ID: 1172100878

View in Genome Browser
Species Human (GRCh38)
Location 20:32483520-32483542
Sequence CTCCTGGCCACCCCCGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 826
Summary {0: 1, 1: 0, 2: 6, 3: 83, 4: 736}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172100878_1172100892 26 Left 1172100878 20:32483520-32483542 CCGGGGGCGGGGGTGGCCAGGAG 0: 1
1: 0
2: 6
3: 83
4: 736
Right 1172100892 20:32483569-32483591 GCGGCGGCGGCGCCGCGGCCCGG 0: 1
1: 6
2: 58
3: 298
4: 1538
1172100878_1172100888 7 Left 1172100878 20:32483520-32483542 CCGGGGGCGGGGGTGGCCAGGAG 0: 1
1: 0
2: 6
3: 83
4: 736
Right 1172100888 20:32483550-32483572 CAGGCGAGCAGCGGCGGCAGCGG 0: 1
1: 0
2: 2
3: 34
4: 384
1172100878_1172100893 29 Left 1172100878 20:32483520-32483542 CCGGGGGCGGGGGTGGCCAGGAG 0: 1
1: 0
2: 6
3: 83
4: 736
Right 1172100893 20:32483572-32483594 GCGGCGGCGCCGCGGCCCGGAGG 0: 1
1: 1
2: 11
3: 89
4: 771
1172100878_1172100890 13 Left 1172100878 20:32483520-32483542 CCGGGGGCGGGGGTGGCCAGGAG 0: 1
1: 0
2: 6
3: 83
4: 736
Right 1172100890 20:32483556-32483578 AGCAGCGGCGGCAGCGGCGGCGG 0: 4
1: 55
2: 385
3: 2044
4: 3495
1172100878_1172100889 10 Left 1172100878 20:32483520-32483542 CCGGGGGCGGGGGTGGCCAGGAG 0: 1
1: 0
2: 6
3: 83
4: 736
Right 1172100889 20:32483553-32483575 GCGAGCAGCGGCGGCAGCGGCGG 0: 1
1: 0
2: 34
3: 247
4: 1279
1172100878_1172100885 1 Left 1172100878 20:32483520-32483542 CCGGGGGCGGGGGTGGCCAGGAG 0: 1
1: 0
2: 6
3: 83
4: 736
Right 1172100885 20:32483544-32483566 AGGGCCCAGGCGAGCAGCGGCGG 0: 1
1: 0
2: 1
3: 35
4: 440
1172100878_1172100891 21 Left 1172100878 20:32483520-32483542 CCGGGGGCGGGGGTGGCCAGGAG 0: 1
1: 0
2: 6
3: 83
4: 736
Right 1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG 0: 1
1: 10
2: 192
3: 494
4: 1380
1172100878_1172100884 -2 Left 1172100878 20:32483520-32483542 CCGGGGGCGGGGGTGGCCAGGAG 0: 1
1: 0
2: 6
3: 83
4: 736
Right 1172100884 20:32483541-32483563 AGGAGGGCCCAGGCGAGCAGCGG 0: 1
1: 0
2: 6
3: 38
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172100878 Original CRISPR CTCCTGGCCACCCCCGCCCC CGG (reversed) Intronic
900114827 1:1023994-1024016 CCCCTGGCCAGCCCCACCCCAGG - Intronic
900383283 1:2396194-2396216 CTCCCAGCCACCCACGTCCCCGG + Intronic
900392161 1:2438419-2438441 CTCCTGGACAGACCCTCCCCTGG - Intronic
900418627 1:2546211-2546233 CTCCCCGCTCCCCCCGCCCCCGG - Intergenic
900570118 1:3354012-3354034 CTCCTGCCCAGCCACGCCCATGG + Intronic
900777289 1:4594608-4594630 CTCCAGGCCGCCCCCACGCCTGG + Intergenic
901036116 1:6337210-6337232 GTCCTGGCCACCACAGCCCTCGG - Intronic
901183664 1:7358541-7358563 CCCCGCGCCACCCCTGCCCCGGG + Intronic
901504659 1:9676900-9676922 CTCTGGGCCACTCCTGCCCCTGG - Intronic
901525983 1:9823740-9823762 CTCCCTGCCGCTCCCGCCCCGGG - Exonic
901644401 1:10708924-10708946 TTCCTGCCCTCCCCCGACCCTGG - Intronic
902525702 1:17055879-17055901 CTCCAGGCCACTCCTGCCCAAGG - Intergenic
902557926 1:17257971-17257993 CTCTTGCCCACCACCTCCCCAGG - Intronic
902729791 1:18361996-18362018 CACCTGCCCTCCCCCACCCCCGG + Intronic
903183089 1:21614869-21614891 TGCCCGGCCACACCCGCCCCAGG + Intronic
903285125 1:22272411-22272433 CTCTTTGCCACCTCAGCCCCTGG - Intergenic
903294614 1:22335807-22335829 TTCCTGGCCAGCCTTGCCCCAGG + Intergenic
903417892 1:23196902-23196924 CTCCTGCCCCCACTCGCCCCAGG + Intergenic
903588777 1:24438460-24438482 CTCCTGCCCTCTCCCGTCCCTGG + Intronic
903594331 1:24482573-24482595 CTCATAGCCACCTCCGCCTCCGG - Intergenic
904190057 1:28736690-28736712 CTCCCCGCCCCCACCGCCCCAGG - Intronic
904378566 1:30096524-30096546 CTGGTGACCACCCCTGCCCCTGG + Intergenic
904541933 1:31239360-31239382 CTCCAGACCACCCCCCGCCCGGG + Intronic
904608582 1:31712734-31712756 CTCCTGCCCAGCCCCAGCCCAGG - Intergenic
904688275 1:32275694-32275716 CCCCGGGGCACCCCCGCGCCCGG - Intronic
904744566 1:32702878-32702900 CCCGTTCCCACCCCCGCCCCAGG - Exonic
904744772 1:32703656-32703678 CTCCCAGGCACCCCAGCCCCTGG - Intergenic
904883947 1:33721701-33721723 CTCCAGGCCACCCTAGCCCTGGG + Intronic
905046225 1:35004691-35004713 CGCCTCCCCACCCCCGCCTCAGG - Intronic
905247909 1:36627391-36627413 TGCCTTGCCACCCCTGCCCCCGG - Intergenic
905341554 1:37281893-37281915 CACCTGGACACTCCTGCCCCAGG + Intergenic
905447847 1:38038902-38038924 CTCCAGGCCAGCCCAGCTCCAGG + Intergenic
905886953 1:41496665-41496687 GTCCTGGCCGCCCAAGCCCCTGG + Intergenic
906296198 1:44650484-44650506 CGCCTGGCCAGCCCCGCAGCAGG - Intronic
906314235 1:44775949-44775971 CTCCCGGAGACCCCCGCGCCGGG - Intronic
906616409 1:47235611-47235633 CTCCTCGCCACCCCCACCCCAGG - Intergenic
906685498 1:47760828-47760850 CCCCTGCCCACCCCAGCCACTGG + Exonic
907093477 1:51752232-51752254 CCCCCCTCCACCCCCGCCCCCGG + Intronic
907385893 1:54125159-54125181 CTCCTGCCTCCCCCAGCCCCCGG + Intergenic
907512242 1:54970428-54970450 CTCCTGCCCCTCCCCGCCCCCGG + Intergenic
907927230 1:58966120-58966142 AACCTGCCCACCCCTGCCCCGGG - Intergenic
907977346 1:59444795-59444817 CTCCTCGCAACCCCCACCCATGG + Intronic
908175529 1:61552118-61552140 CCCATGGCCACCACCACCCCAGG + Intergenic
908631096 1:66108222-66108244 CACCTGCCCACCCCAGTCCCTGG + Intronic
908951699 1:69568736-69568758 CGCCCTGCCACCCCCGCCCCCGG - Intronic
908999152 1:70197570-70197592 CACCTGGCCCCCCCAACCCCCGG + Intronic
909592899 1:77371516-77371538 CTCATGGCCACCCACCCCACAGG + Intronic
910292911 1:85616329-85616351 CTCCTGGGCACGCCCGGCCGCGG + Intergenic
910425487 1:87116420-87116442 GTCCTGGCCAAGCCCACCCCTGG - Intronic
911166254 1:94727225-94727247 CTCATCCCCACCCCCGCCCATGG + Intergenic
912023650 1:105139016-105139038 CCCCTGTCCACCCACTCCCCTGG + Intergenic
912812776 1:112806366-112806388 CTCCTGGCCACACAAGCCTCAGG + Intergenic
912906625 1:113714508-113714530 CCCATGGCCACCGCTGCCCCAGG - Intronic
913966669 1:143382629-143382651 CTCCCAGCCACCCCCACCCAAGG - Intergenic
914061045 1:144208236-144208258 CTCCCAGCCACCCCCACCCAGGG - Intergenic
914118105 1:144758133-144758155 CTCCCAGCCACCCCCACCCAGGG + Intergenic
917402684 1:174668264-174668286 CTCCTGACCACCACAGCCTCTGG + Intronic
917746961 1:178019138-178019160 CTGCTGGCCCCACCTGCCCCAGG - Intergenic
919813999 1:201426413-201426435 CCCGTGGCCTCCCCAGCCCCGGG - Intronic
919981481 1:202644833-202644855 CTCCAGGCATCCCCTGCCCCAGG + Intronic
920022657 1:202967288-202967310 CTCCTGCCCGGCCCCGCCCCCGG - Intergenic
920067392 1:203278535-203278557 CTCCTGGCCAAGACCGGCCCCGG - Intergenic
920096691 1:203491180-203491202 CACCTTGCAACCCCCACCCCTGG + Exonic
920399493 1:205668303-205668325 CTGCTCGCCATCCCCGCTCCAGG + Intronic
920912770 1:210233340-210233362 CTTCTGACCCCACCCGCCCCTGG - Intronic
921292483 1:213671358-213671380 CACCTCCCCACCCCAGCCCCTGG - Intergenic
921365804 1:214372654-214372676 CTTCTGGCCACCCTTTCCCCTGG + Intronic
922237505 1:223733195-223733217 CTCCTGCACTCCCCCTCCCCTGG + Intronic
922571066 1:226634948-226634970 CACCTGGTCACCCAGGCCCCGGG - Intronic
922571217 1:226635660-226635682 TTCTTCACCACCCCCGCCCCGGG - Intronic
922586280 1:226737073-226737095 CTCTTGGCCTCCTCCGGCCCTGG + Exonic
922621925 1:226995169-226995191 TTCCTGTCCACCCCAGCCACGGG + Intronic
922744556 1:228036932-228036954 CTCCAGGCCTCGCCCGCTCCTGG - Intronic
923069103 1:230546545-230546567 CTCCTGGCCACCATTGGCCCAGG + Intergenic
923406809 1:233669085-233669107 CTACTGGCCATCACCACCCCAGG - Intronic
924502799 1:244652993-244653015 CGCCGGGCCGGCCCCGCCCCCGG + Exonic
1064033593 10:11898679-11898701 CTCCTGGTCACCCCATCCCAGGG - Intergenic
1064156931 10:12909979-12910001 CTCCTGGCCATCCGCCCTCCCGG + Intronic
