCCGCCTCCCCCCGGCCGGG + Intergenic
1148451166 17:47778556-47778578 GCCTCCCTGGCCCCCGGCCCGGG - Intergenic
1148488227 17:48005082-48005104 CCCACCCCCGCCCCCATTCCAGG - Intergenic
1148552066 17:48556320-48556342 GGCACCCTCACCCCCGGGCCAGG - Intronic
1148553506 17:48564426-48564448 CCCGCCCCCGCCCCCGCCCCCGG + Intronic
1148562428 17:48613636-48613658 GCCCCCCCCGCCCCCGCACGGGG - Intronic
1148599770 17:48885338-48885360 AGCACCCCCCACCCCGGGCCAGG + Intergenic
1148748637 17:49932076-49932098 ACCTCCTCAGCCCCCGGGCCTGG - Intergenic
1148821377 17:50361717-50361739 CCCACCCCCACCACCAGGCCAGG + Intronic
1148865467 17:50626091-50626113 GCCCTCCCCGCCCCTGGCCCGGG + Exonic
1148970785 17:51479424-51479446 CCCACCCCCACCCCTTGGCCTGG + Intergenic
1149678584 17:58488092-58488114 CCCGCCACCGCCCCCCGGCCCGG + Exonic
1150128439 17:62653364-62653386 CCCACCCCCGCCCCCACCCCCGG + Intronic
1150128447 17:62653370-62653392 CCCGCCCCCACCCCCGGGGCGGG + Intronic
1150217207 17:63477352-63477374 GCCCCGCCCCCGCCCGGGCCCGG - Intergenic
1150407903 17:64918976-64918998 GCCCCCGCCTCCCCCCGGCCGGG + Intronic
1150423251 17:65056809-65056831 GCCACCGCCCCTCCGGGGCCGGG - Exonic
1151570502 17:74923267-74923289 GCCCCCTCCGCCCCCGCCCCCGG - Intergenic
1151703877 17:75756866-75756888 GCCACTCCTGCCCCCGGGGTGGG - Intronic
1151712914 17:75817070-75817092 CCCTACCCCACCCCCGGGCCTGG - Intronic
1152183489 17:78840213-78840235 GCCACTCCAGCCCCAGGCCCAGG + Intronic
1152188034 17:78870797-78870819 GCCTCCCCACCCCCCGAGCCTGG + Intronic
1152197213 17:78924926-78924948 GCGACCCCAGCCCCCGCGCGGGG - Intronic
1152224522 17:79086458-79086480 CCCACCCCAGCCCCGGGACCGGG - Exonic
1152226857 17:79096783-79096805 GCCAGCCCCGCCCATGGGACTGG + Intronic
1152357215 17:79813181-79813203 CCCACCCCCACCCCGGTGCCCGG - Intergenic
1152544047 17:80991990-80992012 CCCAGCCCTGACCCCGGGCCCGG - Intronic
1152629726 17:81405499-81405521 GCCTCCCCCGCCCCCAATCCTGG + Intronic
1152719830 17:81918012-81918034 GCCGCCGCCGCTCCCCGGCCCGG - Intronic
1152781988 17:82230752-82230774 CCCGCCCCTGCCCCAGGGCCCGG - Intronic
1152817719 17:82418301-82418323 CCCACCCCCCCACCCGGGTCGGG + Exonic
1153262477 18:3237966-3237988 GCCACCCCTGCCCCAGTCCCTGG - Intergenic
1153457233 18:5295279-5295301 GCCGCCCCCGCCCCCGGCCGCGG - Intronic
1153636385 18:7117264-7117286 GCCACCCCCGCCCGCGCAGCCGG + Intronic
1154125606 18:11689656-11689678 GCCCGCCCCGGCCCCGGCCCTGG + Exonic
1154295210 18:13141419-13141441 GCCTGCCCCGCCTCGGGGCCTGG + Intergenic
1156099609 18:33578326-33578348 GCCGCCCCCGCCCCTGGCCCGGG + Intergenic
1156275775 18:35581663-35581685 CCCGCCCCCGCCTCCGCGCCCGG - Intronic
1157464186 18:47930511-47930533 TCCCGCCCCGCCCCCAGGCCCGG + Exonic
1157492989 18:48136921-48136943 CCCACCCCCTCCCCACGGCCCGG + Intronic
1157753078 18:50195194-50195216 GCCACCTGGGCCTCCGGGCCGGG + Intergenic
1158601942 18:58863511-58863533 GCCGCCGCCGCCGCCCGGCCCGG + Intronic
1158602030 18:58863819-58863841 CCCACCCGCGCCCCTGGGTCCGG - Intronic
1158648498 18:59267631-59267653 GCCCCCCCCCCCCCCGTGCCAGG + Exonic
1159770395 18:72541766-72541788 GCCCACCCCGCCCCCAGCCCGGG - Intronic
1160012462 18:75116394-75116416 ACCCCCCCCGCCCCAGAGCCAGG - Intergenic
1160439779 18:78880421-78880443 CTCACCCCCGCCCCCCGCCCCGG - Intergenic
1160452038 18:78973011-78973033 GCCACCCCCGCCCCCACACTCGG + Intergenic
1160499308 18:79394451-79394473 CCGACCCCCGCCCACCGGCCTGG + Intergenic
1160724852 19:613565-613587 CCCATCCCCGGCCCCGGCCCCGG - Intronic
1160781141 19:878429-878451 CCCAGCCCCGGCCCCGGCCCCGG + Intronic
1160781296 19:878913-878935 ACCAGCCCCGGCCCCGGCCCCGG + Intronic
1160793495 19:933511-933533 GCCACCTCCTCGCCCGGGGCTGG + Intronic
1160839700 19:1140596-1140618 GCCACCCCCACCCCCACCCCTGG - Intronic
1160858077 19:1226325-1226347 GCCATGCCCGCCCCCGGGTCAGG - Intronic
1160887131 19:1355192-1355214 GCCCCCCCTCCCCCCAGGCCCGG - Intronic
1160887985 19:1360888-1360910 GCCGCACCATCCCCCGGGCCGGG + Exonic
1160909280 19:1467432-1467454 GCCCGCCCCGGCCCCGGCCCAGG + Exonic
1160967781 19:1754121-1754143 GCCACCCCCGCCGCAGCGTCTGG + Exonic
1160979119 19:1808377-1808399 GGCACCCCCATCCCCTGGCCTGG - Intronic
1160981855 19:1819905-1819927 GCCTCCCCCGCCCACCCGCCAGG + Intronic
1161139048 19:2637210-2637232 GCTCCCCCCGCCCCCGAGCCCGG + Intronic
1161148962 19:2696793-2696815 TCCACCCCCTCCCCCAGCCCTGG - Intronic
1161162912 19:2770566-2770588 GCCGCCCCCGCCCCCGCCGCTGG + Intronic
1161233451 19:3186805-3186827 CCCACCCCCTCCCACGGCCCTGG + Intronic
1161237689 19:3206062-3206084 CCCAGCCCTGCCCCCGGCCCCGG + Intronic
1161253794 19:3295212-3295234 CCCACCCCCGCCCCTGCCCCAGG - Intronic
1161265189 19:3360410-3360432 GCCACCGCCGCTCCAGGGCCTGG - Intronic
1161284940 19:3464034-3464056 CCCACCCCCGCGCCCCGGCAGGG - Intronic
1161313588 19:3607747-3607769 CCCACCCCGTCCCCTGGGCCCGG + Intergenic
1161323773 19:3653254-3653276 GCCACCCTCCCTCCCCGGCCGGG + Intronic
1161400703 19:4065458-4065480 GCCACCGCCGCCGCCGGGGCCGG - Intronic
1161400767 19:4065629-4065651 GCCTCCCCCACGCCCGGGCCCGG + Intronic
1161457664 19:4377667-4377689 GCCACTCCTGCCCCCTCGCCAGG + Intronic
1161457762 19:4378071-4378093 GCCACCCCTGTCCCTGTGCCTGG - Intronic
1161494655 19:4580690-4580712 GCGACCCCTGCCCCGCGGCCTGG + Intergenic
1161504422 19:4636260-4636282 GTCACCCGCACCCCCAGGCCAGG - Intergenic
1161628765 19:5340884-5340906 GCCGCCGCCGCCGCCGGGTCGGG + Intergenic
1161794930 19:6381093-6381115 GCCTCCCCCGCCACCGGGCTGGG + Intronic
1161894313 19:7069228-7069250 GACAGCCCCGCCCCCATGCCTGG + Intergenic
1161957717 19:7505895-7505917 TCCTCCCTCCCCCCCGGGCCCGG + Intronic
