ID: 1172100875

View in Genome Browser
Species Human (GRCh38)
Location 20:32483515-32483537
Sequence GGCCACCCCCGCCCCCGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 5, 3: 62, 4: 509}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172100875_1172100882 -7 Left 1172100875 20:32483515-32483537 CCGGCCCGGGGGCGGGGGTGGCC 0: 1
1: 0
2: 5
3: 62
4: 509
Right 1172100882 20:32483531-32483553 GGTGGCCAGGAGGAGGGCCCAGG 0: 1
1: 0
2: 7
3: 112
4: 720
1172100875_1172100891 26 Left 1172100875 20:32483515-32483537 CCGGCCCGGGGGCGGGGGTGGCC 0: 1
1: 0
2: 5
3: 62
4: 509
Right 1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG 0: 1
1: 10
2: 192
3: 494
4: 1380
1172100875_1172100884 3 Left 1172100875 20:32483515-32483537 CCGGCCCGGGGGCGGGGGTGGCC 0: 1
1: 0
2: 5
3: 62
4: 509
Right 1172100884 20:32483541-32483563 AGGAGGGCCCAGGCGAGCAGCGG 0: 1
1: 0
2: 6
3: 38
4: 421
1172100875_1172100889 15 Left 1172100875 20:32483515-32483537 CCGGCCCGGGGGCGGGGGTGGCC 0: 1
1: 0
2: 5
3: 62
4: 509
Right 1172100889 20:32483553-32483575 GCGAGCAGCGGCGGCAGCGGCGG 0: 1
1: 0
2: 34
3: 247
4: 1279
1172100875_1172100890 18 Left 1172100875 20:32483515-32483537 CCGGCCCGGGGGCGGGGGTGGCC 0: 1
1: 0
2: 5
3: 62
4: 509
Right 1172100890 20:32483556-32483578 AGCAGCGGCGGCAGCGGCGGCGG 0: 4
1: 55
2: 385
3: 2044
4: 3495
1172100875_1172100888 12 Left 1172100875 20:32483515-32483537 CCGGCCCGGGGGCGGGGGTGGCC 0: 1
1: 0
2: 5
3: 62
4: 509
Right 1172100888 20:32483550-32483572 CAGGCGAGCAGCGGCGGCAGCGG 0: 1
1: 0
2: 2
3: 34
4: 384
1172100875_1172100885 6 Left 1172100875 20:32483515-32483537 CCGGCCCGGGGGCGGGGGTGGCC 0: 1
1: 0
2: 5
3: 62
4: 509
Right 1172100885 20:32483544-32483566 AGGGCCCAGGCGAGCAGCGGCGG 0: 1
1: 0
2: 1
3: 35
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172100875 Original CRISPR GGCCACCCCCGCCCCCGGGC CGG (reversed) Intronic
900151488 1:1180982-1181004 GGCCACCCAGGCTCCCAGGCTGG + Intronic
900182981 1:1320584-1320606 GGCCACCCATGCCCCAGGGAGGG + Intronic
900191889 1:1355576-1355598 GGCCACCCCCGGGGCCGCGCAGG + Exonic
900226637 1:1536194-1536216 GGCCTCCGCGGCCCCGGGGCGGG - Intronic
900341904 1:2193609-2193631 GGCCACCCCTGCGCCCGGCCCGG - Intronic
900627141 1:3613535-3613557 CTCCACCCCCGTCCCAGGGCCGG - Intergenic
900646227 1:3709957-3709979 TGCCACCCCCACCCCCTGCCAGG + Intronic
901019130 1:6247063-6247085 GGCAACCCCTGCCCCAGGGTTGG - Intergenic
901045515 1:6393481-6393503 CGCCGACCCCGCCCCCGCGCCGG + Intronic
901054168 1:6440870-6440892 TGGGACCCCCGCGCCCGGGCAGG - Intronic
901169422 1:7245969-7245991 AGCGACCCCCTCCACCGGGCAGG + Intronic
901467072 1:9429062-9429084 CGCCAGCCCCGCCCCCGAGGCGG + Intergenic
902044135 1:13512891-13512913 GGCCACCCCAGACCCCAGTCTGG - Intronic
902349966 1:15847389-15847411 GGCAACCCCAGGCCCCGGCCTGG - Intergenic
902480141 1:16707461-16707483 TGGGACCCCCGCGCCCGGGCAGG + Intergenic
902514051 1:16980504-16980526 TGGCACCCTCGCCCCCGCGCCGG + Intronic
902938303 1:19780663-19780685 AGCCACACCTGCCCACGGGCCGG - Exonic
903012818 1:20343173-20343195 CGCCACCCCGGCCCCGGTGCTGG + Exonic
903186899 1:21634052-21634074 GCCCCCCCCCCCCCCCGGGAGGG - Intronic
903186900 1:21634053-21634075 GGCCCCCCCCCCCCCCCGGGAGG - Intronic
903228316 1:21906429-21906451 GGCTCCCCCTGCCCCCAGGCTGG + Intronic
903961224 1:27059056-27059078 GGACACCCCCTCCCCCAGGCTGG + Intergenic
904014047 1:27406808-27406830 GGCACCCCCCACCCCCAGGCAGG + Exonic
904181308 1:28668736-28668758 CGCCACCGCCGCCGCCAGGCCGG - Intronic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
904822750 1:33256247-33256269 GCCCGCCCCCGCCCCCCGCCCGG + Intergenic
905037951 1:34929706-34929728 CCCCGCCCCCGCCCCCGCGCAGG + Intergenic
905369217 1:37474456-37474478 AGGCAGCCCCGCCCCCGGGGCGG + Intergenic
905442699 1:38005297-38005319 GTCCGCCCCCGCGCCCAGGCCGG - Intronic
905445983 1:38028783-38028805 GACCACCCCAGCCCCCCGCCAGG + Intergenic
907248672 1:53123567-53123589 AGCTACCCCCACCCCCGGGTTGG - Intronic
907324127 1:53625856-53625878 GGCCACCTGCGCCCCTGTGCTGG - Intronic
907451722 1:54549696-54549718 GGCCACACCCGTCCCCGTGCTGG - Intronic
908703937 1:66930437-66930459 GGGCGCCCCCGGCCCTGGGCCGG + Intronic
912716807 1:111989310-111989332 GGGAACCGACGCCCCCGGGCCGG + Intergenic
912798618 1:112707220-112707242 GGCCCGCCCCGGCCCCGCGCAGG + Intronic
915525258 1:156472193-156472215 GGCCACCCCACCCTCAGGGCTGG + Intronic
915552241 1:156642026-156642048 GGCCGCCCCCGCCCCCTGGTCGG - Exonic
916091410 1:161310182-161310204 GGCCTCCCCCTGCCCCAGGCTGG + Intergenic
917846726 1:179026127-179026149 CGCGACCCCCGCCCCCGGCGCGG + Intronic
919097819 1:193059087-193059109 GGCCACCGCCGCCCCGCGTCTGG - Intronic
919640394 1:200039875-200039897 GGCTACTCCCGCGCCCGCGCGGG - Intronic
920051030 1:203165278-203165300 GGCCACCGCCGCCCTCCGGGGGG - Exonic
920367719 1:205456896-205456918 GGGCACGCCGGCCCCGGGGCTGG - Intergenic
921175038 1:212586054-212586076 GACCTCCCCTGCCCACGGGCAGG - Intronic
921923409 1:220691916-220691938 GGCTCCCCCCGCCCCCGGGGGGG + Intronic
923400779 1:233614078-233614100 CGCCGCCCCCGCCCCCGCCCGGG - Exonic
923520131 1:234728868-234728890 CGCCCCCCCCGCCCCCGTGCAGG - Intergenic
923684192 1:236142590-236142612 GGCCGCCGCCGCCCCCGCGGGGG - Exonic
924560382 1:245153772-245153794 GCCCTCGCCCACCCCCGGGCTGG + Intergenic