1064987462 10:21225650-21225672 CCCATGGCCACCACCTCCCCAGG + Intergenic
1065925509 10:30431797-30431819 CTCCTCCCCAACCCCGGCCCAGG + Intergenic
1067393919 10:45893970-45893992 ATCCTCTACACCCCCGCCCCAGG + Intergenic
1067862242 10:49863103-49863125 ATCCTCTACACCCCCGCCCCAGG + Intronic
1068697372 10:59982216-59982238 CTCCCCTCCACCCCCGCCCCAGG - Intergenic
1068762940 10:60733166-60733188 CTCCTGGGGCCCCCCGGCCCGGG + Intronic
1069639240 10:69944194-69944216 CTCCTGGCCGCCCAGGCCCCTGG - Intronic
1069857207 10:71447872-71447894 CTCCATGCCAGCCCCACCCCAGG - Intronic
1069895429 10:71677545-71677567 CTCCTCGCCGCCCCCGTCCCGGG - Intronic
1069926837 10:71856304-71856326 CTGCTGCCCACCCCCGCTGCCGG - Intergenic
1069956805 10:72057031-72057053 CCCCTGCCCACCCCCTCCCTGGG - Intergenic
1070148788 10:73792779-73792801 CTCCTCCCCAGCCCCGCCCTCGG - Exonic
1070327883 10:75399940-75399962 CTCCGGGGCACCCCCGGCCGAGG + Exonic
1070785266 10:79158902-79158924 GTCCTGGCCTCCCCTCCCCCGGG + Intronic
1071217971 10:83429700-83429722 CACCTTGTGACCCCCGCCCCTGG - Intergenic
1071767862 10:88689356-88689378 CCCATGGCCACCACCACCCCAGG - Intergenic
1072679853 10:97498823-97498845 CACCTGCCTAACCCCGCCCCAGG - Intergenic
1072748375 10:97958181-97958203 CTCCTGGCTCCCTCAGCCCCAGG + Intronic
1073002694 10:100297273-100297295 CTCCTCTCCACCCCCACCACAGG + Intronic
1073035669 10:100562797-100562819 GTCCTCGGCAGCCCCGCCCCGGG - Intergenic
1073056792 10:100708317-100708339 CTCCTGGGAACCCCAGCCCCCGG + Intergenic
1073143007 10:101261362-101261384 CTCCCTACCACCCCCTCCCCCGG + Intergenic
1075194988 10:120348522-120348544 CTCATGGCCACCACCACCACAGG - Intergenic
1075399204 10:122149494-122149516 CTCCCGGCCCCACCCGCCCTGGG + Intronic
1075906068 10:126083130-126083152 CTCCTGGCCAGCCCCGCTCCAGG - Intronic
1075915399 10:126162220-126162242 CCCTTGGGCACCCCCTCCCCAGG - Intronic
1076706999 10:132307696-132307718 CTGCTGGCCAGCCCCGGGCCCGG - Exonic
1076980148 11:199828-199850 CTTCTGGCCACCTTGGCCCCAGG + Intronic
1077017617 11:403887-403909 CTCCTGGCCACCTGGGCACCTGG - Intronic
1077033835 11:484317-484339 CTCCTGTCCACTCCCCACCCTGG + Intronic
1077213321 11:1383369-1383391 CTCCCCGCCACCCCCGCTCCTGG - Intergenic
1077293953 11:1815350-1815372 CTCCTGGCCGCCCATGCCCCAGG - Intergenic
1077417614 11:2432160-2432182 CGCCTGGGCACCTCCTCCCCTGG - Intergenic
1077423250 11:2462768-2462790 CTCCAGGCCTTCCCTGCCCCCGG - Intronic
1077485194 11:2835234-2835256 CCACTGGCCACCCCAGCCGCAGG - Intronic
1078510334 11:11980014-11980036 CTCCAGGCCTCCCTCTCCCCGGG - Intronic
1078538228 11:12192289-12192311 CTCCTGGGCACCCAGGCTCCAGG + Intronic
1079128991 11:17736631-17736653 CTCCGGTCCACCCCTGCCCGCGG - Intronic
1080886855 11:36376017-36376039 CTGCAGCCGACCCCCGCCCCCGG - Exonic
1080966473 11:37219533-37219555 CTCATGGCCACCACTGCCCCAGG + Intergenic
1081804961 11:45885558-45885580 CACCCCGCCAGCCCCGCCCCCGG - Intergenic
1081994688 11:47355627-47355649 TTCCCGGCCACCCCGTCCCCGGG - Intronic
1083146404 11:60763060-60763082 CTCCCCGCCACCCCCGCTCGAGG + Intronic
1083172148 11:60929368-60929390 CTCCTTGCCACCCTCGCCGTAGG + Intronic
1083225423 11:61281638-61281660 CTCCTGGCCCCGCCCTACCCCGG - Intronic
1083638107 11:64131146-64131168 CTCCCTGTCACCCCCGCCCCAGG + Intronic
1083664030 11:64265116-64265138 CTGCAGCCCACCCCCGACCCAGG - Intronic
1083943312 11:65910336-65910358 CTCCTACCCACCCCCACCACAGG - Intergenic
1084152969 11:67299756-67299778 CCCCTGCCCACCTCCACCCCTGG - Intronic
1084420572 11:69058579-69058601 CTCCTGTCCCCGCCTGCCCCAGG + Intronic
1084641938 11:70431412-70431434 CTCCTGGCCCACCCCTCTCCGGG - Intronic
1084971277 11:72773409-72773431 CTCCTGGCAGCTCCCGCCCCTGG - Intronic
1085270760 11:75268676-75268698 CTCCTGGCCTCCCTCTCCCATGG + Intronic
1085304060 11:75475291-75475313 ATTCTCACCACCCCCGCCCCAGG - Intronic
1085507218 11:77067302-77067324 CTCGTCCCCACCCCCACCCCCGG + Intronic
1086337123 11:85811170-85811192 CTCCCCGCTACCCCCGCCCCCGG + Intergenic
1086569666 11:88267093-88267115 CCCATGGCCACCACTGCCCCAGG - Intergenic
1087196423 11:95308542-95308564 CCCCTCCCCACCCCAGCCCCTGG + Intergenic
1087375283 11:97332191-97332213 CTCCTGGCCACTCCAGCCCTAGG - Intergenic
1088944444 11:114495462-114495484 CTCATGGCCGCCCCTACCCCAGG + Intergenic
1089339055 11:117745220-117745242 CACGCAGCCACCCCCGCCCCAGG - Intronic
1089550643 11:119273846-119273868 CTCCTCTCCACCCCCTCCCCAGG + Exonic
1090259030 11:125305523-125305545 TTCTTGGGCACCCCCACCCCAGG + Intronic
1090271293 11:125388141-125388163 CCCCTTGCCACCCCCACCCCTGG + Intronic
1090612523 11:128484209-128484231 CCCCTGGCCACCTCCGTCCCTGG + Intronic
1091722570 12:2824030-2824052 CTCCTGGGCACCCGGGCCACTGG - Intronic
1092055304 12:5504005-5504027 CTCCCCACCACCCCAGCCCCCGG - Intronic
1092229020 12:6766673-6766695 CTCCCCGCCAGCCCCGGCCCCGG + Exonic
1094289620 12:28832585-28832607 CTCCTGCCCACCTCGGCCTCTGG - Intergenic
1094502826 12:31036065-31036087 CTCCTGGTCAGCACCGCCCATGG - Intergenic
1095956478 12:47809230-47809252 CTCCTTGTCACCCCAGCTCCTGG + Intronic
1095989881 12:48027382-48027404 CTCCTGCCTTCCCTCGCCCCAGG + Intergenic
1096078485 12:48818876-48818898 CTCCGGGCCGCTCCCGCCCCCGG + Exonic
1096468939 12:51864347-51864369 ATCCTGGGCGCCCCCGGCCCGGG + Intergenic
1098046802 12:66408906-66408928 CCCCTGGCCACCACTGCTCCAGG - Intronic
1098649023 12:72941167-72941189 CTCATGACCACCACCACCCCAGG + Intergenic
1099024554 12:77448598-77448620 CCCATGGCCACCACCACCCCAGG - Intergenic
1099245758 12:80191293-80191315 CAGCTGCCCACCCCCGCGCCTGG - Intergenic
1101328739 12:103740323-103740345 CTCCTTCCCACTCCCTCCCCAGG + Intronic
1102042710 12:109810815-109810837 CTCCTCCCCACCCCTACCCCAGG - Intronic
1102151145 12:110689538-110689560 CTCCGGGCCACCCCTGCCTCTGG + Intronic
1102664781 12:114562759-114562781 CTTCTGGCTACCCCCAGCCCAGG - Intergenic
1103301096 12:119927153-119927175 CCCCTCCCCACCCCCACCCCTGG - Intergenic
1103688624 12:122752701-122752723 CTCTTGGCCACGCCCCCCACCGG + Intergenic
1103700681 12:122847418-122847440 CTCCTGCCTTCCTCCGCCCCTGG + Intronic
1103782603 12:123409041-123409063 CTCCTGCCCACCCTGGTCCCAGG + Exonic
1103838662 12:123845099-123845121 CTCCTGGGCTCCAGCGCCCCTGG + Intronic
1103856029 12:123972306-123972328 CCCGGGGCCACCCCTGCCCCTGG + Intronic
1103921339 12:124400816-124400838 CCCCTGGCCACCCTCACCTCAGG - Intronic
1103930759 12:124449629-124449651 CTGCTCCCCACCCCCACCCCAGG + Intronic
1103949293 12:124542472-124542494 CTCCAGGCCACCTCTGCCCTGGG + Intronic
1104709777 12:130977430-130977452 CTCCTGGCCACACCAGGCACAGG + Intronic
1105217880 13:18300061-18300083 CTCCTGCCCACCCTGGTCCCAGG + Intergenic
1105715426 13:23057797-23057819 CACCTGGGCACTCCAGCCCCTGG + Intergenic
1105964528 13:25372323-25372345 CCCCGCGCCGCCCCCGCCCCGGG - Intronic
1106735793 13:32586781-32586803 CGCCCCGCGACCCCCGCCCCGGG - Intronic
1107940284 13:45376860-45376882 CTTCTGGCAGCCCCAGCCCCGGG - Intergenic
1107941296 13:45380873-45380895 CTTCTGGCAGCCCCAGCCCCGGG - Intergenic
1110892185 13:80706764-80706786 CTTCTGGCCGCCCCAGCCCTGGG + Intergenic
1113517670 13:110915428-110915450 CTCCAGGCGCCCACCGCCCCAGG - Intergenic
1113707329 13:112443350-112443372 ACCCTGGCCACCCCTGTCCCAGG + Intergenic
1113805196 13:113107830-113107852 CCCCGGGACACCCACGCCCCCGG - Intronic
1113805204 13:113107847-113107869 CCCCGGGACACCCACGCCCCCGG - Intronic
1113805211 13:113107864-113107886 CTCCGGAACACCCACGCCCCCGG - Intronic
1113805226 13:113107915-113107937 CCCCGGGACACCCACGCCCCTGG - Intronic
1113805349 13:113108255-113108277 CCCCGGGACACCCACGCCCCCGG - Intronic