1161959478 19:7516009-7516031 GCTGCCCCCGCCCCCCGGGCAGG - Intronic
1161977188 19:7613193-7613215 CCCGCCCCCGCCCCAGGCCCAGG - Intronic
1161978625 19:7619446-7619468 GCCAATCCCGGCCCAGGGCCAGG + Intergenic
1162030876 19:7916762-7916784 GCCACCGCCGCCGCCGAGCCCGG + Exonic
1162070621 19:8149922-8149944 GCCACCCCCTCCCTCGAGCAAGG + Intronic
1162126011 19:8499874-8499896 ACCACCCCTGCGCCCAGGCCCGG + Intronic
1162209424 19:9079746-9079768 CCCACCCCAGCCCCTGGGCTCGG - Intergenic
1162257036 19:9498825-9498847 TCCAGCCCCGCCCCCGGGCATGG - Intergenic
1162366414 19:10252268-10252290 GCCAGGCCCGCGCCCCGGCCCGG - Exonic
1162535830 19:11262455-11262477 GCCGCCGCCGCCCCGGGCCCCGG + Intronic
1162668844 19:12237770-12237792 CCCACCCCCCCGCCCAGGCCAGG + Intronic
1162744712 19:12791944-12791966 GCCACCGCCGCCCTCTGGGCCGG - Exonic
1162780959 19:13006873-13006895 GCCACCCCCACCCCATGCCCGGG + Intronic
1162901060 19:13795710-13795732 GCCACGCGCGGCCCCGGCCCCGG - Exonic
1162909006 19:13839669-13839691 ACCACCTCCGCCCCCAAGCCTGG + Intergenic
1162959731 19:14118441-14118463 GCCACCCCTTGCGCCGGGCCCGG - Intergenic
1162997153 19:14343427-14343449 GCCAGCCAGGCCCCTGGGCCTGG + Intergenic
1163012298 19:14433618-14433640 GCCCCCCCAGCCCCCGGAACGGG + Intronic
1163085946 19:14979788-14979810 GCCTCCCCCGCGCCCAGCCCAGG + Intronic
1163112636 19:15170642-15170664 GCCACCCCCTCCCCAAGGCAGGG + Intronic
1163117908 19:15199757-15199779 CCCAGCCCAGCCCCGGGGCCCGG - Intronic
1163158040 19:15449682-15449704 CCCGCCCCCGCCCCCGCCCCGGG + Intronic
1163400902 19:17091829-17091851 GCGTGCCCCGCCCCCAGGCCAGG - Intronic
1163426986 19:17245444-17245466 GCCCCTCCCGGCCCCGGGCCCGG - Exonic
1163478220 19:17539423-17539445 GCCGCGCCCGCGCCTGGGCCTGG + Exonic
1163508039 19:17719725-17719747 GCGACCCCCGCCCCGGAGCCCGG - Intronic
1163567426 19:18059833-18059855 GCCCCCCCACCCCCCGGGCAGGG + Intronic
1163575767 19:18110080-18110102 GCGACCCTCGCTGCCGGGCCGGG + Intronic
1163597068 19:18226375-18226397 CCCGCCCCGGTCCCCGGGCCCGG - Intronic
1163688661 19:18726341-18726363 GCCAGCTCCCCTCCCGGGCCTGG - Intronic
1163743880 19:19033458-19033480 GCCACCCCCGCCGCCGCCTCAGG + Intronic
1163859277 19:19732737-19732759 GCGACCTCGGCCCCCGGTCCTGG - Intronic
1164274223 19:23702653-23702675 CCCGCCCCCGCCCCCGCCCCTGG + Intergenic
1165480386 19:36060042-36060064 TCCACCCCTGCCCCGGGCCCAGG - Intronic
1165507527 19:36243740-36243762 GCCACCCCCACCCCCAGCCTGGG - Intronic
1165764016 19:38338941-38338963 GCCACCCCCTCCCCCCGACCTGG - Intronic
1165832462 19:38736419-38736441 GCCTCCCCTGCCCCCGGACCCGG + Intronic
1165832675 19:38737077-38737099 GCCTCCCCCGCTCCTTGGCCCGG + Intronic
1165939162 19:39406764-39406786 TCCTGCCCCGCCCCCGGCCCCGG + Intergenic
1165939166 19:39406770-39406792 CCCGCCCCCGGCCCCGGCCCCGG + Intergenic
1166557429 19:43710260-43710282 TCCACCCCCACCCCCAGGCTGGG + Intergenic
1166723599 19:45011989-45012011 GGCAGCCCCTCGCCCGGGCCCGG - Exonic
1166843416 19:45712424-45712446 GCCCCCTCCGCCCCCTGCCCGGG - Exonic
1166984127 19:46649541-46649563 GCCGTCCGCGCCCCCGGGACTGG + Exonic
1167001134 19:46746306-46746328 TCCGCCCCTGCCCCCGGGCCGGG - Exonic
1167029904 19:46951299-46951321 CCCATCCCCGCCCCCTGTCCTGG - Intronic
1167077033 19:47256538-47256560 GCGACCGCAGCTCCCGGGCCAGG - Exonic
1167354226 19:48993389-48993411 GAAATCCCCGCCCCCGGGCGTGG - Intergenic
1167368085 19:49065072-49065094 CCCGCCCCCGCCCCCGACCCGGG - Intronic
1167428414 19:49441424-49441446 GATCCCCCCGCCCGCGGGCCCGG + Exonic
1167429004 19:49443581-49443603 ACCGCCTCCGCACCCGGGCCGGG - Intergenic
1167499277 19:49836297-49836319 GCCTCCGCCGCACCAGGGCCTGG + Exonic
1167504095 19:49862341-49862363 CCCACCCCCACCCCCGCCCCAGG + Intronic
1167508694 19:49884377-49884399 GCCACGCCCGTCCCCAGGCCTGG - Intronic
1167566297 19:50259284-50259306 CCCAGCCCCTCCGCCGGGCCTGG - Intronic
1167589907 19:50398870-50398892 GGCACCCCGGGCCCTGGGCCTGG - Exonic
1167738688 19:51311718-51311740 GCCCCCGCCGCCCCCCGGGCCGG + Intergenic
1168064040 19:53909382-53909404 CCCGCCCCCGCCCCGGAGCCCGG - Exonic
1168239526 19:55082186-55082208 GACGCGCCCGCCCCTGGGCCGGG + Intronic
1168307319 19:55442654-55442676 GCCCGCCCCGCCCGCGGGGCCGG + Exonic
1168315201 19:55482006-55482028 GCCGCCCCCGCCCCCGCCCGTGG + Exonic
1168315268 19:55482235-55482257 CCCGCCGCCGCCCCCGCGCCTGG + Exonic
1168465093 19:56595380-56595402 GCCGCGCCCTCCCCGGGGCCAGG - Exonic
1168659409 19:58154692-58154714 ACCACCCCCCCCCCCGCCCCAGG + Intronic
1202714179 1_KI270714v1_random:33368-33390 GGGACCCCCGCGCCCGGGCAGGG + Intergenic
925610354 2:5696706-5696728 CCCTCCCCGGCCCGCGGGCCCGG - Exonic
926751795 2:16204063-16204085 GTCACCCCAGACCCCAGGCCTGG + Intergenic
926914335 2:17878496-17878518 GCCGCCCGCGCCCTCGGCCCGGG + Intronic
927156293 2:20223593-20223615 GCCTCCCCAGCCCCCGCGCCCGG - Intronic
928002867 2:27539749-27539771 ACCCCCCCCGCCCCCGGACGGGG + Intronic
928206045 2:29284311-29284333 GCTGCCCCCACCCCCGCGCCAGG - Intronic
928319012 2:30268560-30268582 GCCACCCACAGCCCTGGGCCTGG + Intronic
929188675 2:39120668-39120690 CGCACCACCGCCCCGGGGCCAGG + Intronic
929454855 2:42058318-42058340 CCCACCCCCGCCCCAGGTCCTGG - Exonic
929534197 2:42770353-42770375 GCTCCCCCCTCCCCCCGGCCTGG + Intronic
929557080 2:42932214-42932236 GCCACCCTCCTCCCAGGGCCTGG - Intergenic
929777998 2:44940470-44940492 GCCACCACAGCCCCTAGGCCAGG - Intergenic
929856094 2:45639784-45639806 ACCTCCCCAGCCCCCAGGCCAGG + Intergenic
929969504 2:46561898-46561920 GCCACCCTGGACCTCGGGCCAGG + Intronic
930177280 2:48314448-48314470 CCCACCCCAGCCGCCGTGCCAGG + Intergenic
931657680 2:64524684-64524706 GCCAGACCCTCACCCGGGCCGGG + Intronic