1062799648 10:369593-369615 GGACACCCCGGCCCGGGGGCTGG + Exonic
1064060024 10:12129592-12129614 GCCCAGCCCCGCCCCCAGGGCGG - Intergenic
1066221149 10:33336643-33336665 GGGCAGCCCTGCGCCCGGGCAGG + Intergenic
1066402640 10:35090462-35090484 GGCCGCCGCCGCTCCCCGGCGGG + Intronic
1067686109 10:48466758-48466780 GGCCAGCGCCGCCCCAGGCCCGG + Intronic
1067731977 10:48819128-48819150 GGCCAGACCCTCCCCTGGGCAGG - Intronic
1067923188 10:50480766-50480788 GGCTGCCCCCGCCCCCCGACAGG - Intronic
1069761812 10:70816247-70816269 GCCCGCCCCCGCCCCCGCCCCGG - Intronic
1070333099 10:75431764-75431786 GGCCAGCCCCGCCTCCGCCCGGG + Intronic
1071847506 10:89535644-89535666 TGCCACACCCGCCCCCAGCCCGG + Intronic
1073800721 10:107038670-107038692 GCCCACCCCCAACCCTGGGCAGG + Intronic
1074116040 10:110458105-110458127 GGCCTGCCCCTCCCTCGGGCTGG + Intergenic
1074116481 10:110460567-110460589 TGCCACCCTCGCCCCCTGGCAGG + Intergenic
1074897657 10:117791150-117791172 GTCCACCCACACCCCCTGGCAGG - Intergenic
1075699803 10:124461963-124461985 GGCCACCGCCTCCACCGAGCCGG - Exonic
1075719577 10:124576839-124576861 GCCCACCCACGGGCCCGGGCTGG - Intronic
1076196613 10:128523097-128523119 CGCCACCCCCGCCCCCACACAGG + Intergenic
1076597292 10:131631935-131631957 GGCCACCACAGCCACCTGGCAGG - Intergenic
1076685252 10:132195735-132195757 GGCTCCACCAGCCCCCGGGCAGG - Intronic
1076746734 10:132518292-132518314 GGCCCCGCCCTCCCCTGGGCCGG + Intergenic
1076817066 10:132920259-132920281 GGCCACCCCGGCGCCGGCGCAGG - Intronic
1076849567 10:133086384-133086406 GGCCACTCCCCCCACCGGCCGGG + Intronic
1077108585 11:852487-852509 GGCCCCCCCCAACCCTGGGCTGG + Intronic
1077191443 11:1257440-1257462 AGCCACCCCCTCCCTCGGGCTGG - Intronic
1077214811 11:1390830-1390852 GGCCACCGGGGCCTCCGGGCAGG + Intronic
1077514241 11:2992150-2992172 GGCCGCCGCCGCGCCCGCGCCGG + Intronic
1078014114 11:7597775-7597797 AGCCAATCCCGCCCCCAGGCAGG - Intronic
1078132080 11:8621276-8621298 GGCCACCCAGGCCCCAGGTCTGG - Exonic
1079128987 11:17736626-17736648 GTCCACCCCTGCCCGCGGGGAGG - Intronic
1079251680 11:18791841-18791863 GCTCCGCCCCGCCCCCGGGCGGG + Exonic
1080596001 11:33774609-33774631 GGCCAGCCCCGCCCTCAGGGTGG + Intergenic
1081700063 11:45147045-45147067 GGCCGCCCCCCACCCCGCGCCGG - Intronic
1081873103 11:46392022-46392044 GGACACCCCCACCCCCCGGAGGG - Intergenic
1082833871 11:57638525-57638547 CGCCAGCCCCTCTCCCGGGCCGG - Intergenic
1083340323 11:61955089-61955111 CCCCACCCCCACCCCCAGGCTGG + Exonic
1083644795 11:64165909-64165931 GTCCCCCCGCGCCCCCGGCCCGG - Exonic
1083659750 11:64246616-64246638 GGCGGCCCCGGCCCCCGGGCCGG - Exonic
1083869372 11:65477501-65477523 TGCCTCCCCTGCCCCCGCGCCGG - Intergenic
1083965738 11:66042677-66042699 GGCCGGCGCCGCCGCCGGGCAGG + Exonic
1083967523 11:66051839-66051861 GCCCACCCCCGGCCCAGGCCCGG - Intronic
1084125255 11:67095092-67095114 CCCCACCCCCGCCCCCTGGCGGG - Intergenic
1084190243 11:67495392-67495414 GGCCTCCCCCACCCCCAGGCTGG + Intronic
1084192106 11:67504027-67504049 CGCCAGCCCTGCCCCGGGGCTGG - Intronic
1084219451 11:67668202-67668224 TGCCACCCCCTCCCCAGAGCAGG - Intronic
1084376413 11:68781075-68781097 GGCCAGCCCCGCCCCCTGCAGGG - Intronic
1084395032 11:68903936-68903958 GGCCATCGCCGCCGCCGGCCTGG - Exonic
1085016492 11:73177483-73177505 GTCCACCCCAGCCCAGGGGCTGG + Intergenic
1089046103 11:115503557-115503579 GGCCGCCCCCCCCGCGGGGCCGG + Intronic
1089353275 11:117833499-117833521 GGCCAGCCCAGCCCCGGGCCTGG - Intronic
1089622467 11:119729537-119729559 CTCCACCGCCGCCCCCGGCCCGG - Intergenic
1090829113 11:130408691-130408713 CCACACCCCCGCCCCCCGGCAGG - Intronic
1091154476 11:133360988-133361010 GGGCAGCCCCGCAGCCGGGCGGG - Intronic
1091730532 12:2877094-2877116 CCCCACCCCCGGCCCCGGCCCGG - Intronic
1091997085 12:5002162-5002184 GGCCACCCCCTCTGCAGGGCAGG + Intergenic
1092057166 12:5516975-5516997 AGCCACCCCCGCCCCCTTCCCGG - Intronic
1092172861 12:6384373-6384395 GGCCACCTCTGCCCCCGGCCTGG + Exonic
1093464846 12:19439376-19439398 GCCCGCCCCCGCCCCCGCCCCGG - Intronic
1094719937 12:33052919-33052941 GCTCACCGCCGCCGCCGGGCAGG + Intergenic
1095098500 12:38160215-38160237 GGCCACCCCTGCGCCGGGCCAGG + Intergenic
1096102492 12:48978269-48978291 GCTCACCCCCGCCCCCTGCCCGG - Intergenic
1096225041 12:49861191-49861213 GGCCAGCCCCCCCACCCGGCTGG + Intergenic
1096241297 12:49961680-49961702 CGCGACCCCCGCCCCCCGGCCGG - Intergenic
1096466100 12:51848442-51848464 GGCCCTCTCCGGCCCCGGGCCGG + Intergenic
1096466157 12:51848591-51848613 CGCCGCCCCGGTCCCCGGGCCGG - Intergenic
1096556301 12:52406142-52406164 GGCCCCTACCACCCCCGGGCCGG + Exonic
1096691697 12:53325571-53325593 CGCCACTCCCGCCCCCGCCCAGG - Intergenic
1096695318 12:53344989-53345011 CGCCGCCCCCTCCCCCGGGCTGG - Intronic
1096766832 12:53898055-53898077 TCCCACCCCCACCCCCTGGCAGG + Intergenic
1097678983 12:62631900-62631922 CTACACCCCCGCCCCCGCGCTGG - Intergenic
1099989556 12:89708556-89708578 CGCCGCCCCCGGCCGCGGGCGGG + Intronic
1100260523 12:92928879-92928901 CGCCCTCCCCGCCCCCGGGCCGG + Intronic
1102472607 12:113168079-113168101 GGCCGCCCCCCACCCCGGCCAGG + Intronic
1103309022 12:119989689-119989711 GGCCCGCCCCTCCCCCGCGCCGG - Intergenic
1103415178 12:120738481-120738503 GGCCAGGCCCGCGCCCCGGCTGG + Intronic