1113805430 13:113108477-113108499 CTCCGGGACACCCACGCTCCTGG - Intronic
1113805693 13:113109192-113109214 CCCCCGGACACCCACGCCCCTGG - Intronic
1115689223 14:35826377-35826399 CTCCTCCCCGCCCCCGGCCCGGG - Exonic
1116677665 14:47926584-47926606 CCCATGGCCACCACTGCCCCAGG + Intergenic
1117351232 14:54883824-54883846 CTCCACCCCACCCCTGCCCCAGG - Intronic
1117721333 14:58631752-58631774 CCTCTGGCCGCCCCCGCCCAGGG - Intergenic
1118807628 14:69251576-69251598 CTGCTGGCTACCCCTGCCGCCGG - Intergenic
1119385771 14:74257432-74257454 CCCCCGGCCTCTCCCGCCCCGGG - Intronic
1119656931 14:76423886-76423908 CTCCTGCCCACTCTCCCCCCAGG - Intronic
1119761602 14:77155605-77155627 CTCCGCGCCACTCCCACCCCAGG - Intronic
1121714940 14:96067121-96067143 CTTCTGGGCACCCCAGCACCTGG - Intronic
1121912363 14:97802978-97803000 CCCCTGCCCACCCTCCCCCCAGG - Intergenic
1122092395 14:99349102-99349124 CTCCTGGTCCCCACAGCCCCTGG + Intergenic
1122347776 14:101071170-101071192 GATGTGGCCACCCCCGCCCCAGG - Intergenic
1122363417 14:101180785-101180807 CTCTGGGTCACCCCCCCCCCCGG + Intergenic
1122470800 14:101964702-101964724 GTCCTCGCCGCCGCCGCCCCCGG - Exonic
1122635652 14:103128477-103128499 CCCCTGGACTCCCCCGCCCTGGG - Intronic
1122690856 14:103531610-103531632 CACCTGTCCAGCCCCTCCCCTGG - Intronic
1122784579 14:104157869-104157891 GCCCTGGTCACCCCCACCCCGGG + Exonic
1122822960 14:104356277-104356299 CCCCTGTCCCCACCCGCCCCTGG + Intergenic
1122857499 14:104566945-104566967 CTCCTGGGGAACCCTGCCCCCGG - Intronic
1122955699 14:105069924-105069946 GTCCTGGCCTCTCCCACCCCTGG + Intergenic
1123025662 14:105422501-105422523 CTCCTGTGCCCCCCCACCCCAGG + Intronic
1123578450 15:21695427-21695449 CTCCTGGGCACCCTTGCCCTAGG - Intergenic
1123615075 15:22137909-22137931 CTCCTGGGCACCCTTGCCCTAGG - Intergenic
1124362015 15:29044590-29044612 CTCCTGGCCACACCCCCCCTGGG + Intronic
1124496519 15:30190979-30191001 CACCTTGCCACCCCCTGCCCCGG + Intergenic
1124617820 15:31255238-31255260 CTCCTGGCTGCCCCTGCTCCTGG - Intergenic
1124653518 15:31489484-31489506 GTCTTAGCCACCCCGGCCCCAGG + Intronic
1124747056 15:32347669-32347691 CACCTTGCCACCCCCTGCCCCGG - Intergenic
1125462942 15:39923352-39923374 CTCCCTGCAACCTCCGCCCCTGG - Intergenic
1125522400 15:40355616-40355638 CTCCTGTCTCCCCCTGCCCCTGG + Intronic
1125687564 15:41572572-41572594 CTCCTGGCCACCCCCACACCAGG - Intronic
1126660670 15:51030450-51030472 CTCATGGCCACCATTGCCCCAGG + Intergenic
1127783394 15:62335469-62335491 CCCATGGCCACCACCACCCCAGG + Intergenic
1128091975 15:64925462-64925484 TTCCTGTCCACCCCCAACCCAGG + Intronic
1128224534 15:65992835-65992857 CACCTGGCCACACCTGCCCTTGG - Intronic
1128761358 15:70218118-70218140 CTCCTGGACCCCACTGCCCCTGG + Intergenic
1128839197 15:70835995-70836017 CTCCTGGCCACCCACTTGCCTGG + Intronic
1129228310 15:74182464-74182486 CCCCCTGCCACTCCCGCCCCTGG - Intronic
1129668186 15:77591443-77591465 CTCCTCGACACCCCCTCACCAGG - Intergenic
1129710651 15:77818970-77818992 CTCCCGGCCCGCCGCGCCCCAGG + Intronic
1129761576 15:78131740-78131762 CTCGCTGCCGCCCCCGCCCCAGG - Intronic
1130056216 15:80528182-80528204 GTCCTTGCCACCCCCGCCTGTGG - Intronic
1130127995 15:81110473-81110495 CTCCTGGTCACCCTTGCCTCTGG + Intronic
1130990938 15:88875238-88875260 CCCCTCCCCACCCCCGCCCCCGG + Exonic
1130994608 15:88896926-88896948 CTGCTGGCTACCCCTACCCCTGG - Intergenic
1131087216 15:89587237-89587259 GTCCTCACCACCCCAGCCCCTGG - Intronic
1131987948 15:98064100-98064122 ATCCTGACCACCCCCACCACTGG - Intergenic
1132234974 15:100212840-100212862 CTCCACCCCACCCCCGCCCCAGG - Intronic
1202987320 15_KI270727v1_random:429672-429694 CTCCTGGGCACCCTTGCCCTAGG - Intergenic
1132466120 16:78124-78146 CACGTGGCCCGCCCCGCCCCGGG + Intronic
1132475950 16:138286-138308 CCTCTGGCCCCCTCCGCCCCCGG - Exonic
1132797276 16:1731253-1731275 CTCGCTGCCACCTCCGCCCCTGG - Intronic
1132841320 16:1979697-1979719 CTCCTGGCCCGCCCTGCCCGCGG + Exonic
1132870766 16:2114806-2114828 CTCCCGGCCACCCTGGTCCCCGG - Exonic
1132880957 16:2161501-2161523 GTCCTGGCCACCTGGGCCCCCGG + Intronic
1132883812 16:2173687-2173709 CCCCTGCCCACCCCTGGCCCAGG + Intronic
1132883858 16:2173858-2173880 CTCCCGCCCACCCTCCCCCCCGG + Intronic
1132928941 16:2448793-2448815 CTCCGCCCCACCCCTGCCCCAGG + Intronic
1132981453 16:2740400-2740422 CTCTTGGCCACTACCTCCCCAGG + Intergenic
1132995208 16:2819137-2819159 CTTCTGGCCCCCACAGCCCCTGG - Intronic
1133022511 16:2973105-2973127 GCCCTGCCCACCCCAGCCCCTGG + Exonic
1133155881 16:3875528-3875550 CTCCTGGCTGCCCCCACCACAGG + Intronic
1133834121 16:9351301-9351323 CCCTTGGCCACCACTGCCCCAGG + Intergenic
1134406979 16:13969561-13969583 CCCATGGCCACCACCACCCCAGG + Intergenic
1135135831 16:19884932-19884954 CCCCCGGCCGGCCCCGCCCCCGG + Intronic
1136188241 16:28600705-28600727 CTTCGGGCCTCCCCGGCCCCAGG - Intergenic
1136190713 16:28613699-28613721 CTTCGGGCCTCCCCGGCCCCAGG - Intronic
1136316187 16:29455759-29455781 CTTCGGGCCTCCACCGCCCCAGG + Exonic
1136394836 16:29987208-29987230 CTGCAGGCCACCCCCACCCTGGG - Exonic
1136430764 16:30195101-30195123 CTTCGGGCCTCCACCGCCCCAGG + Exonic
1136556643 16:31010892-31010914 CGCCGGGCCACCCCACCCCCCGG - Intergenic
1136563425 16:31054946-31054968 CTCATGGCAACCTCCACCCCTGG - Intergenic
1137456613 16:48622749-48622771 CTGCTAGCAACCCCCACCCCAGG - Intergenic
1137781902 16:51104267-51104289 CTTCAGGCCACCCCCACCACAGG - Intergenic
1139577565 16:67851650-67851672 CTCCCCGCTACCCCCGCCCCAGG + Intronic
1139807252 16:69577625-69577647 ATCCTGCCCACTCCAGCCCCAGG - Intronic
1139896230 16:70289752-70289774 CCCCCGCCCCCCCCCGCCCCCGG + Intronic
1139924145 16:70476548-70476570 CTCCTGGCCACCGAGCCCCCTGG + Intronic
1140043346 16:71424111-71424133 CTCATAGCCACCCCTGCCCCTGG + Intergenic
1141075954 16:81006883-81006905 CTCCTCGCCCCCGCCGCCCGCGG + Exonic
1141180392 16:81748974-81748996 CTCCTGCCACCCCCCGCCACAGG - Intronic
1141453447 16:84121160-84121182 AGCCTGCCCACCCCCTCCCCCGG + Intergenic
1141554980 16:84831113-84831135 CCCATGGGCACCCCCGGCCCTGG - Intronic
1141609025 16:85170875-85170897 CCCCTGGACAGCCACGCCCCCGG + Intergenic
1141615235 16:85206503-85206525 GGCCTGGACACCCCCTCCCCAGG + Intergenic
1141817922 16:86425488-86425510 GTCCTGGGCACCCCTGCCTCTGG - Intergenic
1141995316 16:87633373-87633395 GTCCTACCCACCCCCACCCCCGG - Intronic
1142179823 16:88662970-88662992 CTCCCGGCCATCCCCGTCCCAGG + Intronic
1142203990 16:88774013-88774035 CTCCAGGCCTCCCTCTCCCCTGG + Intronic
1142219850 16:88848753-88848775 CACGCTGCCACCCCCGCCCCCGG - Intronic
1142222399 16:88861974-88861996 CCCCAGGCCTCCCCCGCCCCAGG + Exonic
1142413127 16:89926174-89926196 CTGCAGGCGAACCCCGCCCCGGG - Intronic
1142469575 17:155870-155892 CTCCTGGCTACCCCCGGCACTGG + Intronic
1142712572 17:1731295-1731317 CTCCTGGGCAGCCCCTCCGCTGG - Intronic
1142766044 17:2064895-2064917 GTCCTGGCTCCCCCAGCCCCAGG - Intronic
1142810330 17:2393047-2393069 CTCCTCGCCACCCCTCCCACGGG + Intronic
1143107312 17:4536184-4536206 GCCCTGGCCAGCCCCACCCCGGG - Intronic
1143493130 17:7295083-7295105 CTTCCGGCCACCACCGCCCTTGG + Intergenic
1143950537 17:10629172-10629194 CCCCTTGCCGCCCCCACCCCCGG + Intronic
1144734276 17:17546287-17546309 CTGCTGGACACCACTGCCCCTGG + Intronic
1145067018 17:19768522-19768544 CTGCTGGCCACACCAGCCTCAGG + Intergenic
1146079035 17:29760929-29760951 CTTCCGTCCACCCCCACCCCGGG + Intronic
1146668032 17:34717648-34717670 CTCCTGTCCCCTCCCGCCCCAGG + Intergenic
1146774148 17:35597069-35597091 CCCCTGGGCGCCCCCGCTCCGGG + Intronic
1147164141 17:38584497-38584519 TTCCCGGCCACCCCAGCCTCAGG - Intronic