932466992 2:71930395-71930417 GCCACCACTGCCCCCCTGCCAGG + Intergenic
932699691 2:73984620-73984642 GCCACCCTCGCCCTCCGGCGGGG - Intergenic
932699909 2:73985221-73985243 CCCTCCCCCTCCCCCGGGCCGGG - Intergenic
933684708 2:85133689-85133711 GCCGCCCCCGCCGCCGAGCTGGG - Exonic
933847467 2:86337421-86337443 TCCCTCCCCGCCCCCGGCCCCGG - Intronic
933907945 2:86913977-86913999 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933907958 2:86914011-86914033 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933907983 2:86914075-86914097 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908003 2:86914124-86914146 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908031 2:86914201-86914223 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908042 2:86914229-86914251 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908077 2:86914325-86914347 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908093 2:86914371-86914393 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908107 2:86914411-86914433 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908151 2:86914536-86914558 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908174 2:86914603-86914625 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908186 2:86914637-86914659 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908199 2:86914674-86914696 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908213 2:86914714-86914736 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908229 2:86914760-86914782 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908257 2:86914840-86914862 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908275 2:86914892-86914914 GCCTCCGCCGCCGCCCGGCCAGG - Intronic
933908287 2:86914926-86914948 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933911157 2:86942476-86942498 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933911167 2:86942504-86942526 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933911177 2:86942532-86942554 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933911208 2:86942650-86942672 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
934011420 2:87824715-87824737 GCCGCCGCCGCCGCCCGGCCAGG + Intronic
934011435 2:87824755-87824777 GCCGCCGCCGCCGCCCGGCCAGG + Intronic
934011451 2:87824798-87824820 GCCGCCGCCGCCGCCCGGCCAGG + Intronic
934011463 2:87824829-87824851 GCCGCCGCCGCCGCCCGGCCAGG + Intronic
934011551 2:87825383-87825405 GCCGCCGCCGCCGCCCGGCCAGG + Intronic
934011568 2:87825429-87825451 GCCGCCGCCGCCGCCCGGCCAGG + Intronic
934031862 2:88055596-88055618 GCCGCCCCCGCCGCCGGGGCGGG + Intronic
934770856 2:96906965-96906987 GCTCCCCTCACCCCCGGGCCGGG - Intronic
935275814 2:101474437-101474459 GCCTTCCGCGCCCCCGGGCTCGG - Intronic
935692875 2:105745606-105745628 GCCTCCCCCGTCCCTGCGCCGGG - Intronic
936126694 2:109794574-109794596 GCCGCCGCCGCCCCCCGGCCGGG - Intronic
936152200 2:110027971-110027993 GCCTCCCCTGCCCCAGGCCCTGG - Intergenic
936192478 2:110343442-110343464 GCCTCCCCTGCCCCAGGCCCTGG + Intergenic
936433186 2:112482014-112482036 GCCGCCGCCGCCCCCGGGGGAGG + Intergenic
937921604 2:127135409-127135431 GCCACACCTGCCACTGGGCCAGG + Intergenic
937993094 2:127674982-127675004 CCCACCCACGCCCCCGGGCCGGG - Intronic
938102095 2:128504316-128504338 ACCACCCCCGCCACCAGGCTAGG - Intergenic
938296593 2:130182797-130182819 GCCACCCCCGCCACTGGGGCAGG - Intronic
938302843 2:130228698-130228720 GACACCCGGGCCCCCGGGCCTGG - Intergenic
938453826 2:131445524-131445546 GACACCCGGGCCCCCGGGCCTGG + Intergenic
938460155 2:131491832-131491854 GCCACCCCCGCCACTGGGGCAGG + Intronic
939629634 2:144516843-144516865 GCCACCCCCGCCCCCGCCCCGGG + Intronic
940774989 2:157876020-157876042 GCCGCGCCGGCCCCAGGGCCGGG - Intergenic
940830066 2:158457035-158457057 GCCACCGCCGCCGCCGGGGGTGG + Intronic
940945681 2:159615552-159615574 GCCACCCCCACTCCCCGGCTTGG - Intronic
941808689 2:169734370-169734392 GACCGCCCCGCCCCGGGGCCAGG - Intronic
942044875 2:172094565-172094587 GCCCCCCCGCCCCCTGGGCCCGG - Intergenic
942970836 2:181956052-181956074 GCCACCCCTGCCCACAGGCCTGG + Intronic
945225874 2:207530479-207530501 CCCGCCGCCGCCGCCGGGCCGGG + Intronic
945875930 2:215278444-215278466 GCCACCACCGCGCCTGGCCCAGG - Intergenic
946188350 2:217994337-217994359 ACCTCCCCCACCCCCAGGCCTGG - Intronic
946431771 2:219630152-219630174 GCTCCCCCAGCCCCCGGGCCCGG + Exonic
947623443 2:231604960-231604982 GCCCCCGCCTGCCCCGGGCCAGG - Intergenic
948438141 2:237967448-237967470 GCCACGCTCGGCCCAGGGCCTGG - Intronic
948479228 2:238239878-238239900 GCCACCCGCGGCGCCTGGCCGGG - Exonic
948560408 2:238847915-238847937 GCCGCCCCCGCCCCCCGGCGCGG - Intergenic
948599859 2:239101867-239101889 GACACCCCCGGCCCCGGGTCTGG + Intronic
948640351 2:239372009-239372031 GCCACCCACGCGCCCTGCCCTGG - Intronic
948697311 2:239738204-239738226 CCCATCCCCGGCCCCGGCCCCGG + Intergenic
948824786 2:240568899-240568921 GCCTTCTCCGCCCCCGGGCCGGG + Exonic
948933805 2:241149650-241149672 GGCGCCTCCGCCCCCGGGCCGGG + Intronic
948934057 2:241150726-241150748 GCCGCTGCCGCCCCCGGGCCGGG - Intronic
1168769749 20:407944-407966 CCCGGCCCCGCCCCCGGCCCCGG + Intronic
1168769753 20:407950-407972 CCCGCCCCCGGCCCCGGCCCCGG + Intronic
1169074401 20:2752242-2752264 GCCACCCCGGGGCCCGAGCCGGG + Exonic
1169214716 20:3786490-3786512 GCGCCCCCCGCCCCGGGGCCCGG + Exonic
1169214733 20:3786517-3786539 GCCGCCGCCGCCCCGGGGCGGGG + Exonic
1169244539 20:4015385-4015407 GCGGCCGCCGCCCCCGGGCTGGG - Intronic
