ID: 1172100883

View in Genome Browser
Species Human (GRCh38)
Location 20:32483536-32483558
Sequence GCTCGCCTGGGCCCTCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 337}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172100883_1172100902 26 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100902 20:32483585-32483607 GGCCCGGAGGAAGGGGGAGGGGG 0: 1
1: 0
2: 6
3: 103
4: 1400
1172100883_1172100896 19 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100896 20:32483578-32483600 GCGCCGCGGCCCGGAGGAAGGGG 0: 1
1: 0
2: 2
3: 22
4: 173
1172100883_1172100892 10 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100892 20:32483569-32483591 GCGGCGGCGGCGCCGCGGCCCGG 0: 1
1: 6
2: 58
3: 298
4: 1538
1172100883_1172100899 23 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100899 20:32483582-32483604 CGCGGCCCGGAGGAAGGGGGAGG 0: 1
1: 0
2: 1
3: 40
4: 421
1172100883_1172100891 5 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG 0: 1
1: 10
2: 192
3: 494
4: 1380
1172100883_1172100897 20 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100897 20:32483579-32483601 CGCCGCGGCCCGGAGGAAGGGGG 0: 1
1: 0
2: 1
3: 73
4: 4274
1172100883_1172100893 13 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100893 20:32483572-32483594 GCGGCGGCGCCGCGGCCCGGAGG 0: 1
1: 1
2: 11
3: 89
4: 771
1172100883_1172100890 -3 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100890 20:32483556-32483578 AGCAGCGGCGGCAGCGGCGGCGG 0: 4
1: 55
2: 385
3: 2044
4: 3495
1172100883_1172100894 17 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100894 20:32483576-32483598 CGGCGCCGCGGCCCGGAGGAAGG 0: 1
1: 0
2: 4
3: 17
4: 238
1172100883_1172100901 25 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100901 20:32483584-32483606 CGGCCCGGAGGAAGGGGGAGGGG 0: 1
1: 0
2: 5
3: 45
4: 638
1172100883_1172100889 -6 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100889 20:32483553-32483575 GCGAGCAGCGGCGGCAGCGGCGG 0: 1
1: 0
2: 34
3: 247
4: 1279
1172100883_1172100888 -9 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100888 20:32483550-32483572 CAGGCGAGCAGCGGCGGCAGCGG 0: 1
1: 0
2: 2
3: 34
4: 384
1172100883_1172100895 18 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100895 20:32483577-32483599 GGCGCCGCGGCCCGGAGGAAGGG 0: 1
1: 0
2: 1
3: 5
4: 146
1172100883_1172100900 24 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100900 20:32483583-32483605 GCGGCCCGGAGGAAGGGGGAGGG 0: 1
1: 0
2: 4
3: 37
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172100883 Original CRISPR GCTCGCCTGGGCCCTCCTCC TGG (reversed) Intronic
900160377 1:1220466-1220488 GCTTCCCAGGCCCCTCCTCCAGG + Intronic
900333862 1:2151020-2151042 GCTGCCCTGGGGCCTCCTCCGGG + Intronic
900551604 1:3259224-3259246 GCCTGCCTGGACCCTCCTCGTGG - Intronic
900604024 1:3515921-3515943 GCCAGCCTGCGTCCTCCTCCAGG - Intronic
900605829 1:3523147-3523169 GCCGGCTTGGGCCCTGCTCCGGG + Intronic