1147170258 17:38614367-38614389 CTCCTGGCCTCTCCCGCTCTGGG + Intergenic
1147311752 17:39599672-39599694 CTCCTGGCCAGCTCAGCCTCAGG + Intergenic
1147315903 17:39620119-39620141 CTCCATCCCACCCCAGCCCCTGG - Intergenic
1148123496 17:45225346-45225368 CCCCTGGCCACTCCCACCTCCGG + Intronic
1148148747 17:45383591-45383613 CCCCACGCCACCCCAGCCCCTGG - Intergenic
1148837602 17:50474110-50474132 CTCCTGGCCAGGCCAGCCCCTGG + Intronic
1148862908 17:50613869-50613891 CTCCTGTCCTCCCTTGCCCCAGG + Intronic
1148864547 17:50621818-50621840 CTCCCGGCCACCCCCGGGGCTGG + Intronic
1148871050 17:50658977-50658999 CTCCTCCCCACCCCAGGCCCTGG - Intronic
1149692408 17:58589038-58589060 CTCCTGGCCTCCGCCTGCCCTGG - Intronic
1150137655 17:62704341-62704363 CGCGCGGCCACCCCCGACCCCGG - Intronic
1150643742 17:66965624-66965646 CCCCCGGCCGGCCCCGCCCCAGG - Intronic
1150747322 17:67825991-67826013 CTCCTCGCCCCCCCCGGCCCGGG - Exonic
1150862347 17:68813994-68814016 CCCCTAGCCACCCCAGCCTCTGG + Intergenic
1151565200 17:74893698-74893720 CGCCTGGGGACACCCGCCCCCGG + Intronic
1151703883 17:75756872-75756894 CCCCTGGCCACTCCTGCCCCCGG - Intronic
1151842319 17:76627166-76627188 CTCCTGGCCAGCCTCCCCGCTGG - Exonic
1151935148 17:77256810-77256832 CTCCAGGGCACCCCTCCCCCAGG - Intergenic
1151942331 17:77300677-77300699 ATCCTGGACGCCCCCACCCCAGG + Intronic
1152184156 17:78843667-78843689 CTCCTGGCCGCCACCTGCCCGGG - Intergenic
1152226986 17:79097262-79097284 CTCCACGCCTCCCCCGGCCCAGG + Intronic
1152280123 17:79380189-79380211 CCCCTTGCCACCCCTCCCCCAGG + Intronic
1152319259 17:79599025-79599047 CTCCATGCCTCCCCCTCCCCAGG + Intergenic
1152352699 17:79792333-79792355 CCCCTGCCCACCCACCCCCCAGG + Exonic
1152363244 17:79841976-79841998 CCCCCGGCCACCCCCGCTCCTGG + Intergenic
1152389133 17:79992405-79992427 CCCCTGGCCCCACCGGCCCCAGG - Intronic
1152560531 17:81076449-81076471 CTCCTGGCAAGCACAGCCCCGGG - Intronic
1152650084 17:81488580-81488602 CTCCTGGCCTCGGCCCCCCCGGG + Intergenic
1152662718 17:81550420-81550442 CACGCGGCCACCCCCGCCACAGG + Exonic
1152677409 17:81648596-81648618 CTCCTGGCACCTCCCTCCCCTGG + Exonic
1152697063 17:81802827-81802849 GTCCTGGCCACCCTCACCCTGGG - Intergenic
1152715755 17:81899736-81899758 CTCCTGACCAGCCCGCCCCCAGG - Intronic
1152750037 17:82058458-82058480 CTGCTGGCCAGCCTGGCCCCGGG - Intronic
1152779170 17:82218848-82218870 GTCCTGCCCACCCCAGCGCCTGG - Intergenic
1152918190 17:83052513-83052535 CTCCTGGGCACCCCTCCTCCTGG - Intergenic
1152918209 17:83052564-83052586 CTCCTGGGCACCCCTCCTCCTGG - Intergenic
1152918269 17:83052717-83052739 CTCCTGGGCACCCCTCCTCCTGG - Intergenic
1152918311 17:83052819-83052841 CTCCTGGGCACCCCTCCTCCTGG - Intergenic
1153814988 18:8784054-8784076 CTCCTAGCCAGCCCGGCTCCCGG - Exonic
1153900672 18:9614660-9614682 CTCCCGGCCGCCCGGGCCCCCGG + Intronic
1154295207 18:13141413-13141435 CTCCAGGCCTGCCCCGCCTCGGG + Intergenic
1154330037 18:13421859-13421881 CTCCTGCCCACCCCAGCCCCAGG - Intronic
1155320386 18:24613096-24613118 CTGCTGCCCACCCCAGCCCTAGG + Intergenic
1157487044 18:48095376-48095398 CTGCTGGCCAACCCTGCTCCAGG - Intronic
1157585921 18:48801094-48801116 TTCAGGGCCACCCCCACCCCCGG + Intronic
1158533018 18:58280374-58280396 CTCCTGACCAGGCCAGCCCCTGG - Intronic
1158666799 18:59439746-59439768 CTCCTGGGCAGCCCGGCCCACGG - Exonic
1159961109 18:74556388-74556410 CTCCTCACCCTCCCCGCCCCCGG + Exonic
1160032949 18:75278439-75278461 CTCCTGGCCGCCTTCTCCCCAGG + Intronic
1160429411 18:78801192-78801214 GTCCTAGCCACCCCCGGGCCTGG - Intergenic
1160708298 19:539984-540006 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708313 19:540021-540043 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708328 19:540059-540081 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708344 19:540097-540119 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708359 19:540135-540157 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708376 19:540173-540195 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708393 19:540211-540233 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708410 19:540249-540271 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708426 19:540286-540308 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708443 19:540324-540346 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708460 19:540362-540384 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708477 19:540400-540422 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708494 19:540438-540460 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708511 19:540476-540498 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708528 19:540514-540536 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708545 19:540552-540574 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708562 19:540590-540612 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708579 19:540628-540650 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708596 19:540666-540688 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708611 19:540704-540726 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160708654 19:540815-540837 GGCCTGGCCACCCCGGCCTCCGG - Intronic
1160726754 19:620890-620912 CTCCTCCCCTCCCCCTCCCCTGG - Intronic
1160726773 19:620931-620953 CTCCTCCCCTCCCCCTCCCCTGG - Intronic
1160960528 19:1718780-1718802 CTCCCAGCCTCCCCCTCCCCCGG + Intergenic
1160996015 19:1882175-1882197 CTGCTGCCCACTCCCTCCCCCGG + Intronic
1161219915 19:3113755-3113777 CTCCTGGCCACCCTCGGTGCTGG + Intronic
1161264670 19:3358789-3358811 CCCCAGGGGACCCCCGCCCCAGG + Intergenic
1161280325 19:3442165-3442187 CTCCTGGCCGCCTCCACCCGAGG + Intronic
1161619600 19:5291156-5291178 CTCCTGGCCACCAGGACCCCTGG - Intronic
1161808680 19:6459422-6459444 CTCCCGGCCCCGCCCGCTCCCGG - Intronic
1161963460 19:7535227-7535249 CGCCTGTCCAACCCCACCCCGGG - Intronic
1162019634 19:7862731-7862753 CTCCTGACCACCCCCCCCCGCGG + Intronic
1162082822 19:8228948-8228970 CTCATTGCAACCTCCGCCCCAGG - Intronic
1162571982 19:11479564-11479586 TAACTGGCCAGCCCCGCCCCCGG + Intronic
1162718555 19:12648402-12648424 CTCCTGGCCACTCTCCCCCCAGG - Exonic
1162751833 19:12834052-12834074 CTCCTGCCCAGCCCCGCCCCAGG - Intronic
1163007938 19:14408023-14408045 TTCCTGCCCACACCCGCCCCAGG - Intronic
1163262311 19:16198434-16198456 CGCCTCGCCACCCCCGGCCAAGG - Intronic
1163371686 19:16904443-16904465 GTACTGGCCACCCCAGCTCCCGG - Intronic
1163464002 19:17455671-17455693 CTCCTCCCCACCCCCTCCCCCGG + Exonic
1163476930 19:17532079-17532101 CTCCTGGAGCCCCCCGCCCTGGG - Intronic
1163687147 19:18718155-18718177 CTCCTCTCCTCCCCAGCCCCTGG + Intronic
1163694559 19:18757389-18757411 TTCCTGGGCACCCCCTCCCCAGG + Intronic
1163726782 19:18927726-18927748 CTCCTCCCCACCCCCACCCCCGG + Intronic
1164643423 19:29842608-29842630 CTCCCCTCCACCCCCGGCCCAGG - Intergenic
1165154805 19:33780547-33780569 ATCCTGGCCACTGCCACCCCTGG - Intergenic
1165774385 19:38396108-38396130 CTCGTGGCGACCCCCGCAGCCGG - Exonic
1165992686 19:39825555-39825577 CTCCTTGACCCCCCTGCCCCAGG + Exonic
1166043833 19:40218047-40218069 GGCCTGCCCGCCCCCGCCCCCGG - Exonic
1166083271 19:40458312-40458334 CCCAGCGCCACCCCCGCCCCCGG - Intronic
1166185080 19:41134565-41134587 CTCCAGCCCACCCCCAGCCCTGG - Intergenic
1166344172 19:42155063-42155085 CACCTGGCCCCCCACCCCCCAGG - Intronic
1166505240 19:43367266-43367288 CTCCTGGGCACACCTGGCCCTGG + Intergenic
1166509317 19:43393829-43393851 CTCCTGGGCACACCTGGCCCTGG - Intergenic
1166524313 19:43501649-43501671 CTCCTAGCCACCTGCGCCCCGGG - Intronic