1169801440 20:9515942-9515964 ACAGCCCCCGCCCCGGGGCCGGG + Intronic
1171848202 20:30290581-30290603 GCCGGCCCCGCCCCCGGCCCCGG - Intergenic
1172007959 20:31830464-31830486 GCTATCCCCGCCCCCAGGCTGGG - Intronic
1172037307 20:32019117-32019139 GCCGCCGCCTCCCCCGGCCCGGG - Exonic
1172064131 20:32207494-32207516 CACACCCCCGACCCGGGGCCCGG - Intronic
1172095302 20:32457424-32457446 GCCGCCCCTTCCCCCAGGCCAGG + Intronic
1172100874 20:32483514-32483536 GCCACCCCCGCCCCCGGGCCGGG - Intronic
1172118598 20:32585138-32585160 GCCTCCTCCTCCCCCCGGCCGGG + Intronic
1172367850 20:34363529-34363551 CCCACCCCCACCGCCCGGCCCGG - Intronic
1172474495 20:35226783-35226805 GCCGCCGCCGCCGCCGGGCCAGG + Exonic
1172848684 20:37945066-37945088 GCCAAGTCCGCCCCAGGGCCTGG + Exonic
1173280657 20:41624193-41624215 TCCACTCCCACCCCCAGGCCTGG + Intergenic
1173664563 20:44755150-44755172 GCCTCCCCAGCCCCCTGGCCTGG + Intronic
1173733029 20:45341635-45341657 TCCACCCCCACCCCCAGACCTGG - Intronic
1173950374 20:46988200-46988222 CCCACCCCCGCCCCCCGCCATGG - Intronic
1174407742 20:50313014-50313036 GCCCTCCCCGGCCCCCGGCCTGG - Intergenic
1174485425 20:50858052-50858074 GCAACTCCAGCCCCTGGGCCAGG + Intronic
1175171700 20:57085514-57085536 GCCACCCCATCCCCCGCCCCAGG - Intergenic
1175394731 20:58650492-58650514 GCCCCCCCGTGCCCCGGGCCGGG - Intergenic
1175399668 20:58693136-58693158 ACCCCCGCCGCCGCCGGGCCGGG + Intronic
1175466121 20:59192154-59192176 GCGACCCCTGGCCCCGGGCCCGG - Exonic
1175517230 20:59577428-59577450 GCCGCCCCCGGCCCTGGTCCCGG + Intergenic
1175847198 20:62065281-62065303 GCCGGCCCCGGCCCCGGGCCCGG - Exonic
1175876590 20:62233054-62233076 GCCCCTCCCACCCCCGTGCCTGG + Intronic
1175877829 20:62238732-62238754 TCCAGCCCCGGCCCCGGCCCCGG + Intronic
1175889284 20:62309307-62309329 GCCAACCCCGGCCCCTGGTCAGG - Exonic
1175889910 20:62311433-62311455 GCAAGCCCAGACCCCGGGCCTGG - Exonic
1175901005 20:62359933-62359955 GCCGCCCCCACCCCCGTCCCAGG + Intronic
1175992576 20:62796907-62796929 CCCACCCCCACCCCCGCCCCGGG + Intronic
1176138266 20:63534508-63534530 GCCCCTCCTGCCCCCGTGCCAGG + Intronic
1176427437 21:6557544-6557566 GCCCTCCCTGCCCCCGGTCCAGG + Intergenic
1178076441 21:29017323-29017345 GCCACCACCGCACCTGGGCTGGG - Intronic
1178487398 21:33027671-33027693 GCCGCCCCCGCCCCCCAGCGGGG - Exonic
1178535109 21:33404020-33404042 CCCACCCGCGCGCCCGCGCCGGG + Intronic
1178890227 21:36514747-36514769 GCCACCCCCTCCTCAGGACCAGG - Intronic
1179149500 21:38797703-38797725 GCCAGCCAGGCCCCCGGGCCAGG + Intergenic
1179151425 21:38812009-38812031 CCCCTCCCCGCCCCCAGGCCAGG - Intronic
1179496968 21:41778209-41778231 GACACCCCCAACCCTGGGCCGGG - Intergenic
1179605613 21:42513733-42513755 GCGACCCCCGGCTCCGGCCCCGG - Intronic
1179628035 21:42659553-42659575 GCCACCCTTGCCCTCAGGCCTGG + Intronic
1179702928 21:43165861-43165883 GCCCTCCCTGCCCCCGGTCCAGG + Intergenic
1179783859 21:43719026-43719048 GCAGGCCCCGCCCCCGGGCTGGG - Intergenic
1179888608 21:44325057-44325079 GCCACTCCCTCTCCCAGGCCTGG + Intronic
1179955212 21:44734658-44734680 CCCACCCACCCCCCCGTGCCGGG + Intergenic
1180032988 21:45224671-45224693 GCCGCCCCCTGCCCCGGCCCAGG - Exonic
1180109860 21:45642846-45642868 GCGGCCCCAGCCTCCGGGCCGGG + Intergenic
1180201946 21:46229411-46229433 CCCGCCCCCACCCCCGGCCCCGG - Intergenic
1180609205 22:17084946-17084968 GCCCGGCCCGCCCCTGGGCCCGG + Exonic
1180707465 22:17818259-17818281 CCCACCGCCACCCCCGGGCGAGG - Exonic
1180796896 22:18610330-18610352 GACTCCCTCACCCCCGGGCCTGG - Exonic
1181026950 22:20132109-20132131 GCGACCGCTGCCCCCGTGCCCGG - Intronic
1181045004 22:20210323-20210345 GCCATCCCCAGCCCCAGGCCAGG + Intergenic
1181085160 22:20436482-20436504 GCGAGCCCCGCCTCCGGGGCGGG - Intronic
1181121669 22:20671202-20671224 GCCACCCCGGCCCGCGCCCCCGG + Intergenic
1181224828 22:21384941-21384963 GACTCCCTCACCCCCGGGCCTGG + Exonic
1181253804 22:21549872-21549894 GACTCCCTCACCCCCGGGCCTGG - Exonic
1181381505 22:22508388-22508410 GACGCCCCCACCCCCGGGCTGGG - Intronic
1182222884 22:28772791-28772813 GCCGCCCGCGTCCCCAGGCCCGG - Exonic
1182261115 22:29073414-29073436 GTCATCGACGCCCCCGGGCCCGG + Intronic
1182485322 22:30635620-30635642 CCAAGCCCCGCCCCCGGACCGGG - Intergenic
1182804351 22:33058009-33058031 GCGCCCCCGGCTCCCGGGCCCGG + Intronic
1183401763 22:37609014-37609036 GACACCGCCCCTCCCGGGCCGGG - Intronic
1183403950 22:37620752-37620774 GTCACCCCTACCCCTGGGCCTGG + Intronic
1183613517 22:38927312-38927334 GCAACCCCCCCCCCCGCCCCCGG - Intergenic
1183665571 22:39244125-39244147 GGCGCCGCCGCCCCCGGCCCCGG + Exonic
1184038172 22:41928398-41928420 GCTACCCCCTCCCCAGGGCCAGG + Intergenic
1184045185 22:41968899-41968921 CCCATCCCAGCCCCAGGGCCAGG + Intergenic
1184086833 22:42270465-42270487 GCCCGCCCCGCCGCCGGCCCGGG - Intronic
1184147339 22:42619319-42619341 CCCACTCCCGCCTCAGGGCCAGG - Exonic
1184361854 22:44023896-44023918 GGCTCCCCCTGCCCCGGGCCTGG + Intronic
1184386815 22:44181408-44181430 TCCACACCCCGCCCCGGGCCAGG - Intronic
1184411872 22:44330809-44330831 GCCACCCCAGCCCCGGGCGCGGG + Intergenic
1184465872 22:44668717-44668739 GCGGCCCCCTCCCCCGGCCCCGG + Intronic
1184587161 22:45455758-45455780 ACCACCCCCGCCCCCATGCAGGG + Intergenic
1184648266 22:45907873-45907895 GCCTGCCCCACCCCAGGGCCAGG - Intergenic
1184679422 22:46062082-46062104 GCACCTCCCGCCCCGGGGCCGGG + Intronic
1184743071 22:46440276-46440298 GACACTCCCGCCCCCGGACAGGG + Intronic
1184769348 22:46588619-46588641 GCCACCCCTGCCCCCCAGCCAGG - Intronic
1184796858 22:46737952-46737974 GCCGCCCCCGCTCCCTGGCCAGG + Intronic
1184885505 22:47342672-47342694 GCCACGCCATCCGCCGGGCCTGG + Intergenic