1104311139 12:127655245-127655267 GGCAACCCCCTCCCCACGGCTGG + Intergenic
1104844053 12:131838102-131838124 GGCCACCACTGCTTCCGGGCAGG - Intronic
1104866855 12:131961035-131961057 GGCCTGCCCCGGCCCCGGACTGG - Exonic
1104885405 12:132104403-132104425 GGCCTGCCCCGGCCCCGGACTGG - Exonic
1106269377 13:28138744-28138766 GGACACCCCCGACCCCCGGCGGG - Exonic
1106776678 13:33016333-33016355 GCCCACCCCCGCTCCCCGGCGGG - Intergenic
1109537120 13:63737487-63737509 GGCCCCCCCCGCCGCGAGGCGGG - Intergenic
1112693141 13:101917631-101917653 CGCCACCCCCAACCCCGGGTTGG + Intronic
1113909370 13:113834930-113834952 ACCCACCCCCGCTGCCGGGCCGG + Intronic
1113910989 13:113841159-113841181 GGGCACCCCTGACCCCGGCCAGG - Intronic
1113924320 13:113931915-113931937 GGACATCCCCTCCCCCAGGCTGG + Intergenic
1114265351 14:21070168-21070190 GCCCGCCCCCGCCTCCGCGCGGG - Intronic
1114270707 14:21098426-21098448 CGGCCCCCCCGCCCCCGGCCCGG + Exonic
1117805370 14:59484715-59484737 GACCCCGCCCGCCCTCGGGCCGG + Exonic
1121398840 14:93653753-93653775 GGCCACCCCCGCCGCATTGCCGG - Exonic
1121473465 14:94174291-94174313 GGCCCGCCCCGCCCCCTCGCCGG + Exonic
1121608572 14:95259641-95259663 GCCCACCCCCACCCCCAGGTGGG + Intronic
1122790761 14:104183235-104183257 GGCCGCCCCAGCTCCTGGGCTGG - Intergenic
1122826874 14:104374845-104374867 GGCCAGCACAGCCCCAGGGCCGG - Intergenic
1122899832 14:104777833-104777855 GGCCACCCTCCCCACCAGGCTGG - Intronic
1122978681 14:105181487-105181509 GTCGACCCCGGCCGCCGGGCGGG + Intergenic
1123040126 14:105487028-105487050 GTCCACCCCCGCCTTCAGGCAGG - Intergenic
1123949243 15:25253877-25253899 GGGCACCCCCGTCACCGTGCAGG - Intergenic
1123964311 15:25439353-25439375 GGGCACCCCCCCCCCCAGGAGGG + Intergenic
1124109467 15:26772977-26772999 GGGCGCCCCCTCCCCCGTGCCGG - Exonic
1125746962 15:42003841-42003863 GGCAACCCCCGCCTCAGGCCGGG - Intronic
1126940414 15:53759777-53759799 GGCCCCAGCCGCCCGCGGGCGGG + Intronic
1127286465 15:57538010-57538032 GCCACCCCCCGCCCCAGGGCAGG + Intronic
1127861514 15:62997862-62997884 GACCACCCCCACCCCCAGGAGGG + Intergenic
1129006300 15:72376228-72376250 GGCCACCCCTGCGGCCGTGCCGG + Exonic
1129092657 15:73167460-73167482 GGCCTCCCCCGCCCCCAGCATGG - Intronic
1129323403 15:74787108-74787130 GGCCACCCCCAACGCCCGGCAGG + Intronic
1129377818 15:75145263-75145285 GGCCACCCCCTTCCCCCTGCAGG - Intergenic
1129483027 15:75843129-75843151 GCGCGCCCCCGCCCCCGGCCTGG - Intergenic
1129666452 15:77582144-77582166 GACCACCCCCGCCCCCGCCATGG + Intergenic
1130321190 15:82843412-82843434 GTCCACCCTGGCCCCCAGGCTGG - Intronic
1131009106 15:89002698-89002720 GGCCACCCCCTGACCCCGGCAGG + Intergenic
1131846557 15:96495248-96495270 GGCCACCCTCTCCCCCAGCCAGG - Intergenic
1132575240 16:661000-661022 GCCCCCCCCCCCCCCCGGCCCGG + Intronic
1132603485 16:784103-784125 GGCCTCCCCTCCCCCAGGGCTGG - Intergenic
1132683951 16:1154440-1154462 GGCCTCCCCCTCCCCCGCGAGGG - Intronic
1132828897 16:1918143-1918165 GGCCGCCCGCGCCCCCGCGCCGG - Exonic
1132831302 16:1929707-1929729 GGCCACGCCCGCCCTTGGGCCGG - Intergenic
1132851657 16:2027386-2027408 GCCCCCCCCCACCCCCGTGCAGG - Intronic
1132880960 16:2161506-2161528 GGCCACCTGGGCCCCCGGGCAGG + Intronic
1132939466 16:2499698-2499720 TCCCACCCCCACCCCAGGGCAGG - Intronic
1132987812 16:2777184-2777206 GCCCCCCGCCGCCCCCGGCCCGG + Intronic
1133175500 16:4011146-4011168 AGCCACCCCCGCCCCTGGCCTGG - Intronic
1133784176 16:8962792-8962814 GGCGAGCCCCGCGCCCGGGGAGG + Intronic
1134070313 16:11256234-11256256 CGCCAGCCCCGCCTCCGAGCCGG - Intronic
1134441553 16:14302178-14302200 GCCCAGCCCCCGCCCCGGGCCGG + Intergenic
1136272875 16:29158840-29158862 GGTCACCGCGGCTCCCGGGCGGG + Intergenic
1136365307 16:29806731-29806753 GGCCCCCCCCTTCCCCGTGCTGG + Exonic
1137785257 16:51133232-51133254 CCCCACCCCCACCCCCGGTCTGG - Intergenic
1138023160 16:53502881-53502903 GGCCCCCCTCTCCCTCGGGCCGG + Intronic
1138539701 16:57680415-57680437 GGCAGCCCCCTCCCCAGGGCAGG - Intronic
1138546537 16:57722874-57722896 AGCCGCCCCCGCCCCTGGGCTGG - Intronic
1139355452 16:66364727-66364749 GGCCAACCCCCCCTCTGGGCAGG + Intergenic
1139577569 16:67851655-67851677 CGCTACCCCCGCCCCAGGACAGG + Intronic
1141132158 16:81444398-81444420 CACCCCCGCCGCCCCCGGGCCGG - Intergenic
1142076429 16:88120652-88120674 GGTCACCGCGGCTCCCGGGCGGG + Intergenic
1142159588 16:88550215-88550237 GGCCACCCTCTCCCCTGGCCTGG - Intergenic
1142219849 16:88848748-88848770 TGCCACCCCCGCCCCCGGTGAGG - Intronic
1142413124 16:89926169-89926191 GGCGAACCCCGCCCCGGGGAGGG - Intronic
1142695147 17:1629195-1629217 GGCCACCAGCGCCCCCAGCCGGG + Intergenic
1142810265 17:2392840-2392862 CGCCAGCCCCGCCCCCTGGCCGG + Intronic
1143255958 17:5558230-5558252 AGCCACCCCCACCCCCGGCCAGG + Intronic
1143492763 17:7293962-7293984 GTCCGGCCACGCCCCCGGGCGGG - Intronic
1143503432 17:7351687-7351709 GGCCAGCCCCACCCCTCGGCAGG - Intergenic
1143519681 17:7438234-7438256 CCCCTGCCCCGCCCCCGGGCCGG + Intergenic
1144340819 17:14309331-14309353 CGCCTCCCCCGCCCCTAGGCTGG + Intronic
1144574163 17:16418451-16418473 GGCAGGCCCCGCCCCCGGGCAGG - Intronic
1144756182 17:17681833-17681855 CGCCGCCCCCGCCCCGGGGCAGG - Intronic
1144946427 17:18971788-18971810 GGCCAACCCCGCCCCAGCACAGG + Intronic
1144947572 17:18977725-18977747 GGCCAACCCCACCACCGCGCCGG - Exonic