1166694400 19:44844631-44844653 CTCCGTGGCACCCCCTCCCCCGG + Intergenic
1167293192 19:48635614-48635636 CTCCTGGGCACGCCCCCGCCCGG - Exonic
1167381727 19:49142216-49142238 CCCATGGCCACCCCCACCTCTGG - Intronic
1167504420 19:49863613-49863635 CTCCTGGGCTCCCCGGCCTCCGG - Intronic
1168082308 19:54019119-54019141 CTCCTGGTCACCCATGACCCGGG - Intergenic
1168092673 19:54095955-54095977 CTGCTGGGCGCCCGCGCCCCCGG - Exonic
1168405200 19:56107080-56107102 CCCCTGGCCACCCCACCCCACGG + Intronic
1168659923 19:58157580-58157602 CTCCCCGCAACCCCCGCCCTGGG + Intergenic
1202700453 1_KI270712v1_random:160124-160146 CTCCCAGCCACCCCCACCCAAGG - Intergenic
925028091 2:625315-625337 GTCCTGCCCACCCCAGCCCCAGG + Intergenic
925069101 2:951792-951814 CACGTGGCCACCCCAGCCCTAGG + Intronic
925299219 2:2798516-2798538 CACCTGGCCATCCCAGCCACAGG + Intergenic
925351960 2:3207366-3207388 CTCCGGGCCTCCCCCGGCTCAGG + Intronic
925380681 2:3423503-3423525 CTCCTCCCCACCCCCAGCCCCGG + Intronic
925624349 2:5827153-5827175 CTCAGGGCCACACCCGTCCCTGG - Intergenic
925691238 2:6525528-6525550 GTCCTAGGCACCCCCACCCCCGG + Intergenic
925919000 2:8626421-8626443 TTCCTGCCCACCCCCAACCCAGG - Intergenic
926090116 2:10043943-10043965 CTCCTCGCCCCCGCCGACCCGGG - Intronic
927285880 2:21356278-21356300 CTCCTGAGGACCCCCACCCCGGG - Intergenic
927574563 2:24190565-24190587 CTGCATGCCAGCCCCGCCCCAGG - Exonic
927718531 2:25368114-25368136 CTCCTGCCCACCTCGGGCCCAGG - Intergenic
927823243 2:26287853-26287875 CTCCTCCCCACCTCTGCCCCAGG + Intronic
927854263 2:26518037-26518059 CTCCCTGCCACCCCTGCCCATGG + Intronic
927947633 2:27146703-27146725 CTCATTGCAACCTCCGCCCCCGG + Intergenic
928094179 2:28393800-28393822 CTGCTGGCCGCCGCCGCCGCTGG - Exonic
928458603 2:31448820-31448842 GTCCTGGGCACCCTCTCCCCTGG - Intergenic
929460934 2:42101624-42101646 CGCGTGGCCGCCCCCGGCCCAGG + Intergenic
930209272 2:48617739-48617761 CTTCTGCCCAGCCACGCCCCCGG + Intronic
930647690 2:53929290-53929312 CCCCTGACCACCCCCAACCCTGG + Intronic
931021235 2:58046978-58047000 CTCCGGGCCGTCCCAGCCCCCGG + Intronic
931165940 2:59747910-59747932 TTTCTGGTCACCCCAGCCCCAGG - Intergenic
931587722 2:63846236-63846258 CTGCTGATGACCCCCGCCCCTGG - Intronic
932126120 2:69146862-69146884 GTCCTGGCCACCCTTTCCCCTGG + Intronic
932152717 2:69387437-69387459 TTCCTGGAGACGCCCGCCCCGGG + Intergenic
932449830 2:71802313-71802335 CTCCTGTCCACCCCTCCTCCAGG - Intergenic
932479458 2:72030334-72030356 CACCTGGCTACCACCACCCCTGG + Intergenic
932648747 2:73532496-73532518 CCCATGGCCACCACTGCCCCAGG + Intronic
934171381 2:89543597-89543619 CTCCCAGCCACCCCCACCCAAGG - Intergenic
934281690 2:91617915-91617937 CTCCCAGCCACCCCCACCCAAGG - Intergenic
934296424 2:91746604-91746626 CTCCTGCCCACCCTGGTCCCAGG - Intergenic
934532897 2:95106701-95106723 CTCCTGGCCCCTCCAGACCCTGG + Intronic
934602606 2:95669443-95669465 CTCCCCACCACCCCTGCCCCTGG + Intergenic
934983656 2:98868988-98869010 ATGGTGGCCACCCACGCCCCGGG + Intronic
935762543 2:106334696-106334718 TTCCAGACCACCCCCCCCCCAGG - Intergenic
936535981 2:113311634-113311656 CTCCCCACCACCCCTGCCCCTGG + Intergenic
937357259 2:121205844-121205866 CCCCTGGCCACCCCCAGGCCCGG + Intergenic
938058403 2:128233597-128233619 CTCCTCGCCACCCAGTCCCCGGG - Intergenic
938068342 2:128293605-128293627 CTCCAGGCCATACCAGCCCCTGG - Intronic
938104591 2:128521236-128521258 CTCCTGGCTCTCCCCTCCCCAGG + Intergenic
938463622 2:131513038-131513060 CCACTGTCCACCCCTGCCCCCGG - Intergenic
940402293 2:153261827-153261849 CCCGTGGCCACCACCACCCCAGG + Intergenic
940971995 2:159904845-159904867 CACCTGGCCCGCTCCGCCCCGGG - Intergenic
941029518 2:160494255-160494277 CTCCCACCCACCCCCGACCCGGG + Intergenic
941096668 2:161245100-161245122 TTCCCGGCCTCCCCCGACCCCGG - Intergenic
941951308 2:171160201-171160223 CCCCCCGCCCCCCCCGCCCCGGG - Intronic
942173882 2:173312742-173312764 CTCCTGCCCACCCTGGTCCCAGG + Intergenic
944811242 2:203328876-203328898 CTCCTCGCCGCTCCCGCCCTCGG + Intronic
945461610 2:210116165-210116187 CCCATGGCCACCACTGCCCCAGG - Intronic
946395523 2:219442093-219442115 CTCCCGGCGCCGCCCGCCCCCGG - Intronic
946865672 2:224039344-224039366 CTTCCTGCCGCCCCCGCCCCCGG + Intergenic
948040915 2:234900839-234900861 CCCCTGCCCACCCTCGCCCTGGG + Intergenic
948467433 2:238159062-238159084 CTGCTGGCCGCCGCCGCCGCGGG + Exonic
948524094 2:238559802-238559824 CCATTGGCCACCCCCGCCGCAGG - Intergenic
948599855 2:239101861-239101883 GCCCTGGACACCCCCGGCCCCGG + Intronic
948642253 2:239383193-239383215 CCCGTGGCCACCCCTGACCCTGG + Intronic
948867239 2:240782346-240782368 CTCCCAGCAGCCCCCGCCCCAGG + Intronic
948888439 2:240895635-240895657 CTCCAGGCCAGCCCCTTCCCTGG + Exonic
948910108 2:240998604-240998626 TTCGGGGCCAGCCCCGCCCCTGG - Intergenic
1168810176 20:699892-699914 TTCTGGGCCACCCCCGCCCCCGG - Intergenic
1168933570 20:1644574-1644596 ATCCTGGCCACCCCTTCCCCTGG + Intronic
1169338991 20:4781685-4781707 CTCCCCACCACCCCCACCCCGGG - Exonic
1170062814 20:12276879-12276901 CCCATGGCCACCACTGCCCCAGG - Intergenic
1170119274 20:12894246-12894268 CTCCAGGCCAGCCTCGCCTCTGG + Intergenic
1170156611 20:13274664-13274686 CTCCCCGCCCCCCCCGCGCCCGG + Intronic
1171011499 20:21511856-21511878 CTCCTCGCCGCCACCGCCGCCGG + Exonic
1171848205 20:30290587-30290609 CCCCAGGCCGGCCCCGCCCCCGG - Intergenic
1172034565 20:32001991-32002013 CTCCTTTCCTCCCCAGCCCCAGG - Exonic
1172097265 20:32466559-32466581 CTCCTGGCCTCCCCTCCCCCAGG - Intronic
1172100878 20:32483520-32483542 CTCCTGGCCACCCCCGCCCCCGG - Intronic
1172714219 20:36951227-36951249 CTCCTGGGAACCCCCGCCGCAGG + Intronic
1173664469 20:44754715-44754737 CTCCTCTCCACCCCCGGTCCTGG + Intronic
1174046942 20:47740463-47740485 CCCTGGGCCACCCCCACCCCTGG - Intronic
1174186219 20:48708212-48708234 CTCCTGGCCCCCTGCGGCCCAGG + Intronic
1174390545 20:50216135-50216157 GACCGGGCCACCCCCTCCCCGGG - Intergenic
1174424118 20:50420048-50420070 GTCCTGACCATCCCGGCCCCGGG + Intergenic
1174466954 20:50725083-50725105 CTCCAGACCCCCCCTGCCCCGGG + Intergenic
1174938595 20:54898741-54898763 CCCATGGCCACTCCCACCCCAGG - Intergenic
1174992181 20:55522976-55522998 ATTATGGCCACCCCTGCCCCTGG + Intergenic
1175186330 20:57181714-57181736 CTCCAGGCCACCCACATCCCAGG + Intronic
1175199116 20:57266156-57266178 CTCCGGGCCCGCACCGCCCCAGG + Exonic
1175208412 20:57329730-57329752 CGCCTGTCCAGCCCCGCCTCTGG + Intergenic
1175404240 20:58716563-58716585 CCCCTGGCCACCCCACCCCAAGG + Intronic
1175765481 20:61589938-61589960 CTCCTGGCCGCCCCCTCTCAAGG - Intronic
1175883190 20:62272226-62272248 CTCCTGCCAGCCCCAGCCCCTGG + Exonic
1175964236 20:62652442-62652464 CTCCTCGTCAGTCCCGCCCCGGG + Intronic
1175969758 20:62678889-62678911 TTCCTCTCCACCCCAGCCCCTGG - Intronic
1175982059 20:62743569-62743591 CTCCTGTCCACACCCTCCCAAGG - Intronic
1176096035 20:63345008-63345030 CTGCTGGTCACCCCCACCCCCGG - Exonic
1177894550 21:26844434-26844456 CGCCTCGCCACCGCCGCCCCAGG - Exonic
1178931781 21:36825622-36825644 CCCCAGGTCACCCCCGCCCCAGG + Intronic
1179162489 21:38909722-38909744 TTCCTGGGGACCCCCACCCCAGG - Intergenic
1179181305 21:39047504-39047526 CTCCTGGCCCCTCCCCTCCCTGG + Intergenic
1179500205 21:41804036-41804058 CTCATTGCAACCTCCGCCCCTGG + Intronic
1179902332 21:44400625-44400647 TTCCTGGCCTCCCCAACCCCAGG - Intronic
1179960555 21:44765031-44765053 CTCCTGGACACGCCCACCACAGG + Intergenic
1180013983 21:45071166-45071188 GTCCTGGCCACCGCGGCCCAGGG + Intergenic
1180064869 21:45407113-45407135 CTCCAGGCCACCCGCAGCCCGGG + Intronic