1185015201 22:48338868-48338890 GCCTCCCCCACCCCCGTGCTTGG - Intergenic
1185037935 22:48489464-48489486 GCCGCCGCCGCCGCCGCGCCCGG - Exonic
1185061283 22:48608100-48608122 GCCAGCCCCTCCCACGGCCCCGG + Intronic
1185079739 22:48702945-48702967 GCCTGCCCCGTCCCTGGGCCTGG - Intronic
1185322864 22:50209842-50209864 GCCACACCTGCCCCAGGGCCAGG - Intronic
1185336115 22:50271583-50271605 GCCATCCCCGGGCCCGCGCCAGG - Intergenic
1185342836 22:50299311-50299333 GCTTCCCCCGCCCCCGCACCGGG - Intronic
1185409418 22:50674367-50674389 GCCGCCCCCGCCCCCGGGGAAGG + Intergenic
1185409529 22:50674624-50674646 TCCATCCCCGCGCCGGGGCCCGG - Intergenic
950316311 3:12004656-12004678 GCCGCCGCCGCCCCCCGGTCCGG + Exonic
950345327 3:12287854-12287876 CCCGCGCCCGCCCCCGCGCCGGG + Intronic
950939933 3:16883361-16883383 GCCACCCCACGCCCCAGGCCTGG - Intronic
952287233 3:31981018-31981040 GCTTCCCCCGCCGCCGAGCCCGG + Exonic
953391507 3:42536372-42536394 GCCAGCCCCGGCCCTGGGCTCGG + Exonic
953705211 3:45225822-45225844 GCCGCCGCCTCCTCCGGGCCCGG + Exonic
953705222 3:45225835-45225857 GCCCCCCGAGCGCCCGGGCCCGG - Exonic
953901418 3:46846062-46846084 GCCTCCCCCGGCCCCGGCCCAGG + Intergenic
953908724 3:46881637-46881659 GCCAGCCCCGACCCCCGCCCAGG - Intronic
954137191 3:48587407-48587429 GCCTCCCCCTCACCCTGGCCAGG + Exonic
954152055 3:48662653-48662675 GCCTCCACCGCCCCCCGCCCCGG + Exonic
954156666 3:48688821-48688843 CCCACCCCCGCCCGGGGTCCAGG - Intronic
954291420 3:49652034-49652056 TCCACCCCAGCCCCCAGCCCGGG + Exonic
954367646 3:50154957-50154979 CCCAGCCCCACCCCCGGGGCGGG - Intergenic
954581798 3:51707004-51707026 CCCCGCCCCGCCCCCGGCCCCGG - Intergenic
954912598 3:54122085-54122107 GCCCGCTCCGCCCCTGGGCCGGG - Intergenic
955161482 3:56468460-56468482 GCCCCGCCCGGCCCCGCGCCTGG - Intergenic
955936741 3:64109574-64109596 CCCACCCCTGCCCCAGGGCTTGG - Intronic
958641533 3:96813497-96813519 GCGGCCCCCGCCCCAGGGCCGGG - Intergenic
960055538 3:113274141-113274163 GCCACCCCTGAGCCCTGGCCAGG + Intronic
960994593 3:123332532-123332554 GCCACCCCAACCCCCGGCTCAGG + Intronic
961236885 3:125375056-125375078 CCCCCGCCCTCCCCCGGGCCCGG + Intronic
961426286 3:126851134-126851156 GCCACCCAAGCCCACTGGCCTGG + Intronic
961446418 3:126983606-126983628 GCCTCCCCCGCCCCCCGGCCGGG + Intergenic
961792287 3:129384893-129384915 GCCCCCCCCGCCCCCCGCCGAGG + Intergenic
961827537 3:129606773-129606795 CCGACCCCGGCGCCCGGGCCCGG + Exonic
963049214 3:141127415-141127437 GCCAGCCCTGCCCTTGGGCCTGG + Intronic
963236741 3:142963701-142963723 GCCGCCGCCGCCCCCGGAGCGGG + Intergenic
966362834 3:179148537-179148559 GCCGCCGCCGCCCGCGGGGCTGG + Exonic
967493653 3:190120428-190120450 CCCGCCCCCGCCCCCCGGCGAGG - Exonic
968178173 3:196568994-196569016 GCTGCCCCAGCCCCCGGGGCCGG - Exonic
968319278 3:197750630-197750652 GCCACCTCCGGCCGCGGCCCCGG + Intronic
968479273 4:826397-826419 TCCACCCCCGCCCCCGCCCCGGG - Intergenic
968479316 4:826464-826486 TCCACCCCCGCCCCCGCCCCGGG - Intergenic
968479332 4:826488-826510 TCCACCCCCGCCCCCGCCCCCGG - Intergenic
968503367 4:961195-961217 GCCTCTCCCGCCCCAGGGCCAGG - Exonic
968503389 4:961257-961279 GCCTCTCCCGCCCCAGGGCCAGG - Intronic
968503411 4:961314-961336 GCCTCTCCCGCCCCAGGGCCAGG - Intronic
968503437 4:961376-961398 GCCTCTCCCGCCCCAGGGCCAGG - Intronic
968514907 4:1011839-1011861 CCGCCCCGCGCCCCCGGGCCCGG - Intronic
968516335 4:1017165-1017187 GCCACCCCCACCCCGTGGCCAGG + Intronic
968651899 4:1763489-1763511 GCCGCCCCGGCCCCGGGGCCGGG + Intergenic
968653196 4:1767942-1767964 TCCACCCCCACCCCAGGCCCCGG + Intergenic
968691769 4:1993946-1993968 GCCACCACCACGCCCGGCCCAGG + Intronic
968702986 4:2065422-2065444 ACCCCCCCCGCCCCCCGTCCAGG - Exonic
968850585 4:3075038-3075060 GCCCCCGCCGCCACCCGGCCCGG + Exonic
969209703 4:5677429-5677451 GCCACACCAGCCCCCAGGACAGG - Intronic
969285706 4:6200669-6200691 CCCGCCCCCGCCCCCGCCCCGGG + Intergenic
969344936 4:6564331-6564353 CCCACCCCCGCCCCCCCACCGGG + Intergenic
969451519 4:7276563-7276585 GCCTCCCCCGCTCCAGGCCCCGG + Intronic
969479961 4:7442136-7442158 TCCACCCCCTCCCCCAGCCCAGG + Intronic
969536251 4:7757621-7757643 CCCACCCCCGCCCCCTGTGCAGG + Intergenic
969538879 4:7773567-7773589 GCCACCACCGGCCCAGGCCCTGG - Intronic
969605713 4:8201390-8201412 TCCACCCCTTCCCCCGGGGCTGG + Intronic
969617462 4:8262050-8262072 GGCACCCCTGCCCGCAGGCCTGG - Intergenic
971121709 4:23711906-23711928 GGGACCCCCACCCCTGGGCCAGG + Intergenic
972089190 4:35258334-35258356 GCCACTGCCACCACCGGGCCAGG - Intergenic
972589396 4:40470214-40470236 GCTCCCCCCGCCCCCCAGCCTGG + Intronic
975778940 4:77819550-77819572 GCCCCCCGAGACCCCGGGCCCGG - Intronic
977666726 4:99652343-99652365 GCCAGCTCGGCCCCTGGGCCCGG - Exonic
977693799 4:99946303-99946325 GCCAGCCCCAGCCCCAGGCCCGG - Intronic
979785607 4:124712576-124712598 GCCGCCTCCTCCGCCGGGCCCGG + Exonic
980130369 4:128811627-128811649 GCAACCCCCCACCCCGGCCCGGG - Intronic
980923894 4:139115316-139115338 GCGACCCCGGCCCCCGGGCCGGG - Intronic
981128408 4:141132630-141132652 GCCGCCCCGGCCCCGGGGTCCGG + Exonic
981550340 4:145936838-145936860 TCCACTCCCGCCCCCAGCCCGGG + Intronic
983249284 4:165326891-165326913 CCCGCCCCCGCCCCCGCCCCCGG + Intergenic
983533417 4:168833066-168833088 GCCGGCCCCGCCCCGGGGCTGGG + Intronic
983537996 4:168878230-168878252 ACCACCGCCGCTCCCGAGCCCGG + Intronic
984803739 4:183735851-183735873 CCCCCCCCCTCCCCCCGGCCCGG + Intergenic
985012615 4:185599883-185599905 ACCTCCCCCGCCCCCAGGGCTGG - Intronic
985448351 4:190041052-190041074 TCCTCCCGCGCCCCCGGGGCTGG + Intergenic
985489814 5:172570-172592 CCCACCCCGGCCCCCGTTCCCGG - Intronic