1145214828 17:21043295-21043317 GGCCACCCCCCCCCCCCCCCCGG + Intronic
1145815741 17:27793775-27793797 GGCTCGCCCCGCCCCCGGGGCGG - Intronic
1146132685 17:30292135-30292157 GGCCGCGCCTGCCCCCGCGCAGG + Intergenic
1146329690 17:31917220-31917242 GGCCCCGGCCGCCGCCGGGCAGG - Intergenic
1146371156 17:32266203-32266225 GGCCACCGCGGGGCCCGGGCTGG - Exonic
1147179787 17:38677034-38677056 CGCCACCCCCGCCCCCATCCAGG - Intergenic
1147315345 17:39617768-39617790 CGCCACCCCCGCCCCGCGCCTGG + Intergenic
1147967395 17:44200339-44200361 CGCTGCCCCCGCCCCCGAGCCGG - Intergenic
1147976186 17:44249521-44249543 CCCCACCCCCACCCCAGGGCAGG + Exonic
1148218077 17:45844839-45844861 GGCCACGCCTGCCCCTGGGAGGG + Exonic
1148562429 17:48613637-48613659 CGCCCCCCCCGCCCCCGCACGGG - Intronic
1148722487 17:49763898-49763920 GGCCACCCCCGTCCCGGCGCTGG + Exonic
1148786292 17:50147776-50147798 GGCCAGCCTCTCCCCTGGGCTGG - Intronic
1148865466 17:50626090-50626112 GGCCCTCCCCGCCCCTGGCCCGG + Exonic
1149866454 17:60153830-60153852 GCCCATCCCCAGCCCCGGGCAGG - Intronic
1150423252 17:65056810-65056832 GGCCACCGCCCCTCCGGGGCCGG - Exonic
1151178008 17:72305084-72305106 GGCCTCCCCCGACCCCTGCCTGG - Intergenic
1151703878 17:75756867-75756889 GGCCACTCCTGCCCCCGGGGTGG - Intronic
1151938935 17:77281141-77281163 GGCGGCCCCCACCCCCGGCCTGG + Intronic
1152197214 17:78924927-78924949 GGCGACCCCAGCCCCCGCGCGGG - Intronic
1152357399 17:79813720-79813742 GGCCCCCGCCGGCCCGGGGCGGG - Intergenic
1152648567 17:81481590-81481612 TCCCGCCCCCTCCCCCGGGCCGG - Intergenic
1152743883 17:82030514-82030536 GGCCAGCCCCGCTCTCTGGCTGG - Intronic
1152747767 17:82049164-82049186 GGCCACGCCTGCCCCTGGCCAGG + Intronic
1152769060 17:82156525-82156547 GGCCACAGCCCCCACCGGGCAGG + Intronic
1153480616 18:5543457-5543479 GGCCGGCCCCTCCCCCGGGGAGG - Intronic
1154106444 18:11527662-11527684 GGGCACCCATGCCCCCTGGCAGG + Intergenic
1155654027 18:28175820-28175842 GCCCACCCTCGCCGCGGGGCAGG - Intronic
1156054254 18:32979298-32979320 GGCGACCCCTGCCCCCACGCTGG + Intronic
1156099608 18:33578325-33578347 CGCCGCCCCCGCCCCTGGCCCGG + Intergenic
1156501989 18:37566054-37566076 CGCCACCCCCACCCCTGGTCTGG - Intergenic
1157464404 18:47931125-47931147 GGCCCGCCCCGCCTCCCGGCCGG + Intronic
1159204040 18:65227208-65227230 GTCCACCCCAGCCCCCTGGAAGG + Intergenic
1159770451 18:72542050-72542072 GGCCAGCGCCACCCCCAGGCAGG + Exonic
1160354680 18:78216769-78216791 GGCCGCCCCCTTCCCCAGGCAGG - Intergenic
1160395093 18:78564832-78564854 CCCCACCCCCGCCACTGGGCTGG + Intergenic
1160499179 18:79394113-79394135 GGCCGCCCCCGCCCCGGCCCCGG + Intergenic
1160887984 19:1360887-1360909 GGCCGCACCATCCCCCGGGCCGG + Exonic
1160930389 19:1567393-1567415 GGCGACCCCCTTCCCCGGGGCGG + Intronic
1160979382 19:1809951-1809973 GGCCACCCACACCCCCAGCCAGG + Intronic
1160983410 19:1826995-1827017 GTCCACATCCGCCCCCGCGCTGG + Exonic
1160988633 19:1851721-1851743 GACCACCCCCTTCCCCGGGCGGG + Intergenic
1161022179 19:2015646-2015668 GGCCGACCCCGACCCCCGGCGGG + Exonic
1161264635 19:3358693-3358715 GGGCGCCCCCTCCCCCGGTCAGG - Intergenic
1161284942 19:3464035-3464057 GCCCACCCCCGCGCCCCGGCAGG - Intronic
1161302747 19:3550951-3550973 GGGCACCCTCCCCCACGGGCAGG - Intronic
1161313532 19:3607541-3607563 GGCCACCCCCCAGCTCGGGCTGG + Intergenic
1161338874 19:3729946-3729968 GGGCACCCCCTCCCCAGGGAGGG + Intronic
1161794929 19:6381092-6381114 GGCCTCCCCCGCCACCGGGCTGG + Intronic
1161802684 19:6424645-6424667 GGCCGCCGCCGCCCGCCGGCGGG - Exonic
1161849333 19:6730703-6730725 GCCCACCCCCGCCCCCAGAGCGG + Intronic
1162027869 19:7904460-7904482 GGCGCCCCCCTCCCCCGGCCTGG + Intronic
1162312147 19:9913914-9913936 GGCGCCCCCCGCCCCCCGCCGGG - Intronic
1162377873 19:10315883-10315905 CGCCACCCCCTCCCCCGACCCGG + Exonic
1162568691 19:11458286-11458308 GGACATCCCTGCCCCCTGGCAGG - Exonic
1162809671 19:13156163-13156185 GCCGACCCCCGCCCCCGCCCGGG + Intergenic
1163003186 19:14381715-14381737 GGGCACCCCCACACCCCGGCAGG + Intronic
1163063507 19:14776531-14776553 GGGCACCCCCACACCCCGGCAGG - Intronic
1163112635 19:15170641-15170663 CGCCACCCCCTCCCCAAGGCAGG + Intronic
1163118356 19:15201032-15201054 GGCTCGCCCCGCCCCGGGGCCGG + Intergenic
1163410246 19:17149542-17149564 GGCCATCCTCGCCCCAGGGAGGG + Intronic
1163567425 19:18059832-18059854 AGCCCCCCCACCCCCCGGGCAGG + Intronic
1163666669 19:18606841-18606863 GCCCGGCCCCGCCCCCGGCCCGG + Exonic
1165242988 19:34482062-34482084 GGCCCCCGCCGCCCCCGACCGGG - Exonic
1165507528 19:36243741-36243763 TGCCACCCCCACCCCCAGCCTGG - Intronic
1166344702 19:42157905-42157927 GGCCACCACAACCCCAGGGCTGG + Intronic
1166354134 19:42217171-42217193 GGCCTCCCCCTCCCCCGGGAGGG + Intronic
1166361690 19:42255175-42255197 GGACGCCCACGCCCCCCGGCCGG + Intergenic
1166367276 19:42284135-42284157 GTCGACCTCCGGCCCCGGGCGGG - Intronic
1166367398 19:42284472-42284494 GACCTCCCCCGCCCCCCGGGCGG + Intronic
1166557428 19:43710259-43710281 CTCCACCCCCACCCCCAGGCTGG + Intergenic
1167001135 19:46746307-46746329 CTCCGCCCCTGCCCCCGGGCCGG - Exonic
1167125337 19:47545127-47545149 GGCCACCGCCGGGGCCGGGCGGG + Exonic
1167428420 19:49441430-49441452 GGCCGCCCGGGCCCGCGGGCGGG - Exonic
1167456251 19:49597832-49597854 GGCCACCCCGGCCACGGGGGAGG + Exonic
1167578909 19:50330825-50330847 GGCCGTCCCCGCCCCCTGGGCGG + Intronic