1180109430 21:45641220-45641242 CTGCAGGGCAGCCCCGCCCCAGG - Intergenic
1180706100 22:17810857-17810879 CTGCTGCCCACCCCTGTCCCAGG - Intronic
1180749442 22:18114019-18114041 CTCCTGCCCACCCCCATCACTGG - Intronic
1180865358 22:19115520-19115542 CTCCTCGCCACCCCCACCAGAGG + Intronic
1180866272 22:19121865-19121887 CTCCTGGCCGCCGCCGCTCCCGG + Intronic
1180954248 22:19734478-19734500 CTCTTGGCCACCCTCTGCCCTGG + Intergenic
1181038032 22:20179263-20179285 CTCCTGAGCACCCCATCCCCAGG + Intergenic
1181040898 22:20192175-20192197 CTCATGCCCAACCCTGCCCCTGG - Intergenic
1181441226 22:22936040-22936062 GTCCTGGCCACCCCCCTCCCTGG - Intergenic
1181478114 22:23180875-23180897 CGCCTCGCCAGCCCGGCCCCGGG - Exonic
1182279180 22:29208283-29208305 TCCCAGGCCACCCCCTCCCCAGG - Intronic
1183093355 22:35538570-35538592 CTCCTGCCCTCCCCCACTCCTGG - Intergenic
1183319253 22:37155150-37155172 CTGCTGGCCACCCATGCCTCTGG - Intronic
1183710164 22:39498639-39498661 CTCCTCCCCACCCCCTCCCAGGG - Intergenic
1184411869 22:44330803-44330825 GGCCGGGCCACCCCAGCCCCGGG + Intergenic
1185143039 22:49114036-49114058 TGTCTGGCCAACCCCGCCCCAGG + Intergenic
1185275637 22:49949233-49949255 CTCCTGCCCAGCCACGCCCCAGG - Intergenic
1185317727 22:50186107-50186129 GGCCTGACCCCCCCCGCCCCCGG - Intronic
1185347649 22:50317429-50317451 CTCCTTGCCACTCCCAGCCCTGG - Intronic
1185409411 22:50674361-50674383 CCCCCCGCCGCCCCCGCCCCCGG + Intergenic
1185414505 22:50702535-50702557 CCCCTGACCACCCCCGCTCCTGG + Intergenic
950151227 3:10688969-10688991 CTCCTCCCCACCCCCACACCAGG - Intronic
950355396 3:12404032-12404054 CTACTGGTGACCCCAGCCCCTGG - Intronic
950546342 3:13640235-13640257 CTGCAGGCCACCCCCGGCCCCGG + Intergenic
950548544 3:13653137-13653159 CTCCTGCCAACCCCCAACCCCGG - Intergenic
951543751 3:23806389-23806411 CTCCCTCCCACCCCCGCTCCCGG - Intronic
952312978 3:32207122-32207144 CTTCTGGTTACCCCTGCCCCTGG - Intergenic
952532847 3:34279881-34279903 CTCCCCGCCCCCCCCCCCCCCGG + Intergenic
952770835 3:36998659-36998681 CTCCTCGCTCCCCCCGGCCCTGG - Intronic
953031656 3:39183859-39183881 TTCCTGGCCTCCACTGCCCCAGG - Exonic
953636737 3:44670795-44670817 CTCCAGCCCACCCCAGCCTCTGG - Intergenic
953810602 3:46109329-46109351 ATCCTGGCCATCCCCCTCCCTGG + Intergenic
953889681 3:46742824-46742846 GGCCGGGCCAACCCCGCCCCAGG + Intronic
954644743 3:52124303-52124325 CTCCTGGCCTCCCCAGTGCCAGG + Intronic
954669222 3:52279169-52279191 CTCCTGACCTCACCCGCACCCGG + Intronic
955050715 3:55408045-55408067 CTGCTGACCACTCCAGCCCCTGG + Intergenic
955418973 3:58718436-58718458 CTCCAGGCCTCCCCTTCCCCTGG + Intronic
955916419 3:63912414-63912436 CTCAAGGCCACCCCCCGCCCCGG - Intronic
956414621 3:69013365-69013387 ATCCTGGCCCTCCCCGGCCCCGG - Intronic
956613171 3:71144840-71144862 CTCCTCACCACCCCTGGCCCCGG + Intronic
958004286 3:87792771-87792793 CCCCTGCCCTCCCGCGCCCCGGG + Intergenic
958980117 3:100709972-100709994 CTCCTGGCCACCGCAGCCAGGGG - Intronic
959286755 3:104424004-104424026 CTACTGCCCACCCCAGCACCTGG - Intergenic
959289015 3:104449369-104449391 CTCATAGCCACCACTGCCCCAGG + Intergenic
959395604 3:105834080-105834102 CAACTGCCCACCCCCACCCCAGG - Intronic
959704419 3:109326405-109326427 CTCCTGCCCGCCCCCGCCGTTGG - Exonic
959913675 3:111793301-111793323 CCCATGGCCACCACTGCCCCAGG + Intronic
960913919 3:122678740-122678762 CAGCAGGCCACCCCCACCCCAGG + Intergenic
960943250 3:122948191-122948213 CCCCTGGCCACCCCCAGCCAGGG + Intronic
961045327 3:123704083-123704105 CTCCTGTCCAATCCAGCCCCAGG + Intronic
961474004 3:127135852-127135874 CTCCAGGCCATCGCAGCCCCCGG + Intergenic
961574512 3:127823386-127823408 CTCGTGGACAGCCGCGCCCCGGG + Intergenic
961642787 3:128375381-128375403 CTCCTGCCCACCCTCGCCATGGG + Intronic
961821620 3:129578290-129578312 CTCCTGGCCCCACCCGGCGCTGG + Intronic
963231090 3:142909450-142909472 CTCATGGCCAGCCCAGCCTCTGG - Intergenic
965379309 3:167967820-167967842 CTCATGGCCACTACCACCCCAGG - Intergenic
965561375 3:170064868-170064890 CTCCTGCCCACCCTGGTCCCAGG + Intronic
966141994 3:176767327-176767349 CACATGGCCACCACTGCCCCAGG - Intergenic
966424058 3:179762089-179762111 TTCCTGCTCACCCCAGCCCCTGG + Intronic
966809308 3:183829198-183829220 TTCCTTGCCTCCCCCTCCCCTGG - Intergenic
966816731 3:183895962-183895984 CACTTGGCAACCCCAGCCCCAGG - Intergenic
968116432 3:196093914-196093936 CACCTGGGCACCCCAGCCCTGGG - Intergenic
968390394 4:187881-187903 CTCCTGGGCACCCCCATCCCAGG + Intergenic
968503369 4:961201-961223 CGGCTGGCCTCTCCCGCCCCAGG - Exonic
968503391 4:961263-961285 CGGCTGGCCTCTCCCGCCCCAGG - Intronic
968503413 4:961320-961342 CGGCTGGCCTCTCCCGCCCCAGG - Intronic
968503439 4:961382-961404 CAGCTGGCCTCTCCCGCCCCAGG - Intronic
968521832 4:1037682-1037704 CCCCAGGCCCCGCCCGCCCCTGG + Intergenic
968564991 4:1307317-1307339 CTCCTCCCCACCCCAGCCCCTGG + Intronic
968571613 4:1345166-1345188 TTCCTGGCCACCCCTGCAGCAGG - Intergenic
968571967 4:1346800-1346822 TTCCCGGCCGGCCCCGCCCCCGG + Intergenic
968620528 4:1601704-1601726 CCCCTGGCACCCCCTGCCCCTGG + Intergenic
968764797 4:2462692-2462714 CTCCCCGCCATCCCCGCCCCGGG - Intronic
968922542 4:3530158-3530180 CTCCTGACCACCCTGGGCCCTGG + Intronic
968954622 4:3711939-3711961 GCCCTGGACAGCCCCGCCCCTGG - Intergenic
968959429 4:3735408-3735430 CTCCTGGGCCACCCAGCCCCTGG - Intergenic
969028376 4:4192291-4192313 CTCCCAGCCACCCCCACCCAAGG + Intronic
969300717 4:6295407-6295429 CTCCTGCCCAACACCGCCCCTGG - Intronic
969461526 4:7331634-7331656 CTCCTGTCCACCCACGCCCCCGG + Intronic
969538881 4:7773573-7773595 CTGCCGGCCACCACCGGCCCAGG - Intronic
969682765 4:8652394-8652416 ATGCTGGCCACCCCCGACCTGGG - Intergenic
969703566 4:8780527-8780549 CTCCCAGCCACCCCTGCCCTGGG + Intergenic
969703978 4:8782247-8782269 CCCCTGGCACCCCCAGCCCCGGG + Intergenic
969857047 4:10008321-10008343 CACCTGGACACCAACGCCCCAGG + Intronic
970196404 4:13554967-13554989 CTCCTCTCCAACCCCACCCCTGG - Intergenic
970413368 4:15832995-15833017 CTCATGGCCACCACCACCACAGG + Intronic
970521933 4:16893513-16893535 CTCCTCCCCACCCCCTCCCCAGG + Intronic
971024664 4:22576839-22576861 CTCCTCCCCACCCCAGCCCCTGG - Intergenic
971481461 4:27118357-27118379 CTCCAGGCCACCCCTGCCCGAGG - Intergenic
972323108 4:37991051-37991073 CCCCCACCCACCCCCGCCCCAGG - Intronic
972670617 4:41211387-41211409 CTGCTCCCCTCCCCCGCCCCCGG + Intronic
973348597 4:49083293-49083315 CCCATGGCCACCACTGCCCCAGG - Intergenic
973621851 4:52734950-52734972 CTCATTGCAACCTCCGCCCCAGG + Intronic
974301067 4:60067637-60067659 CTCATGGTCACCACCACCCCAGG - Intergenic
976033213 4:80783896-80783918 CTCCTCTCCACCCCCACCCCTGG + Intronic
977166876 4:93710850-93710872 CCCATGGCCACCACTGCCCCAGG + Intronic
977368374 4:96102081-96102103 CCCCTGGCCCCTCCCTCCCCTGG - Intergenic
977809874 4:101346643-101346665 TTCCTCCCCTCCCCCGCCCCAGG - Intronic
978258346 4:106719190-106719212 CCCATGGCCACCACTGCCCCAGG - Intergenic
978776528 4:112511057-112511079 CTCCTGGCCAAAGCCGCCCAGGG + Intergenic
979395084 4:120178128-120178150 CCCATGGCCACCACCACCCCAGG - Intergenic
980075214 4:128287524-128287546 CTCCTCGCCCGCCCCGGCCCCGG + Exonic
981510946 4:145557658-145557680 CTCCCTGACCCCCCCGCCCCTGG - Intronic
982057792 4:151570203-151570225 TTCCTAGCCACCCCCTCTCCTGG + Intronic
982911607 4:161149105-161149127 TCCCTGGCCACCACCGTCCCAGG - Intergenic
983533414 4:168833060-168833082 CTCTAGGCCGGCCCCGCCCCGGG + Intronic
985480524 5:107620-107642 CACCTGCCCATCCCCGCCCTGGG + Intergenic
985574163 5:665879-665901 CTCCTGACCACCCCTCCCCCAGG + Intronic
985664365 5:1174292-1174314 CTCCAGGGCACCCCCTCCCCGGG + Intergenic