985512714 5:321489-321511 GCGACCCCCGCCTCGGGGCACGG + Intronic
985537518 5:473418-473440 GCCCCTCCCGCCCCAGCGCCCGG - Intronic
985540488 5:485275-485297 GCCACCCCCTCTCCGGGGCCCGG + Intronic
986297116 5:6448804-6448826 GCCGCCGCCACCGCCGGGCCCGG - Exonic
986330588 5:6713857-6713879 GCCGCCGCCGCCACCGGCCCAGG + Intergenic
986748095 5:10761385-10761407 CCCGCCCCCGCCCCCGCCCCCGG - Intergenic
987317590 5:16738297-16738319 CCCACCCCTGCTCCCAGGCCTGG - Intronic
988965912 5:36417816-36417838 TCCACCCCCGCCCTCGCCCCAGG + Intergenic
989178880 5:38556715-38556737 CCCGCCCCTGCCCCCGGCCCCGG + Intronic
989408177 5:41085722-41085744 GGCACCCCCGCACCCCAGCCTGG - Intergenic
990175993 5:53109547-53109569 GGCGCCCCCGCCCCCGCCCCCGG - Exonic
990955047 5:61332402-61332424 GCGCCACCCGCCCGCGGGCCTGG - Exonic
991346234 5:65671637-65671659 CCCACCCCCACCCCCGCCCCCGG - Intronic
991351188 5:65722111-65722133 GCCAGCACCGCCCCTGGGGCGGG + Exonic
991676557 5:69094287-69094309 GCCGCCGCCGCCGCCGGGGCCGG - Exonic
991731549 5:69594301-69594323 CCCACCTCCGCCACCGTGCCCGG + Intronic
991807981 5:70449447-70449469 CCCACCTCCGCCACCGTGCCCGG + Intergenic
991863402 5:71033564-71033586 CCCACCTCCGCCACCGTGCCCGG - Intergenic
992732840 5:79689890-79689912 GCCATCGCCTCTCCCGGGCCTGG - Exonic
993603287 5:89955429-89955451 GCCACCCCCACCCCAAGTCCAGG + Intergenic
994107261 5:95961492-95961514 GCCGGCCCCGCACCCGGGCGCGG + Intronic
994367049 5:98928581-98928603 GCCTCCCCCGCGCCCAGGCCCGG + Exonic
995503695 5:112836171-112836193 CCCCCCCCCGCCACCGTGCCCGG + Intronic
996404174 5:123090170-123090192 GCCGCCGCCGCCCCCGCCCCCGG + Exonic
996978494 5:129461469-129461491 GCCGCCCCCGTCCCCGCCCCCGG + Exonic
997228606 5:132227657-132227679 GCGACCCCCGGCCCCGGATCCGG + Intronic
997457162 5:134025993-134026015 GCAACTCCCTCCCCCAGGCCAGG - Intergenic
997479744 5:134176474-134176496 GCCACCCCCGCCCTGGTCCCCGG + Intronic
998170297 5:139868709-139868731 TCCACCCCCTCCCCCGGGTGAGG - Intronic
999257499 5:150217730-150217752 GCCTCCCCCGTCCCTGGGCTAGG - Intronic
999461190 5:151758683-151758705 GCCTCCCTCGCGGCCGGGCCCGG - Exonic
999721828 5:154404202-154404224 GCCACCACCTTACCCGGGCCAGG - Exonic
999767810 5:154754817-154754839 GCCGCCCCCTCCCCTGTGCCCGG - Intronic
1000843991 5:166256733-166256755 ACTACCCCCGCCCCGAGGCCGGG + Intergenic
1001081004 5:168667399-168667421 GCCTCCCTGGCCCCTGGGCCAGG - Intronic
1001556508 5:172641058-172641080 GCCGCTCCCGCGCCCGGGCCGGG - Intergenic
1001616493 5:173047369-173047391 CCCACCCACAACCCCGGGCCTGG + Intergenic
1001617781 5:173056684-173056706 CCCTCCCCCACCCCCGGCCCGGG + Intronic
1001653187 5:173329562-173329584 GTCTCCCCCGCGCCGGGGCCGGG + Intergenic
1001823033 5:174724729-174724751 GCGCCCCCAGGCCCCGGGCCTGG - Exonic
1002021370 5:176366095-176366117 GACATCCCCACCCCCGGGCGGGG - Intronic
1002099762 5:176851595-176851617 GCCAGCCCCGCCCCCAGCCCAGG - Intronic
1002139955 5:177132649-177132671 CCCACCCCCGGCACCGAGCCGGG - Intergenic
1002189964 5:177473100-177473122 CCCACCCTACCCCCCGGGCCCGG - Exonic
1002193474 5:177490539-177490561 GCTACACCCGCCTCCGGGACTGG - Intronic
1002306043 5:178283956-178283978 GCCACCCCAGTGCCCAGGCCAGG + Intronic
1002405066 5:179024039-179024061 GCCACGCCCCCTCCGGGGCCGGG - Intronic
1003504413 6:6728045-6728067 GCCACCCCCCCCCCCACTCCAGG + Intergenic
1003871177 6:10404465-10404487 GCCCGCCCCGCCCCGCGGCCGGG - Intronic
1005926788 6:30451547-30451569 GCCAGCCGCGCCTCCGGTCCAGG + Intergenic
1006117116 6:31781350-31781372 CCCACACCAGCCCCCGGGTCAGG + Intronic
1006155197 6:32009924-32009946 GCCCACCCAGCCCCCGGCCCCGG + Intergenic
1006161503 6:32042658-32042680 GCCCACCCAGCCCCCGGCCCCGG + Intronic
1006402144 6:33823991-33824013 GCCACCTCCGGCGCCAGGCCAGG - Intergenic
1006582897 6:35086867-35086889 GCCCCTCCCACCCCCAGGCCAGG - Intronic
1006717546 6:36130307-36130329 GGCAGCCCCGACCCCGTGCCTGG + Exonic
1006860833 6:37170664-37170686 GCACCCCCCGCCTCCGGCCCGGG + Intronic
1006929647 6:37680120-37680142 CCCACCCCCGCCCCCGGGAGGGG - Intronic
1007421669 6:41723532-41723554 CGCACCCCAGCCCCAGGGCCGGG + Intronic
1007631436 6:43275431-43275453 CCCGCCCCCGCCCCGGGGCCAGG - Intronic
1007784077 6:44270509-44270531 GTGACACCCGCCCCCGGCCCCGG + Exonic
1007793305 6:44326539-44326561 GCCACCCCACACCCCTGGCCAGG - Intronic
1007830085 6:44631150-44631172 GCCAGCCCCACCCAGGGGCCAGG - Intergenic
1010422213 6:75688531-75688553 GCCACCCCACCCCCCCGTCCAGG + Intronic
1012399865 6:98834404-98834426 CCCTCCCCCTCCCCCGGGCTCGG - Intergenic
1013173219 6:107656061-107656083 GCCATCCCCACCTCTGGGCCTGG - Intronic
1013575697 6:111482524-111482546 GGCGCCCCCACCCCCGGGCAGGG - Intronic
1013619279 6:111872866-111872888 GCCGCCCCCGCCGCAGGGCCCGG - Intronic
1013793470 6:113859613-113859635 GCCATTCCCGCCCCCAGCCCTGG - Intronic
1013793681 6:113860421-113860443 GCCCCCTCCGCCGCCGGGCCCGG + Exonic
1014798329 6:125749680-125749702 GCCTCCTCCCTCCCCGGGCCTGG - Exonic
1015376137 6:132512807-132512829 GCTCCCCACGCCCCCCGGCCGGG - Intronic
1015976437 6:138795993-138796015 GCCCCTCCCGCCGCCGCGCCCGG - Intronic
1017163859 6:151390530-151390552 GCCACCCCCGCCCCCGGCGCCGG - Intronic
1017164105 6:151391354-151391376 GCCACCCCCAGCCCAGGGTCCGG - Intronic
1017672203 6:156778576-156778598 GCCGCCGCCGCCCCCGGGCACGG - Exonic
1017672554 6:156779731-156779753 TCCCCCCCCTCCCCCAGGCCCGG + Intronic
1017811653 6:157988159-157988181 GCCACCCCAACGCCCGGGCCTGG - Intronic
1017882583 6:158572167-158572189 GCCAGGCCCGTCCCAGGGCCAGG - Intronic
1018150287 6:160931186-160931208 CCCACCCGCGCCCCCGCCCCGGG - Intergenic