1168239525 19:55082185-55082207 GGACGCGCCCGCCCCTGGGCCGG + Intronic
1168694409 19:58396565-58396587 GGCCGCCGCCGCCCCCGCCCGGG + Exonic
1202714178 1_KI270714v1_random:33367-33389 TGGGACCCCCGCGCCCGGGCAGG + Intergenic
925299222 2:2798521-2798543 GGCCATCCCAGCCACAGGGCAGG + Intergenic
925401408 2:3575725-3575747 GGCCGCCTCCCCTCCCGGGCGGG - Intronic
925911238 2:8574885-8574907 AGCCTCCCCCGCCAGCGGGCTGG + Intergenic
925943273 2:8839396-8839418 TGCCACCCCAGCCCCAAGGCTGG - Intergenic
928002866 2:27539748-27539770 GACCCCCCCCGCCCCCGGACGGG + Intronic
928186542 2:29115685-29115707 GGCCCCCCCGGGCCGCGGGCTGG + Intronic
928518274 2:32063924-32063946 CGCCCCTCCCGCCGCCGGGCCGG + Exonic
928607141 2:32953439-32953461 GGCCACCCCGGCCCCCATGTGGG + Intronic
929534403 2:42771612-42771634 GCCCACCCCAGCCCCCAGCCTGG + Intronic
929620457 2:43349133-43349155 GACCACCCCCTCCTCAGGGCAGG - Intronic
929761495 2:44811081-44811103 GCCCCCTCCCGCCCCCGGGTGGG + Intergenic
931517805 2:63059861-63059883 GTCCCCCGCCGCCCCCGGCCCGG - Intergenic
931517848 2:63059990-63060012 CCCCACCCCCACCCCCGGGCCGG + Intergenic
932699692 2:73984621-73984643 GGCCACCCTCGCCCTCCGGCGGG - Intergenic
932699911 2:73985222-73985244 CCCCTCCCCCTCCCCCGGGCCGG - Intergenic
932773224 2:74513286-74513308 GCCCGCCCCGGCCCCCGGGGGGG - Intergenic
933684709 2:85133690-85133712 CGCCGCCCCCGCCGCCGAGCTGG - Exonic
934031861 2:88055595-88055617 GGCCGCCCCCGCCGCCGGGGCGG + Intronic
934718427 2:96556515-96556537 GGCTCCCCCCGCCCCCAGCCAGG + Intergenic
934845252 2:97658162-97658184 GGCTACCCCTTCCCCCAGGCTGG + Intronic
934947735 2:98554216-98554238 GGCCTCCCCAGCCCCTGGCCTGG + Intronic
935098943 2:99973827-99973849 GGGCACCCCTGCCCCAGAGCGGG - Intronic
935692876 2:105745607-105745629 GGCCTCCCCCGTCCCTGCGCCGG - Intronic
936078689 2:109417952-109417974 GGCCAGCCCTGCCCCCAGACTGG - Intronic
936126695 2:109794575-109794597 CGCCGCCGCCGCCCCCCGGCCGG - Intronic
936232377 2:110714193-110714215 GGCCACCCAAGCCCATGGGCTGG + Intergenic
936412958 2:112276246-112276268 CGCCGGCCCCGCCCCCGGCCGGG + Intronic
936512142 2:113157296-113157318 CGCCACCCCCAACCCCGGCCCGG + Intergenic
937289918 2:120776004-120776026 GACCATCCCAGCCCCTGGGCAGG - Intronic
937993096 2:127674983-127675005 CCCCACCCACGCCCCCGGGCCGG - Intronic
939629633 2:144516842-144516864 TGCCACCCCCGCCCCCGCCCCGG + Intronic
942047638 2:172109054-172109076 CCCCACCCCCGCCCCCTGACAGG - Intergenic
942459103 2:176157411-176157433 CTCCACCCCCGGCCCCCGGCGGG + Intronic
943725127 2:191245329-191245351 CGCCGCCCCCGCCCCTCGGCCGG + Intronic
945241603 2:207681625-207681647 GGCTGCCCCGGACCCCGGGCAGG + Intergenic
946386679 2:219387992-219388014 GGTCAGCCCCGCCCCTCGGCGGG + Exonic
947549652 2:231037429-231037451 GGACCCCCGGGCCCCCGGGCGGG - Intergenic
947564556 2:231185704-231185726 GGCCTCACCCGCCCCTAGGCAGG - Intergenic
947860467 2:233354423-233354445 CGCCCCCACCGCCCCCGGCCCGG + Intergenic
948381208 2:237551116-237551138 GGCCAGCCCCGCACACTGGCAGG + Intronic
948627657 2:239279049-239279071 GGCCACACCCTGCCCCAGGCGGG + Intronic
948801564 2:240435641-240435663 CGCCTCCCCCGCCGCCGGCCCGG - Intergenic
948824785 2:240568898-240568920 CGCCTTCTCCGCCCCCGGGCCGG + Exonic
948933804 2:241149649-241149671 GGGCGCCTCCGCCCCCGGGCCGG + Intronic
948934058 2:241150727-241150749 GGCCGCTGCCGCCCCCGGGCCGG - Intronic
1168777859 20:462591-462613 AGCCTCCCCCGCCGCCGGCCGGG - Intergenic
1168931949 20:1631001-1631023 GGCCACCTCCACCCCAGTGCAGG + Intronic
1169204580 20:3732627-3732649 CGCCGCCCCCTCCCCCAGGCCGG - Intergenic
1169214732 20:3786516-3786538 CGCCGCCGCCGCCCCGGGGCGGG + Exonic
1169244540 20:4015386-4015408 CGCGGCCGCCGCCCCCGGGCTGG - Intronic
1169264725 20:4160930-4160952 CCCCACCCCCTCCCCGGGGCTGG + Intronic
1170190292 20:13638750-13638772 GGACACCCCTTGCCCCGGGCGGG - Intronic
1172007960 20:31830465-31830487 TGCTATCCCCGCCCCCAGGCTGG - Intronic
1172100875 20:32483515-32483537 GGCCACCCCCGCCCCCGGGCCGG - Intronic
1172661931 20:36574118-36574140 GGGCCCCCCCGCCGCCGAGCCGG + Intronic
1174072469 20:47908770-47908792 GGGAGCCCCCGCCCCCGGTCTGG + Intergenic
1174407742 20:50313014-50313036 GCCCTCCCCGGCCCCCGGCCTGG - Intergenic
1174483260 20:50845633-50845655 GGCCTCCCCCGACCCCAGGCTGG + Intronic
1175060303 20:56236258-56236280 GGCCAACCCCTGCCCCGTGCAGG + Intergenic
1175186333 20:57181719-57181741 GGCCACCCACATCCCAGGGCTGG + Intronic
1175219513 20:57408911-57408933 GGCCACTGCCCCCCCCAGGCTGG - Exonic
1175398682 20:58686319-58686341 GACCTCCCCCTCCCCAGGGCTGG - Intronic
1175847040 20:62064859-62064881 GGCAGCCCCCGCCCCCGCCCCGG - Exonic
1175895101 20:62332619-62332641 GGCCACGCCCACCTCCTGGCGGG + Exonic
1175947404 20:62565322-62565344 GGCCAGCCCAGGCCCCCGGCAGG - Intronic
1175964629 20:62654396-62654418 GCCCACCCCAGCCCCAGCGCAGG + Intronic
1176113372 20:63420778-63420800 TTCCACCCCAGCCCCCGTGCCGG + Intronic
1176213711 20:63938648-63938670 AGCCGGCCCCGCCCCCGCGCTGG - Intergenic
1176245866 20:64096316-64096338 GGTCACCCCAGCCCACTGGCTGG - Intronic
1176414525 21:6467211-6467233 TCCCACCCCAGCCCCCGCGCCGG - Intergenic
1178076442 21:29017324-29017346 AGCCACCACCGCACCTGGGCTGG - Intronic
1178487399 21:33027672-33027694 CGCCGCCCCCGCCCCCCAGCGGG - Exonic