900648846 1:3721273-3721295 GCTGGCGTGGGCCCTGCTGCAGG - Intronic
900704504 1:4071895-4071917 CCTCCCTTGGGCCCTCCACCTGG + Intergenic
901061879 1:6475384-6475406 CCGAGCCTGGGCCTTCCTCCGGG - Intronic
901104346 1:6743691-6743713 GCTCGGCTGGGCCCTGCAGCTGG + Intergenic
901300631 1:8197858-8197880 GCGGGCCTGGGCCCTGATCCAGG + Intergenic
901381830 1:8879216-8879238 GCGCGCCTCGGCCCCACTCCGGG + Intronic
901816442 1:11796187-11796209 GCTCTCCTGGGCCCCTCACCTGG + Exonic
901870488 1:12135821-12135843 CCTCGCCTGGGGCCTCAGCCAGG + Intronic
901882516 1:12202455-12202477 GCTGGCCTGGCTGCTCCTCCGGG + Intronic
902753676 1:18535423-18535445 GCTAGCCTGAGCCCTCCTGAGGG + Intergenic
905867232 1:41382777-41382799 GCTGGGCTGGGGCCGCCTCCTGG - Exonic
906113123 1:43337851-43337873 GCCCTCCTGGGCCCTCTTCATGG + Exonic
906531025 1:46524144-46524166 GCTCTGCCGGTCCCTCCTCCTGG + Intergenic
907328500 1:53656330-53656352 CCTCACCTGAGACCTCCTCCTGG + Intronic
907400522 1:54222280-54222302 GCTCAGATGGCCCCTCCTCCTGG - Intronic
907420536 1:54343865-54343887 GCTCTCCTAGCCCCTTCTCCTGG - Intronic
907424834 1:54373064-54373086 GTGTGCCTGGGCCCTCTTCCTGG + Intronic
908850526 1:68371440-68371462 TCTGGCAAGGGCCCTCCTCCTGG + Intergenic
909075486 1:71047001-71047023 GCTCGCCTTCGCCCTGCTGCCGG - Exonic
912238131 1:107875342-107875364 ACTCTCCTGATCCCTCCTCCAGG - Intronic
913186509 1:116374010-116374032 GCTCCGCCGGGGCCTCCTCCCGG + Exonic
914846565 1:151286897-151286919 GCATGCCTGGGCCATTCTCCTGG - Exonic
915491280 1:156251271-156251293 GCCTGCCAGGGCCCTCCTGCAGG - Intronic
915748159 1:158181122-158181144 GCTGCTCTGGGCGCTCCTCCAGG + Exonic
917447301 1:175117155-175117177 GCTCTCCTGGGCCCCCTTCTGGG - Exonic
917448069 1:175123613-175123635 GCTCTCCTGGGCCCCCTTCTGGG - Exonic
917920355 1:179744718-179744740 GCCCACCTGGGCCCTCCCCCAGG + Intronic
919206977 1:194431114-194431136 CCTAGCCCGGGCACTCCTCCCGG + Intergenic
920285275 1:204874516-204874538 GCTCTCCAGGGCCCTGCCCCCGG + Intronic
920799617 1:209174138-209174160 GCTCTCCTGGGCCCTGGTCTGGG - Intergenic
921152619 1:212414320-212414342 GAGCGCCCGCGCCCTCCTCCCGG - Intronic
921175166 1:212586948-212586970 GCTGGGCTGGGCCCTCCGCAGGG + Intronic
922901287 1:229138725-229138747 GCAAGCATGGGCTCTCCTCCCGG - Intergenic
922955269 1:229594165-229594187 TCTCTCCTGGGCCCTCATTCCGG - Exonic
923685977 1:236154174-236154196 GTCCTCCTGGGCCCTGCTCCAGG + Intronic
924529529 1:244881676-244881698 CCTCCCCTGGGCCCTCCTGGAGG + Intergenic
1062974904 10:1675850-1675872 GCTGGCCTCTGCCCTCCTGCAGG - Intronic
1063558080 10:7099714-7099736 GCTGGCCTGCACCCTCCACCAGG + Intergenic
1063965541 10:11343526-11343548 ACTGGTCTGGGCCCTGCTCCTGG - Intergenic
1065343110 10:24724091-24724113 GCTCGCCTGCCCCCTCCCCGTGG + Intergenic
1065367527 10:24951029-24951051 GCTAGGCTTGCCCCTCCTCCTGG + Intronic
1067457159 10:46427233-46427255 ACTGGGCTGGGCCCTCCTGCTGG - Intergenic
1067944440 10:50681359-50681381 TCTGGTCAGGGCCCTCCTCCTGG + Intergenic