1018331055 6:162727770-162727792 GGCCTCCCCGCCCCCGCGCCCGG + Exonic
1018371003 6:163168386-163168408 GCAACCCCGGCCCCAGGGACAGG - Intronic
1018818202 6:167351382-167351404 CCCCCCCCCGCCCCCGGACCAGG - Intronic
1019477875 7:1252715-1252737 CCCACCCCCTCCCCCAGGGCAGG + Intergenic
1019478432 7:1255171-1255193 GCCAGCCCCGCCCCAGGGCAGGG - Intergenic
1019559402 7:1648453-1648475 GCCACCCCCCTCCCCGGGACAGG - Intergenic
1019562150 7:1664592-1664614 GCCACCCCCACCCCTGTCCCGGG + Intergenic
1019689649 7:2403563-2403585 GCCGGCCCCGCCCCCGGCGCAGG - Exonic
1019708855 7:2509368-2509390 GGGACCCCAGCCCCCAGGCCAGG + Intergenic
1019711486 7:2520024-2520046 GCCGCCGCCGCCCCCAGCCCGGG - Exonic
1020274592 7:6616369-6616391 GCCACCCCAGCTCCCGGGCAAGG - Intronic
1021240284 7:18192111-18192133 CACCCCCCCGCCCCCCGGCCGGG - Intronic
1021558371 7:21944773-21944795 GCCTCCCCTTCTCCCGGGCCAGG + Intronic
1021698829 7:23298655-23298677 CCCACCCCCCCACCCGTGCCAGG + Intergenic
1022106278 7:27199904-27199926 GAAGCCCCCGCCCCCGGCCCCGG + Exonic
1023016316 7:35971508-35971530 GCGGCCCTGGCCCCCGGGCCGGG - Intergenic
1023791678 7:43758331-43758353 GCCCCCCCCACGCCGGGGCCAGG + Intergenic
1024973748 7:55094350-55094372 GCCCCCCCTGCCCCCCGACCTGG - Intronic
1025829806 7:65038756-65038778 GCCACCTCCGCCCCGCGGCCTGG - Intergenic
1025917061 7:65873756-65873778 GCCACCTCCGCCCCGCGGCCTGG - Intronic
1025959231 7:66205644-66205666 TCCAACCCCGCCCCCGAGCGCGG + Intronic
1026471249 7:70695134-70695156 GCCACCCCTGCCCGCCGGCCCGG - Intronic
1026968596 7:74454708-74454730 GCCAGCCCCCTCCCCGGGGCCGG - Intronic
1027982981 7:85250279-85250301 GGCGCCCCCCCCCCCCGGCCTGG - Intergenic
1028193190 7:87875995-87876017 TCCGGCCCCGGCCCCGGGCCCGG + Intronic
1029118647 7:98251935-98251957 GCCGCCCCCGTCCCCTGCCCTGG - Intronic
1029479760 7:100805361-100805383 TCCACCTCCTCCCCCGGACCTGG - Intronic
1029592286 7:101515068-101515090 GCCAGCCCTGCCCACGGGGCAGG + Intronic
1029701213 7:102248219-102248241 ACCACCCACCCCTCCGGGCCTGG - Intronic
1030033527 7:105389118-105389140 CCCACCCCAGCCCGCGGCCCGGG + Intronic
1030820172 7:114084963-114084985 CCCTCCCCTGCCCGCGGGCCGGG - Intergenic
1031512440 7:122666967-122666989 GGCACCCCCTCCCCCAGGGCTGG - Intronic
1031604085 7:123748482-123748504 GCCAGCCCCGGCCCCGGCCCCGG - Intronic
1032020722 7:128405988-128406010 GCAGCCCCCGCCCCCGCCCCCGG - Intronic
1032074541 7:128830277-128830299 GCGGCCCCCACCCGCGGGCCGGG + Intergenic
1032174411 7:129611927-129611949 GCCGCCCCCGGCTCTGGGCCTGG + Intronic
1032359891 7:131245511-131245533 GCGCCCCCCGCCCCCGGCCTCGG + Intronic
1034222858 7:149459742-149459764 GTCAGCGCCGCGCCCGGGCCGGG + Intronic
1034284300 7:149874201-149874223 TCCACCCCGGCCCCCTGGCCCGG + Intronic
1034441218 7:151086863-151086885 GCCGCCGCCGCCCCCGGCCCCGG - Exonic
1034469548 7:151248123-151248145 CCCACCCCCACCCCCAGGGCAGG + Intronic
1034659972 7:152760193-152760215 GCCTCCCCCGCCCACGTGGCCGG + Intronic
1034830601 7:154304855-154304877 GCCACCTCTGCCCCCTGTCCAGG + Intronic
1034985892 7:155515294-155515316 GCCCCCCCCCCCCCCGGCCCCGG + Intronic
1035022756 7:155808878-155808900 GACGCCCCCGCCCCCGCGCTGGG - Intronic
1035032258 7:155869260-155869282 CCCACCCCCATCCCCAGGCCTGG - Intergenic
1035187676 7:157139083-157139105 GCCCCTCCCGCCCCAGGGCAGGG + Exonic
1035224788 7:157427094-157427116 GCCACCCTCGTTCCCGGGCCCGG + Intergenic
1035404393 7:158588139-158588161 GCGACCCCCAGCACCGGGCCGGG - Intergenic
1036201397 8:6773966-6773988 GCTCCCACCGCCCCCAGGCCTGG - Intergenic
1037273791 8:17156675-17156697 TCCGCCGCCGCCCGCGGGCCTGG - Exonic
1037473855 8:19237498-19237520 GCCACCTCAGCAGCCGGGCCGGG - Intergenic
1037828763 8:22176379-22176401 GGCACCCACGCCTCCGTGCCTGG - Intronic
1037857767 8:22383940-22383962 GTCACCCACTCCCCCAGGCCCGG + Intronic
1037899978 8:22682453-22682475 GCCACCTCTGCCCCCAGACCAGG + Intergenic
1038229771 8:25689095-25689117 CCCTCCCCCACCCCCGGCCCTGG - Intergenic
1038422737 8:27443802-27443824 CCCACCCCTCCCCGCGGGCCTGG + Intronic
1038807994 8:30812478-30812500 TCCCCACCCGCCCCCGGCCCCGG + Exonic
1038808000 8:30812484-30812506 CCCGCCCCCGGCCCCGGCCCGGG + Exonic
1039465946 8:37784879-37784901 CCCACCCCTGCCCCAGGCCCTGG - Intronic
1039791839 8:40882548-40882570 GCCACCCCAGCCCCCTGGCCTGG + Intronic
1040038997 8:42897298-42897320 GCCCCGCCCGCCCCAGGCCCCGG - Intronic
1041107579 8:54458062-54458084 CCCACCCCCTCCCCCGGGTCGGG + Exonic
1042399658 8:68331109-68331131 GCCACCCACGCCCGCGGCCGGGG + Exonic
1042916332 8:73878911-73878933 GCAGACCCCGCCCCCGCGCCCGG - Intergenic
1043067418 8:75592574-75592596 GGCACCCCCACCGCCAGGCCCGG + Intergenic
1044591426 8:93917234-93917256 GCCACGCCCGCCCCACAGCCCGG - Intronic
1045294268 8:100860265-100860287 GCCGCCCCTGCCCCCGTGCCTGG - Intergenic
1045489096 8:102655758-102655780 CCCACCCCCGCCCGCGGCGCGGG - Exonic
1047933356 8:129751752-129751774 GCCACCACCGCCCTAGGGCCTGG - Intronic
1048073171 8:131041615-131041637 GCCACCCCCGGCCCGGTTCCGGG - Exonic
1048291163 8:133182866-133182888 CCCACCCCAACCCCCGGCCCAGG + Intergenic
1048484159 8:134831981-134832003 CCGACCCCCGACCCCGGGCCAGG - Intergenic
1049082926 8:140457218-140457240 GAGCCCCCCGCCCCTGGGCCTGG - Intronic
1049145883 8:141000952-141000974 CCCTCCCGCGCCCCCGGCCCGGG - Intronic
1049145968 8:141001233-141001255 GCCGCCGCCGCCGCCGGTCCCGG - Intronic
1049405278 8:142449611-142449633 GCCCCCCCCCCCCCCTCGCCAGG + Exonic
1049461009 8:142727864-142727886 GCGGCCCCCGCCCCTGGCCCCGG + Intronic
1049468184 8:142763034-142763056 TCCACCCCCGCCCCCCCACCTGG - Intergenic
1049474547 8:142790624-142790646 TCCATCCCCGGCCCCTGGCCCGG - Intergenic