1178513825 21:33229891-33229913 CTCCGCCCCCGCCCCCGCGCCGG + Intronic
1179304761 21:40144292-40144314 GTCCAGCCCTGCCCCAGGGCGGG + Intronic
1179496969 21:41778210-41778232 GGACACCCCCAACCCTGGGCCGG - Intergenic
1179690023 21:43075533-43075555 TCCCACCCCAGCCCCCGCGCCGG - Intronic
1179783860 21:43719027-43719049 CGCAGGCCCCGCCCCCGGGCTGG - Intergenic
1179830754 21:43994532-43994554 GTCCACACCCGCCCCCGAGGTGG + Intergenic
1179908701 21:44436986-44437008 GGCCAGCCCCGCCGCGGCGCAGG + Intronic
1179968321 21:44819020-44819042 GGCCTCCCCCGCCTTCGGCCGGG - Intergenic
1180791827 22:18578736-18578758 GGCCAGCCCAGCCCCTGGGAAGG - Intergenic
1180866275 22:19121870-19121892 GGCCGCCGCCGCTCCCGGGAAGG + Intronic
1181041909 22:20196269-20196291 GGCTTCCCCCGCCCCGAGGCTGG - Intergenic
1181229909 22:21416573-21416595 GGCCAGCCCAGCCCCTGGGAAGG + Intergenic
1181248740 22:21518293-21518315 GGCCAGCCCAGCCCCTGGGAAGG - Intergenic
1181381506 22:22508389-22508411 AGACGCCCCCACCCCCGGGCTGG - Intronic
1181745323 22:24952263-24952285 GACCTTGCCCGCCCCCGGGCCGG + Intergenic
1182318325 22:29462645-29462667 CGCCACCCCCACCCCCACGCTGG + Intergenic
1182485324 22:30635621-30635643 GCCAAGCCCCGCCCCCGGACCGG - Intergenic
1182735392 22:32529336-32529358 GGCCAGCCCCGACCCTGGGAGGG - Intronic
1183272634 22:36871709-36871731 GGTAACCCCCGCCCCCACGCTGG + Exonic
1183370181 22:37427661-37427683 GCCCGCTCCCGCCCCCGAGCCGG + Intergenic
1183401764 22:37609015-37609037 GGACACCGCCCCTCCCGGGCCGG - Intronic
1183607133 22:38872366-38872388 GACCTCCCCCTCCCCCGGGGCGG + Intergenic
1183662716 22:39230862-39230884 GGCCAGCCTCGCCCACAGGCTGG - Intronic
1183687061 22:39367280-39367302 GGCCTCCCAGGCCCCAGGGCAGG + Intronic
1184086834 22:42270466-42270488 GGCCCGCCCCGCCGCCGGCCCGG - Intronic
1184099727 22:42335806-42335828 GGGCACCCCCACCCCAGAGCTGG - Intronic
1184411871 22:44330808-44330830 GGCCACCCCAGCCCCGGGCGCGG + Intergenic
1184510427 22:44930158-44930180 GGCCACACCCGCCCCAGTGCTGG - Intronic
1184523630 22:45009360-45009382 CTCGCCCCCCGCCCCCGGGCAGG + Intronic
1184587160 22:45455757-45455779 AACCACCCCCGCCCCCATGCAGG + Intergenic
1184743070 22:46440275-46440297 TGACACTCCCGCCCCCGGACAGG + Intronic
1185018924 22:48362261-48362283 GGGGACCCCCACCCCCAGGCAGG - Intergenic
1185044924 22:48523990-48524012 GGCCAGCCCGGCCCCGGGGCAGG - Intronic
1185277639 22:49956729-49956751 GGCCGCCCCAGGCCCTGGGCTGG - Intergenic
1203285886 22_KI270734v1_random:154107-154129 GGTCCCCCCCCCCCCCGGGTGGG + Intergenic
950170448 3:10835314-10835336 GGCCTCCCCCACCCCATGGCTGG - Intronic
950345325 3:12287853-12287875 GCCCGCGCCCGCCCCCGCGCCGG + Intronic
950479399 3:13235315-13235337 GGCCACACCCTTCCCCTGGCTGG + Intergenic
950754678 3:15162775-15162797 GGTCAGCCCCCCGCCCGGGCAGG - Intergenic
951981873 3:28575570-28575592 GGTGACCCCCGCCTCCGCGCTGG - Intergenic
952301277 3:32106565-32106587 GGCCACCCCCGCCCGGCGCCGGG - Exonic
952744448 3:36764216-36764238 AGCCGCCGCCGCCCCCGGCCCGG - Intergenic
952887830 3:38022350-38022372 GGCCACCTCCGGCCTCCGGCGGG + Intronic
954073177 3:48158040-48158062 GGCCACCCCCGGCTCAGTGCTGG - Exonic
954367648 3:50154958-50154980 GCCCAGCCCCACCCCCGGGGCGG - Intergenic
956468647 3:69542634-69542656 GGCCGCCCCAGCCCCCGGAGAGG - Intergenic
958004290 3:87792776-87792798 GCCCTCCCGCGCCCCGGGGCTGG + Intergenic
958641534 3:96813498-96813520 CGCGGCCCCCGCCCCAGGGCCGG - Intergenic
960747668 3:120908146-120908168 GGCAGGCCCCGCCCCCGGGCCGG - Exonic
961013414 3:123449850-123449872 GGCCGCCTCCGCCCCCGGCCTGG + Intergenic
961013473 3:123450032-123450054 GTCTTCCCCCGCCCCCGGCCAGG + Intergenic
961037447 3:123652535-123652557 GGGCACCCCCGCCCCGGAGACGG + Intronic
961446417 3:126983605-126983627 GGCCTCCCCCGCCCCCCGGCCGG + Intergenic
961574454 3:127823222-127823244 GGCCGCCCCCGCCGCCGAGCCGG - Intronic
961665866 3:128492842-128492864 GGCCCTTCCCGCCCCCGGCCCGG - Intronic
961676288 3:128568961-128568983 GGCCGCCCCTGCCCCAGCGCGGG - Intergenic
964720428 3:159763970-159763992 GACCACCCCCCGCCCCGGCCCGG - Intronic
967017931 3:185498464-185498486 GCCCACCTTCGCCCCCGTGCGGG - Intronic
968441591 4:627074-627096 GACCACACCTGCCCCTGGGCTGG - Intronic
968479274 4:826398-826420 GTCCACCCCCGCCCCCGCCCCGG - Intergenic
968479317 4:826465-826487 GTCCACCCCCGCCCCCGCCCCGG - Intergenic
968583466 4:1405433-1405455 GGCGGCCCGCGCCCCCGGTCGGG - Intronic
968651898 4:1763488-1763510 AGCCGCCCCGGCCCCGGGGCCGG + Intergenic
968658421 4:1788522-1788544 GGCCTCCCCCACTCCCAGGCTGG + Intergenic
968807734 4:2786609-2786631 GGCCACTCCTGACCCTGGGCTGG + Intergenic
968911014 4:3477013-3477035 GGCCATCCCCACCCACGGCCTGG - Intronic
969344934 4:6564330-6564352 GCCCACCCCCGCCCCCCCACCGG + Intergenic
969455849 4:7299176-7299198 GCCCACCCCCAGCCCCGGACAGG - Intronic
969506886 4:7593646-7593668 CCCCACCCCCGCCCCCAGGTTGG - Intronic
971018989 4:22515833-22515855 GGCCGCCCCGGAGCCCGGGCGGG + Exonic
976226586 4:82799019-82799041 GGCCGCCTCCGCCCGGGGGCGGG + Intergenic
977607413 4:98996178-98996200 GGCGGCCCCCGCCCCAGCGCGGG - Intronic
980923895 4:139115317-139115339 GGCGACCCCGGCCCCCGGGCCGG - Intronic
983533416 4:168833065-168833087 GGCCGGCCCCGCCCCGGGGCTGG + Intronic
984792153 4:183624837-183624859 GGCCACTCCCGACCCTGAGCTGG + Intergenic
985504678 5:272006-272028 GGCCGCCCCCGTCCCCTGGCGGG + Intronic