985678218 5:1243138-1243160 ATGCTGGCCACCCCCTCTCCTGG - Intronic
985748692 5:1662099-1662121 ATCCGGGCCACCCCAGCTCCCGG + Intergenic
986451422 5:7869287-7869309 CGGCTGCCCACCCCCGCCCCGGG - Intronic
987089360 5:14497481-14497503 CTCCAGGCAACCCCCACCGCAGG - Intronic
987457945 5:18170012-18170034 CTCATGGCCACCACAACCCCAGG - Intergenic
988214427 5:28252966-28252988 CTCTTGGCCACACCCGGCGCCGG + Intergenic
989519999 5:42390295-42390317 AATCTGGTCACCCCCGCCCCGGG - Intergenic
989584350 5:43063068-43063090 CTCCGCCCCACCCCCTCCCCGGG - Intergenic
990763271 5:59154040-59154062 CTCCTCTCCAGCCCAGCCCCTGG - Intronic
990933072 5:61115177-61115199 CCCATGGCCACCACCACCCCAGG + Intronic
992000193 5:72428708-72428730 CTCCTGGCCACCATGGGCCCAGG - Intergenic
992454181 5:76901492-76901514 CTCATAGCCACCCCGACCCCAGG + Intronic
993133448 5:83927557-83927579 CTCCTTACCACCACCACCCCTGG - Intergenic
993155648 5:84218791-84218813 CCCATGGCCACCACTGCCCCAGG - Intronic
995393812 5:111666633-111666655 CTCCTGACCCCCCCGCCCCCGGG + Intronic
995798072 5:115962388-115962410 AGCCTACCCACCCCCGCCCCCGG - Intergenic
997265118 5:132490825-132490847 GCCCTGGCCGGCCCCGCCCCCGG + Intergenic
997497651 5:134343695-134343717 CTCATGGCCGCCCCAGACCCAGG + Intronic
998139003 5:139689626-139689648 CTCCTGCCCACCGCTCCCCCTGG + Intergenic
998216516 5:140241760-140241782 AGCCTGGCCACCCCAGGCCCTGG - Intronic
998317910 5:141201235-141201257 CTACTCGCTACTCCCGCCCCAGG + Exonic
998456615 5:142278731-142278753 CGCATGGCCACCCCAGCCCATGG + Intergenic
999248429 5:150167437-150167459 CTCCTGTCCACTCTCGCCCTGGG + Intronic
999727104 5:154446286-154446308 CTCCCGGACACCCCCGCTGCAGG + Exonic
1000305062 5:159987282-159987304 CACCTGGGCGCCCCCGCCGCAGG - Intergenic
1002300053 5:178252780-178252802 CTCCTGGCCTCCCCCAAGCCTGG - Intronic
1002375579 5:178786644-178786666 CTCCCAGCCATCCCCGCCTCTGG - Intergenic
1002651328 5:180697953-180697975 GTCCTGGCCACTCCAGCCACAGG - Intergenic
1003011907 6:2434408-2434430 CTCGGGGCCGCCCCTGCCCCTGG + Intergenic
1003247998 6:4400498-4400520 CTCCTAGCCTCCTCCTCCCCAGG + Intergenic
1004843411 6:19612926-19612948 CCCCTGGCCATCCCCGCGCCAGG - Intergenic
1005959886 6:30687128-30687150 CTCCTCCGCACCCCCTCCCCCGG - Exonic
1006089598 6:31620684-31620706 ATCCGGGCAACCGCCGCCCCCGG - Intergenic
1006333702 6:33410152-33410174 CCGCCGGCCACCCCAGCCCCAGG + Intergenic
1006446300 6:34081664-34081686 CTGCTGGACATCCCCGCCCCAGG + Intronic
1006694753 6:35921222-35921244 CTCCTTGCCGCCCCCTCCTCGGG - Exonic
1007631440 6:43275437-43275459 CTCCAGCCCGCCCCCGCCCCGGG - Intronic
1009039304 6:58158090-58158112 CCCATGGCCACCACTGCCCCAGG + Intergenic
1009215203 6:60912933-60912955 CCCATGGCCACCACTGCCCCAGG + Intergenic
1009373481 6:62938349-62938371 CTCATGGCCACCACCACCACAGG + Intergenic
1009431554 6:63572264-63572286 CCCCTTCCCTCCCCCGCCCCGGG + Exonic
1012678990 6:102154375-102154397 CTCTTAGCCACCACCACCCCAGG - Intergenic
1013016494 6:106164720-106164742 TTCCAGGCCACCCCTTCCCCTGG - Intergenic
1013117469 6:107114442-107114464 CTCCCGGCCGCCGCCGCCGCGGG + Intronic
1015440541 6:133241761-133241783 CTTCTTCCAACCCCCGCCCCAGG + Intronic
1015590345 6:134817056-134817078 CTCATCACCACCCCCTCCCCAGG + Intergenic
1016357591 6:143234977-143234999 GGCCTCTCCACCCCCGCCCCAGG - Intronic
1017163860 6:151390536-151390558 GTCTGGGCCACCCCCGCCCCCGG - Intronic
1017672206 6:156778582-156778604 CGCCGGGCCGCCGCCGCCCCCGG - Exonic
1017842243 6:158231917-158231939 CCCCGGGAGACCCCCGCCCCCGG - Intergenic
1017938695 6:159031638-159031660 CTCATGGCCTCCTCCGGCCCCGG - Intergenic
1018443546 6:163834698-163834720 CTCCTGGCCACTCCTGGCACGGG - Intergenic
1018755893 6:166849560-166849582 CCCCAGGCCACCCCCGCCCGTGG + Intronic
1018902574 6:168058854-168058876 GGCCCGGCCACCCCAGCCCCAGG + Intronic
1019307082 7:340786-340808 CTCCAGGCCCCTCCCGCCTCCGG + Intergenic
1019404780 7:877583-877605 CTCCTAGCCTCCACCTCCCCTGG + Intronic
1019410305 7:903871-903893 CTCCTGGGCAGCCCGGCCCTGGG + Intronic
1019478436 7:1255177-1255199 GGCCAGGCCAGCCCCGCCCCAGG - Intergenic
1019559407 7:1648459-1648481 CTCCCCGCCACCCCCCTCCCCGG - Intergenic
1019656541 7:2199018-2199040 CTCCTGGATAGCCCCGCCCAAGG - Intronic
1019681992 7:2355430-2355452 CCGCTCGCCAGCCCCGCCCCGGG - Intronic
1019771490 7:2886370-2886392 CTCCAGGGCACCCCCACCCACGG - Intergenic
1020009240 7:4799496-4799518 CTCCTGCCCACCCCCACCTCTGG - Intronic
1020096880 7:5374378-5374400 GGCCTGGCCACCGCCGGCCCCGG - Exonic
1020125963 7:5532630-5532652 CTCCAGCCCCACCCCGCCCCGGG + Intronic
1023850741 7:44148968-44148990 CTCCTTGCCACCTCTGCCCCAGG + Intronic
1024983872 7:55179532-55179554 CTCCTGCCCACCTTCTCCCCAGG - Intronic
1025709042 7:63890928-63890950 TGCCTGGACACCCCCTCCCCAGG - Intergenic
1025996421 7:66530207-66530229 CGCCTGGCCACCCCAGGCTCAGG - Intergenic
1026888114 7:73966573-73966595 TCCCTGGCCACCCCATCCCCTGG + Intergenic
1026988438 7:74569436-74569458 CACCTGGCCACCCCAGGCTCAGG - Intronic
1027001580 7:74658020-74658042 CCCCTCGGCACCCCCGGCCCCGG + Exonic
1028181537 7:87730438-87730460 CTCATGGCCACCACCATCCCAGG - Intronic
1029190266 7:98766968-98766990 CACCTGGTTATCCCCGCCCCAGG + Intergenic
1029449665 7:100633639-100633661 CCCCTCGCCGCCCCTGCCCCTGG - Intronic
1029460986 7:100693889-100693911 CTCCGGCCCATCCCCGCCGCCGG - Intergenic
1029537940 7:101166763-101166785 CTCCCCCCCACCCCCGCCCACGG - Intergenic
1029604182 7:101588690-101588712 CTCCTGGCCTCTCCATCCCCAGG - Intergenic
1031972976 7:128077169-128077191 CCCCTCGCCAGCCCCACCCCTGG + Intronic
1031997615 7:128242880-128242902 CTCCTTGGCTCCCACGCCCCTGG - Intronic
1032095758 7:128937910-128937932 CGTCTTGCCGCCCCCGCCCCTGG - Intronic
1032194646 7:129781847-129781869 GTCCTGGGCACACCCGGCCCGGG - Intergenic
1032697689 7:134351613-134351635 CCCATGGACCCCCCCGCCCCTGG + Intergenic
1033223712 7:139544846-139544868 GGCCGGGCCAGCCCCGCCCCGGG + Exonic
1033228120 7:139576628-139576650 CTCCCTGCCACCCCCGTCCCTGG - Intronic
1033551307 7:142450888-142450910 CTCCTGGCCTCTCCCTCCCTGGG + Intergenic
1034677378 7:152901654-152901676 CACCTGCCCACCCCAGCCCATGG + Intergenic
1035049618 7:155990992-155991014 CTCCCTGCCACTCCCGCTCCTGG + Intergenic
1035366599 7:158352358-158352380 CTCCTGACCACTCCCCTCCCTGG + Intronic
1035373120 7:158391788-158391810 CTCCTTTCCTCCCCCGCCCCCGG - Intronic
1035458234 7:159023416-159023438 CACCTCACCACACCCGCCCCCGG + Intergenic
1035458254 7:159023481-159023503 CACCTCACCACACCCGCCCCTGG + Intergenic
1035458285 7:159023610-159023632 CACCTCACCACGCCCGCCCCTGG + Intergenic
1035458304 7:159023675-159023697 CACCTCACCACGCCCGCCCCTGG + Intergenic
1035519683 8:266440-266462 CCCCCGGCCGCCCCCTCCCCAGG - Intergenic
1035522238 8:284219-284241 CTCCAGGCCACCCAGGCCCAGGG + Intergenic
1035637174 8:1155886-1155908 ATACTGGCCTCCCCCGCCGCTGG - Intergenic
1037910389 8:22740676-22740698 CTTCTGGAGACCCCCTCCCCTGG + Intronic
1037913998 8:22761065-22761087 CTCCTGGCCCCCTCTGCCCATGG + Intronic
1038003214 8:23407840-23407862 CTCCTGTCCACCCCATCCCCAGG + Intronic
1038632880 8:29262767-29262789 CCCCTGGCCAGCCCCGTCCCTGG - Intronic
1039874991 8:41577989-41578011 CTCCTGCCCCGCCCCGCCCCCGG + Intronic
1039964029 8:42271167-42271189 CCACACGCCACCCCCGCCCCGGG + Intergenic
1040038999 8:42897304-42897326 CTCCTCGCCCCGCCCGCCCCAGG - Intronic
1040416584 8:47201149-47201171 CTCCTGGCCACCCTAGATCCAGG - Intergenic
1040587193 8:48755365-48755387 CTGCTGCTCACCCCAGCCCCGGG + Intergenic
1041411863 8:57564966-57564988 CTCCTGGCCACCTCACTCCCAGG + Intergenic