1049532142 8:143160065-143160087 CCCACCCCCACCCCTGGGCTGGG + Intronic
1049565290 8:143334932-143334954 GCCAGCCCCGCCCCCGAGCGCGG + Intronic
1049583837 8:143424060-143424082 GCCATCCCTGGCCCAGGGCCTGG - Intronic
1049597584 8:143491846-143491868 GACACCCTCGGCCCTGGGCCTGG + Intronic
1049599724 8:143501785-143501807 AACACCCGCGCCCCGGGGCCGGG - Intronic
1049708223 8:144052430-144052452 GCCCACCCCGCCCCCGCACCTGG + Exonic
1049761450 8:144333725-144333747 GCCGCCCCGGCCCCCCGGCCCGG + Exonic
1049765706 8:144354365-144354387 GCCACCCCCGGCTGCGGGCAGGG - Intronic
1049843756 8:144790002-144790024 ACCACCCCCGCCCCCGGCCTCGG + Intronic
1051287240 9:15510281-15510303 TCCTCCCCCGCCCGCGGGCCCGG - Exonic
1052347183 9:27421550-27421572 GTAACCCCCGCCCCCCGGCCTGG - Intronic
1053149130 9:35732005-35732027 GGCCCGCCCGCCCCGGGGCCAGG + Intronic
1053435208 9:38069399-38069421 GCCCCCCTCGCGCCCGGGGCCGG + Intergenic
1054930365 9:70629208-70629230 GCCCCCCCCCCCCCCGGCACTGG - Intronic
1054938679 9:70716109-70716131 GCCACCCCCTTCCTCGGGACAGG - Intronic
1054940370 9:70734102-70734124 GCCACCCCCTTCCTCGGGACAGG - Intronic
1056170365 9:83979788-83979810 TCCAGCTCCGACCCCGGGCCGGG + Intronic
1056170673 9:83981094-83981116 GCCAGCTGCGCCCCCGGGCCCGG - Intronic
1056182768 9:84102015-84102037 GCTCCCCCCGCCCCTGTGCCGGG + Intergenic
1056748774 9:89329400-89329422 GCCACCCACGCCACTGTGCCCGG + Intronic
1057259567 9:93576361-93576383 GCCGCCTCCGCCCGCCGGCCTGG - Intergenic
1057700784 9:97361930-97361952 GCCACCCCTGCCCCTGGCCCTGG + Intronic
1057757178 9:97847945-97847967 GCCCCCCCACCCCCCGGGCCTGG - Intergenic
1058699127 9:107586608-107586630 GCCACCCCCCAACCCAGGCCTGG - Intergenic
1059102301 9:111483218-111483240 GGCTCCCCCGACCCCGGGCCAGG + Intronic
1059145672 9:111897112-111897134 GCCTCCCGCGCCCCCGCACCGGG + Exonic
1059375401 9:113876646-113876668 GCCCCCTCCGGCCCCGGGCTCGG + Intronic
1059414889 9:114156260-114156282 CCCACCCCCGACCCCCGGGCTGG - Intronic
1060269106 9:122128586-122128608 GTCACCCCCAGCACCGGGCCAGG + Intergenic
1060477942 9:123999675-123999697 GCCGCCCCCGCCCCCGCCCCCGG + Intergenic
1060550521 9:124482734-124482756 CCCGGCCCCGCCCCCGGCCCAGG + Exonic
1060798108 9:126526386-126526408 GCCACCCCTGCCGCCTGACCCGG + Intergenic
1060880140 9:127112335-127112357 GCCGCCCCCGACCCTGGGCTAGG + Intronic
1060946087 9:127569758-127569780 GGCACCCCCGCCCCAGTGCCAGG + Intronic
1061415453 9:130444852-130444874 ACAGACCCCGCCCCCGGGCCCGG - Intergenic
1061449487 9:130660679-130660701 CCCTCCCCCGCACCCAGGCCCGG + Intergenic
1061458061 9:130713229-130713251 GACACCCCCTCCCCCGGCCCCGG - Intergenic
1061580219 9:131531562-131531584 CCCCCGGCCGCCCCCGGGCCTGG + Intergenic
1061923711 9:133795845-133795867 GCCACCCCCACCCGCCAGCCAGG + Intronic
1062032584 9:134368357-134368379 GCCACCCACTCCCCTGGGGCTGG + Intronic
1062196381 9:135276475-135276497 CCCACCACAGCCCCTGGGCCAGG + Intergenic
1062340200 9:136090774-136090796 GCCACCCCCAGCCCAGGGCCGGG + Intronic
1062341278 9:136094923-136094945 GGCGCCCGCGACCCCGGGCCGGG - Intronic
1062375999 9:136262194-136262216 GCCACCCCGGCCCCTGAGCCAGG + Intergenic
1062389346 9:136327780-136327802 CCCAGCCCCGGCCCCGGCCCCGG - Intronic
1062425268 9:136503372-136503394 TCCTCCCCCGCCCACCGGCCAGG + Intronic
1062472923 9:136714067-136714089 CCCACCCTGGCTCCCGGGCCTGG - Intronic
1062524933 9:136974398-136974420 GCCCCCACCGCACCCGGCCCTGG + Intergenic
1062537014 9:137025485-137025507 GCCGCCCCCACCCCAGGGACCGG - Intronic
1062559607 9:137135358-137135380 TCCACCCCCCCCCCCGCCCCCGG - Intergenic
1062562650 9:137148536-137148558 GCCACCCACTCGCCGGGGCCGGG + Intronic
1062658313 9:137615283-137615305 GCCACCCCCACCCCAGCCCCAGG - Exonic
1186466237 X:9786349-9786371 GCCAGCCCCGGCCCCGGCCCCGG + Intergenic
1186670020 X:11758409-11758431 CCCGCCCCCGCCCCCGGTCCCGG - Intronic
1186670025 X:11758415-11758437 TCCGCCCCCGCCCCCGCCCCCGG - Intronic
1186747355 X:12583617-12583639 GGCGGCCCCGCCCCCGGCCCTGG + Intronic
1187341370 X:18425038-18425060 CCCACCCCAGCCCCCGGCACGGG + Intergenic
1190024805 X:46912980-46913002 TCCGCCCCCGCCCCCCGCCCGGG - Intronic
1190277999 X:48911590-48911612 TCCACCGCGGCGCCCGGGCCAGG - Exonic
1190287302 X:48970178-48970200 GCAACCCCTGCCCCCGGCACCGG - Exonic
1190732574 X:53235004-53235026 GCCACCACCGCCAACAGGCCAGG - Exonic
1190881537 X:54495648-54495670 GCCACCGCCGCTGCCGTGCCAGG + Exonic
1191717984 X:64205946-64205968 CCCACTCCCGCCCCCACGCCGGG + Intergenic
1191907402 X:66108095-66108117 GGGACCCCCCACCCCGGGCCAGG + Intergenic
1192147887 X:68693983-68694005 GCCACCCCCGCCCCTGGGATTGG + Intronic
1192149419 X:68702972-68702994 GCCACCACCGCCCCTGGTCCTGG - Intronic
1192447952 X:71224506-71224528 GCCAGCCCAGCCCCGGTGCCAGG - Exonic
1195107822 X:101617457-101617479 GCCACCCCCACCCATGGTCCTGG + Intronic
1195668339 X:107449865-107449887 GGCACCCGTGCCCCCGAGCCCGG - Intergenic
1198518465 X:137430021-137430043 CCCACCCCATCCCCTGGGCCAGG - Intergenic
1198748819 X:139918544-139918566 CCCACCCCCACCCCCGCCCCGGG - Intronic
1199854665 X:151750708-151750730 GCCACTCCCGCCCTCGTGCAGGG + Intergenic
1200002132 X:153067514-153067536 GGCCCCCCCGACCCCGGGGCTGG - Intergenic
1200005601 X:153082511-153082533 GGCCCCCCCGACCCCGGGGCTGG + Intergenic
1200086882 X:153611416-153611438 ACCCCCCACCCCCCCGGGCCGGG + Intergenic
1200100747 X:153688280-153688302 GCCGCCGCCGCCGCCCGGCCGGG + Exonic
1200155580 X:153972934-153972956 GCCGCCGCCGCCGCCGCGCCCGG - Intronic
1201161998 Y:11173483-11173505 CCCACCCCCTCCCCCGACCCCGG - Intergenic
1201959367 Y:19661665-19661687 CCCCCCCCCGCCCCCCGCCCCGG - Intergenic