985743435 5:1633589-1633611 GGCCGCCCCCGTCCCCTGGCGGG - Intergenic
985750087 5:1668540-1668562 GGCCACCCTCTCCTGCGGGCGGG - Intergenic
989011505 5:36877094-36877116 AGCCACCCCCCCTCCCGGCCCGG + Exonic
989133695 5:38132142-38132164 GGCCACCCCCGCCTGCGTGACGG + Intergenic
990557751 5:56952205-56952227 TGCCGCCTCCGCCGCCGGGCGGG - Intronic
991351187 5:65722110-65722132 GGCCAGCACCGCCCCTGGGGCGG + Exonic
993692812 5:91023652-91023674 GGCCACCCAAGCTCCAGGGCTGG + Intronic
998149363 5:139748037-139748059 GCCCCCTCCCGCCCGCGGGCTGG - Intergenic
998491608 5:142551803-142551825 GCCCGCCCCAGCCCCCAGGCTGG + Intergenic
998503379 5:142652803-142652825 GTCCACGCCAGGCCCCGGGCGGG + Intronic
999322633 5:150624793-150624815 CGCCACCCCCGCCCCGCGCCAGG - Intronic
1001398473 5:171433112-171433134 GGCCACCCCCGCCACCTCCCTGG + Intronic
1001556509 5:172641059-172641081 CGCCGCTCCCGCGCCCGGGCCGG - Intergenic
1002021371 5:176366096-176366118 CGACATCCCCACCCCCGGGCGGG - Intronic
1002139957 5:177132650-177132672 GCCCACCCCCGGCACCGAGCCGG - Intergenic
1002140335 5:177133907-177133929 GGTCACCCCCTCCCCCCAGCTGG + Exonic
1002405067 5:179024040-179024062 GGCCACGCCCCCTCCGGGGCCGG - Intronic
1002487739 5:179550933-179550955 GGCCCCCACCGCGCCCGCGCCGG - Intronic
1002548902 5:179972515-179972537 GGCCTCCCCCGACCCCCAGCGGG - Intronic
1002645216 5:180649444-180649466 GGCCAGCCCCACGCTCGGGCGGG + Intronic
1002898620 6:1393089-1393111 GGCCACCCCCGCGCCTCGCCGGG - Intronic
1002926851 6:1610014-1610036 GGCCCCCCCCCCCCCCGCCCTGG + Exonic
1003105488 6:3211840-3211862 GGCCATCCCATCCCCTGGGCAGG - Intergenic
1004186548 6:13426246-13426268 GGCCACACACGCCCCCAGGCAGG + Intronic
1005303774 6:24495060-24495082 TGCCGCCTCCGCCCCCGCGCCGG + Exonic
1006300982 6:33193390-33193412 GGCCGGCCCCGCCCCCAGCCTGG + Intergenic
1006346265 6:33485693-33485715 GGCCGGCCCCCCCCCCGGACGGG + Intergenic
1006366877 6:33621276-33621298 GGCCTCCCCGCCTCCCGGGCGGG + Exonic
1006370317 6:33640235-33640257 GCCCACCCCAGCCCCCTGACTGG - Intronic
1006424648 6:33956453-33956475 CACCACCCCAGCCCCCTGGCGGG - Intergenic
1006475328 6:34249145-34249167 GCCCACCCCCGCCTCCGGATTGG - Exonic
1006929649 6:37680121-37680143 CCCCACCCCCGCCCCCGGGAGGG - Intronic
1007363213 6:41373195-41373217 GTCCGCCCCAGCCCCCGCGCCGG + Intergenic
1007414664 6:41684545-41684567 GGCCCTCCCAGCCCCCAGGCCGG + Exonic
1007451139 6:41941075-41941097 GGCCGCCCCCGCCCGGGAGCCGG - Intronic
1011610437 6:89145973-89145995 GGCCGCCCCCGGCGCCGCGCGGG - Intergenic
1011640380 6:89412010-89412032 GACCCCCGCCGTCCCCGGGCCGG - Exonic
1013575698 6:111482525-111482547 CGGCGCCCCCACCCCCGGGCAGG - Intronic
1015149253 6:130019937-130019959 GCCCGCGCCCGCACCCGGGCCGG - Intronic
1015376138 6:132512808-132512830 GGCTCCCCACGCCCCCCGGCCGG - Intronic
1016383759 6:143511766-143511788 GGCCACTCCCGCCCCAGAGGGGG - Intergenic
1017665908 6:156720060-156720082 GGCCCGCCCCGCCCCCGTCCTGG - Intergenic
1018150289 6:160931187-160931209 GCCCACCCGCGCCCCCGCCCCGG - Intergenic
1019302211 7:311591-311613 GACCACCCCCGCCCCCCTCCTGG + Intergenic
1019351689 7:557037-557059 GGCCCCTCCCACCCCCGGCCTGG + Intronic
1019442123 7:1052714-1052736 TATCACCCCCGCCACCGGGCAGG + Intronic
1019476360 7:1246554-1246576 GGCCGCCGCCGCCCCAGGACCGG - Intergenic
1019478433 7:1255172-1255194 GGCCAGCCCCGCCCCAGGGCAGG - Intergenic
1019524901 7:1476507-1476529 GGCCACCCCCTCTCCCGGATGGG + Intronic
1019524911 7:1476528-1476550 GGCCACCCCCTCTCCCGGATGGG + Intronic
1019538368 7:1540378-1540400 CGCCACCCCCCGCCCCCGGCCGG - Exonic
1019711476 7:2520011-2520033 GGCTGCCCCGGCGCCCGGGCTGG + Exonic
1020008128 7:4792959-4792981 GGGAAGCCCCGCCCCAGGGCAGG - Intronic
1020083705 7:5299441-5299463 GGCGTCCCCCGACACCGGGCAGG - Intronic
1020137174 7:5593968-5593990 GCCCACCTCCCACCCCGGGCTGG + Intronic
1020207502 7:6130428-6130450 GGCCTCCCCAGCCCCCGGTGAGG - Intronic
1020274410 7:6615784-6615806 GGCCGCCGCCGACCCCAGGCGGG + Exonic
1020709245 7:11585666-11585688 GGCCACCCACGACCCCAGACTGG - Intronic
1021572840 7:22083093-22083115 GGCCACTCCCCCCGCCGCGCTGG - Intergenic
1022936692 7:35185948-35185970 GGCCTCCCCCGCCCGGGAGCTGG - Intergenic
1023016317 7:35971509-35971531 GGCGGCCCTGGCCCCCGGGCCGG - Intergenic
1023831234 7:44040017-44040039 GGCAACCCCCGACCCCTCGCAGG + Intergenic
1024111913 7:46155482-46155504 GGCCACCCCCAACCAGGGGCTGG - Intergenic
1025777378 7:64570559-64570581 CCCCTCCCCCGACCCCGGGCCGG - Intergenic
1025850283 7:65238911-65238933 GGACACCCCCACCCCCAGCCTGG - Intergenic
1026382972 7:69817750-69817772 GACCACCCACATCCCCGGGCAGG - Intronic
1027187464 7:75980779-75980801 GCCCACCCTCCCCACCGGGCTGG - Intronic
1027982981 7:85250279-85250301 GGCGCCCCCCCCCCCCGGCCTGG - Intergenic
1029303201 7:99600400-99600422 AGGCACCCCCGCCCCCAGGAAGG + Intronic
1029594159 7:101528051-101528073 CACCACCCCCATCCCCGGGCAGG - Intronic
1029701486 7:102249145-102249167 GGCCTGCACCGACCCCGGGCCGG + Exonic
1029741564 7:102494323-102494345 GGCAACCCCCGACCCCTCGCAGG + Intronic
1029759555 7:102593492-102593514 GGCAACCCCCGACCCCTCGCAGG + Intronic
1029776922 7:102689402-102689424 GGCAACCCCCGACCCCTCGCAGG + Intergenic
1029832927 7:103280059-103280081 GGCCTCCCCCGCCCGGGAGCGGG - Intergenic
1031980698 7:128122502-128122524 TGCCCCCCCCACCCCCCGGCCGG + Intergenic