1044241515 8:89893496-89893518 CCCATGGCCACCACCACCCCAGG - Intergenic
1044674951 8:94719695-94719717 CTCCTGGCCGCCGCCTGCCCTGG - Intronic
1045098841 8:98825713-98825735 CTCCCGCCCCGCCCCGCCCCCGG + Intronic
1045389983 8:101705586-101705608 CTCCTGTCCACCCCTACTCCAGG - Intronic
1046041678 8:108913540-108913562 CTCCTGGTCACCCCACCTCCTGG + Intergenic
1047421492 8:124711502-124711524 CTCCAGCCCAGCCCAGCCCCAGG + Intronic
1047706538 8:127505154-127505176 CTCCTACACACCCCTGCCCCTGG + Intergenic
1047729786 8:127717689-127717711 CCCCTGTCCATCCCCACCCCAGG + Intergenic
1048710633 8:137206398-137206420 CACCTGGCCACCACCACGCCCGG + Intergenic
1049203202 8:141351723-141351745 TTCCTCCCCACCCCCACCCCAGG - Intergenic
1049468720 8:142765462-142765484 CTCCTCCCCACCCCCCACCCTGG - Intronic
1049537844 8:143190184-143190206 CTCCTGTGCTCCCCCGCCCTGGG - Intergenic
1049588458 8:143442431-143442453 CCCCTGCCCCCCCCCCCCCCCGG - Intronic
1049600697 8:143506063-143506085 CTCCCGGCCTCCTCAGCCCCAGG + Intronic
1049602169 8:143513028-143513050 CGCCTGGGCACCCCCTGCCCAGG - Intronic
1049789582 8:144466583-144466605 CCCGTGCCCGCCCCCGCCCCGGG - Intronic
1049800375 8:144514835-144514857 CCCCTAACCACCCCCTCCCCTGG - Intronic
1049843752 8:144789996-144790018 TTCCCCACCACCCCCGCCCCCGG + Intronic
1049989232 9:976570-976592 CCCACCGCCACCCCCGCCCCTGG - Intergenic
1050083368 9:1938840-1938862 CCCCTCCCCACCCCCACCCCGGG + Intergenic
1050084493 9:1950382-1950404 CTTTTAGCCACCCCCACCCCCGG - Intergenic
1050091254 9:2017458-2017480 CTCCTGCCCGCACCCTCCCCTGG + Intronic
1050231083 9:3526329-3526351 ACCCTCGCCACCCCCTCCCCCGG - Intergenic
1051039112 9:12784984-12785006 CTCATGGCCACCACTGCCCTAGG + Intronic
1051306769 9:15718212-15718234 CCCCTGGCCACCACTGCCACAGG - Intronic
1052985599 9:34484927-34484949 ATCCTGGCCACCTCTGCCCTGGG - Intronic
1053760883 9:41349438-41349460 CTCGTGGACACCCAGGCCCCAGG + Intergenic
1054340741 9:63859669-63859691 CTCCGCCCCCCCCCCGCCCCGGG - Intergenic
1054721528 9:68608992-68609014 CTCCTGGCCCCCCTCACTCCAGG - Intergenic
1054905700 9:70412564-70412586 CCCCTGTCCCGCCCCGCCCCCGG - Intronic
1056475104 9:86945934-86945956 CTGCTCACCACCCGCGCCCCCGG + Exonic
1056592513 9:87974760-87974782 CTCCTATCTGCCCCCGCCCCCGG + Intergenic
1056865987 9:90227802-90227824 CTCCCCGCCTCCCCCGGCCCCGG + Intergenic
1056930130 9:90867350-90867372 TTCCTGGGCAGCCGCGCCCCAGG + Intronic
1057045990 9:91886587-91886609 TTCCCGGCAACCCCCGGCCCGGG + Intronic
1057177382 9:93010160-93010182 CTTCTGGCCACCACAGCCCCAGG - Intronic
1057290502 9:93803091-93803113 CTGCTGGCCCTCCCAGCCCCAGG - Intergenic
1057832651 9:98418866-98418888 CTCCTCACCACCCCCACCCATGG + Intronic
1058003992 9:99896021-99896043 CCCATGGCCACCACCACCCCAGG - Intergenic
1058523663 9:105836424-105836446 CTCCAACCCACCCCCACCCCAGG - Intergenic
1058987182 9:110219227-110219249 GTCCTGGCCACCCCCACATCAGG - Intergenic
1059354056 9:113686286-113686308 CTCCTGGACACCCCAGTTCCAGG - Intergenic
1060157828 9:121332294-121332316 CTACTGCCCACCCCCTGCCCTGG - Intronic
1060219700 9:121757932-121757954 CTCCTGGCACCCCCAGCCCTGGG + Intronic
1060268646 9:122126614-122126636 CTCCTGGCAACCCCTTCCCTCGG - Intergenic
1060495933 9:124118587-124118609 CTCCTGGCCAAGCCTCCCCCTGG - Intergenic
1060526474 9:124323962-124323984 CACCTGGCCCCCCACGCCTCGGG + Intronic
1060526902 9:124325971-124325993 CTCCTGGACACCCCCTCCACAGG - Intronic
1060779851 9:126403374-126403396 GCCCTGGCCAGCCCCACCCCAGG + Intronic
1061003794 9:127917048-127917070 CTCCTCGCCGGCCCCGGCCCCGG - Intergenic
1061123158 9:128656618-128656640 GCCCTGGCCGCCCCGGCCCCGGG + Exonic
1061207987 9:129175333-129175355 CTCTCGGCCGCCCCCGCTCCAGG - Intergenic
1061241734 9:129378497-129378519 CCCGCGGCCACCCCCACCCCTGG - Intergenic
1061282942 9:129607847-129607869 TGCCTGGGCAGCCCCGCCCCTGG - Intergenic
1061307620 9:129741121-129741143 TCCCTGCCCACCCCCACCCCAGG - Intronic
1061395133 9:130339751-130339773 CTCCTGGGCACCCAGGCCCTGGG + Intronic
1061506228 9:131033408-131033430 CTCCTGTCCTCCCCGACCCCAGG - Intronic
1061513303 9:131073791-131073813 CTCCTTACCTCCCCAGCCCCTGG + Intronic
1061582391 9:131545923-131545945 CTCCGGGGCACCACAGCCCCGGG - Intergenic
1061614918 9:131773312-131773334 CTCTTGGCCACCCCTTCCCCTGG + Intergenic
1061752810 9:132792574-132792596 CCCCTGGGCACCCCCTCTCCAGG - Intronic
1061801019 9:133113472-133113494 CTCCTGACCGCCACCGCCTCTGG + Intronic
1061902574 9:133680562-133680584 CTCCTGGCCCACACCTCCCCAGG + Intronic
1061946453 9:133911025-133911047 CTCCTGAGCACCCCAGCTCCTGG + Intronic
1061986502 9:134133060-134133082 CTGCTGGCCACCCTCCCCGCTGG - Intergenic
1062220848 9:135414391-135414413 CTCCTGGCCCCCACAGCCCCGGG - Intergenic
1062268305 9:135697408-135697430 CTCCAGGCCACACCCTCCCGAGG + Intronic
1062358926 9:136178332-136178354 AGCCTGCACACCCCCGCCCCCGG + Intergenic
1062401819 9:136376145-136376167 CTGCTGGCCACCCATGCCTCGGG - Intronic
1062424715 9:136500798-136500820 CTCCAGGCCGCCCCCGCTGCAGG + Exonic
1062562646 9:137148530-137148552 CGCCTGGCCACCCACTCGCCGGG + Intronic
1062623216 9:137431769-137431791 CTCCCGGACACCCCGGCACCTGG + Intronic
1062646833 9:137552015-137552037 AACCCGGCCAGCCCCGCCCCTGG - Intronic
1185479548 X:435761-435783 CTCCTGCCCATCCCGGCGCCGGG - Intergenic
1186383844 X:9089410-9089432 CTTCTCGCCACCCCCACCCTTGG + Intronic
1186437718 X:9557411-9557433 CTCCTTGGCACCCCAGCCTCTGG - Intronic
1186466233 X:9786343-9786365 CTCCCCGCCAGCCCCGGCCCCGG + Intergenic
1186512826 X:10143269-10143291 CTCATTTCCACCCCGGCCCCAGG + Exonic
1187332734 X:18355030-18355052 ATCCTGGCCACCACCCACCCTGG + Intergenic
1188669719 X:32868337-32868359 ATGATGGCCGCCCCCGCCCCCGG - Intronic
1189858397 X:45247517-45247539 CTCATAGCCACCACCACCCCTGG + Intergenic
1192147884 X:68693977-68693999 AGCCGAGCCACCCCCGCCCCTGG + Intronic
1192219837 X:69190227-69190249 CTCCTGCCCACCCCCCACCACGG + Intergenic
1192351474 X:70360127-70360149 CCCCAGGCCTCCCCTGCCCCAGG - Intronic
1192528948 X:71870278-71870300 CTGCAGCCCACCCCCGCCCCCGG + Intergenic
1193344343 X:80387998-80388020 CTGCTGGCCACCACTTCCCCAGG + Intronic
1196809232 X:119615501-119615523 TTCCTGCCCACCTCCACCCCAGG + Intergenic
1196951804 X:120931794-120931816 CTCCTCGGCGCTCCCGCCCCGGG + Exonic
1196952488 X:120936655-120936677 CTCCTCGGCGCTCCCGCCCCGGG + Exonic
1196953173 X:120941516-120941538 CTCCTCGGCGCTCCCGCCCCGGG + Exonic
1196953858 X:120946376-120946398 CTCCTCGGCGCTCCCGCCCCGGG + Exonic
1196954543 X:120951237-120951259 CTCCTCGGCGCTCCCGCCCCGGG + Exonic
1196955226 X:120956097-120956119 CTCCTCGGCGCTCCCGCCCCGGG + Exonic
1196955913 X:120960980-120961002 CTCCTCGGCGCTCCCGCCCCGGG + Exonic
1196956595 X:120965841-120965863 CTCCTCGGCGCTCCCGCCCCGGG + Exonic
1196957277 X:120970701-120970723 CTCCTCGGCGCTCCCGCCCCGGG + Exonic
1196957959 X:120975561-120975583 CTCCTCGGCGCTCCCGCCCCGGG + Exonic
1196958641 X:120980421-120980443 CTCCTCGGCGCTCCCGCCCCGGG + Exonic
1196959322 X:120985281-120985303 CTCCTCGGCGCTCCCGCCCCGGG + Exonic
1197153987 X:123250121-123250143 CTCCCTGCTACCCCTGCCCCAGG - Intronic
1197487685 X:127074418-127074440 CCCCTGGCCACCACCGTCCTAGG + Intergenic
1198124974 X:133634665-133634687 CTCATTCCCACCCCAGCCCCAGG - Intronic
1199749873 X:150805312-150805334 CTACTCCCCACCCCAGCCCCTGG - Intronic
1200084805 X:153598935-153598957 GTCCTGGCCTCCCCCGGCCGCGG + Intronic
1200117431 X:153775484-153775506 TTCCTGGCCCCACCCGCCCCTGG - Intronic
1200334864 X:155339832-155339854 CTCCTCGCCTCCCCTGCCTCTGG + Intergenic
1200351602 X:155501389-155501411 CTCCTCGCCTCCCCTGCCTCTGG - Intronic