1033299992 7:140176911-140176933 GGCCACCGCCGCCGCCGCTCCGG + Exonic
1034464147 7:151215870-151215892 AGCCGCCCCCACCCCCTGGCAGG - Intronic
1035022757 7:155808879-155808901 GGACGCCCCCGCCCCCGCGCTGG - Intronic
1035187675 7:157139082-157139104 CGCCCCTCCCGCCCCAGGGCAGG + Exonic
1035553475 8:545985-546007 GGCGACCCCCGATCCCGGGACGG + Intergenic
1036206118 8:6806687-6806709 GCTCAGCCTCGCCCCCGGGCAGG + Intergenic
1036390296 8:8318864-8318886 GCCCGCCCCCGCCCCCGCCCCGG - Exonic
1036432253 8:8702116-8702138 GGTCAGACCCGCCCGCGGGCTGG + Exonic
1037802263 8:22042325-22042347 GCCCACCCCTGCCCCCTGGAGGG + Intergenic
1037882094 8:22578497-22578519 GGGCACCCCCACCCCTGGGCTGG - Intronic
1038326616 8:26577278-26577300 GGCCACGCCCGGCCCCGGAGAGG - Intronic
1041107577 8:54458061-54458083 CCCCACCCCCTCCCCCGGGTCGG + Exonic
1042399657 8:68331108-68331130 TGCCACCCACGCCCGCGGCCGGG + Exonic
1043463711 8:80486047-80486069 CCGCACCCCCGCCCCCAGGCCGG + Intronic
1043954322 8:86343022-86343044 GGCGCCGTCCGCCCCCGGGCTGG + Intronic
1045023567 8:98064742-98064764 GGCGCCGCCCGCGCCCGGGCTGG + Intronic
1049224190 8:141441829-141441851 GGCCACCCCCTGCCCTGGGAAGG + Intergenic
1049532140 8:143160064-143160086 CCCCACCCCCACCCCTGGGCTGG + Intronic
1049544924 8:143226107-143226129 GGGCACCCCCTCCTCCAGGCAGG - Intergenic
1049555314 8:143278656-143278678 GGCGACCCCGGCGCCCGGGTTGG + Intergenic
1049765707 8:144354366-144354388 CGCCACCCCCGGCTGCGGGCAGG - Intronic
1049787016 8:144455898-144455920 AGCCACCCCAGCTCCTGGGCCGG + Intronic
1051287370 9:15510717-15510739 GGCCCCCTCGGCTCCCGGGCGGG + Intronic
1053139932 9:35676001-35676023 GGCCAGCCCAACCCCCGGGCAGG - Intronic
1053140883 9:35682057-35682079 GGCCAGCCCCACCCCCAGCCAGG - Exonic
1053381186 9:37650822-37650844 CGCGACCCCCGCCCCGGGGGAGG - Intronic
1054274210 9:63052597-63052619 CCCCCCCCCCGCCCCCGGGCAGG + Intergenic
1054400631 9:64712372-64712394 CCCCCCCCCCGCCCCCGGGCAGG - Intergenic
1054434237 9:65196687-65196709 CCCCCCCCCCGCCCCCGGGCAGG - Intergenic
1057259880 9:93577292-93577314 GGCCAACCCCGAGCCCGCGCGGG - Intronic
1057470061 9:95349411-95349433 GGCCACCCCCGCCTCCAGGGAGG - Intergenic
1057566467 9:96169668-96169690 GCCCACCCACGTCGCCGGGCGGG + Intergenic
1057773275 9:97984824-97984846 GGCCGCCCCCGCCCCGCGCCGGG + Intronic
1057903775 9:98968792-98968814 CCCCGCCCCCGCCCCCAGGCAGG - Intronic
1058152357 9:101476786-101476808 GGCCACCCCCCGGCCCTGGCTGG - Exonic
1058439081 9:104991211-104991233 GCCCTCCCCCGCCCCAGCGCCGG + Intergenic
1059375203 9:113876096-113876118 CGCCCTGCCCGCCCCCGGGCCGG - Intergenic
1060139943 9:121201431-121201453 GGACACCTCCGCCCCCGCCCAGG + Intronic
1061130043 9:128703438-128703460 GGCCTCCCCCGCCCCAGGGCGGG + Intronic
1061235965 9:129342801-129342823 GGTGACCCTCGCCCCCCGGCTGG + Intergenic
1061400987 9:130368283-130368305 GGCCAGCCCCCTCCCCGGGGAGG - Intronic
1061820277 9:133223519-133223541 GCCCACACCCTCCCCAGGGCAGG - Intergenic
1062029995 9:134357960-134357982 GGGCACCCCAGGCCCCAGGCGGG - Intronic
1062050201 9:134443192-134443214 GGGCACAGCCGCCCCCTGGCAGG + Intergenic
1062240341 9:135534317-135534339 GCCCACACCCTCCCCAGGGCAGG + Intergenic
1062240356 9:135534385-135534407 GCCCACACCCTCCCCAGGGCAGG + Intergenic
1062285296 9:135770122-135770144 GCCCATCCCCGCCCCCAAGCAGG - Intronic
1062340199 9:136090773-136090795 GGCCACCCCCAGCCCAGGGCCGG + Intronic
1062363225 9:136197351-136197373 TGCCAGCCCCGCCTCCTGGCTGG - Exonic
1062562649 9:137148535-137148557 GGCCACCCACTCGCCGGGGCCGG + Intronic
1203768409 EBV:38371-38393 GGCCACCCCCCACCCGGAGCGGG - Intergenic
1203768459 EBV:38496-38518 GGCCACCCCCCACCCGGAGCGGG - Intergenic
1203768509 EBV:38621-38643 GGCCACCCCCCACCCGGAGCGGG - Intergenic
1203768559 EBV:38746-38768 GGCCACCCCCCACCCGGAGCGGG - Intergenic
1203768609 EBV:38871-38893 GGCCACCCCCCACCCGGAGCGGG - Intergenic
1203768659 EBV:38996-39018 GGCCACCCCCCACCCGGAGCGGG - Intergenic
1203768709 EBV:39121-39143 GGCCACCCCCCACCCGGAGCGGG - Intergenic
1203768759 EBV:39246-39268 GGCCACCCCCCACCCGGAGCGGG - Intergenic
1203768809 EBV:39371-39393 GGCCACCCCCCACCCGGAGCGGG - Intergenic
1203768859 EBV:39496-39518 GGCCACCCCCCACCCGGAGCGGG - Intergenic
1203768909 EBV:39621-39643 GGCCACCCCCCACCCGGAGCGGG - Intergenic
1203768959 EBV:39746-39768 GGCCACCCCCCACCCGGAGCGGG - Intergenic
1186466270 X:9786405-9786427 GGCTCCCTCCGCCGCCGGGCCGG + Intergenic
1188480365 X:30630764-30630786 GCCCAGCCCAGCCTCCGGGCCGG - Intergenic
1190024806 X:46912981-46913003 GTCCGCCCCCGCCCCCCGCCCGG - Intronic
1192657090 X:73003386-73003408 GGCCTCCGCCTCCCCCGGGGTGG - Intergenic
1192665030 X:73079615-73079637 GGCCTCCGCCTCCCCCGGGGTGG + Intergenic
1198276320 X:135098325-135098347 GTCCCCGCCCGCCCCCGGCCGGG - Intergenic
1198310188 X:135422415-135422437 GTCCCCGCCCGCCCCCGGCCGGG + Intergenic
1199854664 X:151750707-151750729 CGCCACTCCCGCCCTCGTGCAGG + Intergenic
1200002132 X:153067514-153067536 GGCCCCCCCGACCCCGGGGCTGG - Intergenic
1200005601 X:153082511-153082533 GGCCCCCCCGACCCCGGGGCTGG + Intergenic
1200128959 X:153830780-153830802 GGCGGCCCCCGCCCGCGGCCAGG + Intergenic
1200259300 X:154603701-154603723 GGCCACCCTAGCCCCATGGCTGG - Intergenic
1200277864 X:154751164-154751186 GGCCGCCGCGGCCCCCGGGGAGG + Intronic