1068083294 10:52346602-52346624 GCTGGGCTGGACCCTCCTCCAGG + Intergenic
1069068821 10:63973795-63973817 GCTCTCCTGGGCCCTGTTCGCGG + Intergenic
1069075483 10:64034545-64034567 GCTCTCCTAGGCCCCTCTCCAGG - Intergenic
1069857960 10:71451994-71452016 GCTCTCCTGGGCCCACTCCCTGG - Intronic
1069934462 10:71905760-71905782 GTACGCCTGGGCCCTTCTCCAGG + Intergenic
1070865941 10:79708230-79708252 TCTGGTCAGGGCCCTCCTCCTGG + Intronic
1070879735 10:79846361-79846383 TCTGGTCAGGGCCCTCCTCCTGG + Intronic
1071573667 10:86711326-86711348 GCTCGCCTGGGCCCCAGCCCGGG - Intronic
1071632841 10:87230451-87230473 TCTGGTCAGGGCCCTCCTCCTGG + Intronic
1071646290 10:87362669-87362691 TCTGGTCAGGGCCCTCCTCCTGG + Intronic
1073214245 10:101827909-101827931 GTTCCCTTGGGGCCTCCTCCCGG + Exonic
1074864641 10:117537640-117537662 TCTCGCCTAGGCCGTCATCCAGG - Intergenic
1075047411 10:119157000-119157022 ACAAGCCTGGGCCCTCATCCTGG - Intronic
1075418605 10:122284201-122284223 ACTCGCCTGGGCCTTCCTGCTGG - Intronic
1075558042 10:123447463-123447485 GCTCGCCTGTCCCTGCCTCCTGG - Intergenic
1076140722 10:128077009-128077031 CCTCTCTGGGGCCCTCCTCCAGG + Intronic
1077154941 11:1087090-1087112 TCTCCTCTGGGTCCTCCTCCGGG + Intergenic
1077154993 11:1087238-1087260 CCTCCTCTGGGTCCTCCTCCAGG + Intergenic
1077155013 11:1087294-1087316 CCTCCTCTGGGTCCTCCTCCAGG + Intergenic
1077160025 11:1108438-1108460 CCCAGCCTGGGGCCTCCTCCAGG + Intergenic
1077229816 11:1453737-1453759 GCCCTGCTGGCCCCTCCTCCCGG + Intronic
1077307962 11:1876343-1876365 GCTGGGCTGGGCCTTCCACCAGG - Intronic
1077393244 11:2309352-2309374 GCTAGGCCGGACCCTCCTCCAGG - Intronic
1077413740 11:2415029-2415051 GCTTGGCCGGGCCCTTCTCCTGG + Exonic
1077439527 11:2561594-2561616 GCTCGTCTGGGTCCCCCGCCTGG + Intronic
1077504458 11:2923683-2923705 CCTCTCCTGTGCCATCCTCCTGG - Intronic
1078009267 11:7559030-7559052 AGATGCCTGGGCCCTCCTCCAGG - Intronic
1079023123 11:16925091-16925113 GGTCGCCTTTGCCCACCTCCCGG + Intronic
1080459269 11:32439111-32439133 GCACGCCTGGGCCGCCCTCCGGG + Intergenic
1081525528 11:43925138-43925160 GCCCAGCTGTGCCCTCCTCCAGG + Intergenic
1081866848 11:46364932-46364954 GATCTCCTGGGCCCTGGTCCTGG - Intronic
1083603394 11:63962372-63962394 CCTGGCCTGGTCTCTCCTCCTGG - Intergenic
1083805653 11:65072364-65072386 CCTCGCCTGGGTCCTCAGCCCGG - Intronic
1083889120 11:65587048-65587070 TCATGCCTGGCCCCTCCTCCAGG - Intronic
1084105015 11:66975430-66975452 GCCCTCCTGGGGCCTCCCCCAGG - Exonic
1085447568 11:76610885-76610907 GCTCGCCTTGCCCCTCACCCGGG + Intergenic
1087713741 11:101583518-101583540 ACTGGCCTGGGCCCCGCTCCCGG + Exonic
1088878761 11:113957472-113957494 GCTGCCCTGGGCCAGCCTCCGGG + Intergenic
1090931008 11:131298064-131298086 GCCCCCCTGGCACCTCCTCCAGG + Intergenic
1091697473 12:2637715-2637737 GCATCCCTGGGCCCTGCTCCGGG + Intronic
1092303292 12:7273306-7273328 GCTGGACTGGGCACTCCTCAGGG + Intergenic
1092885622 12:12922335-12922357 GCTCCCTTGGGCCCTCATTCTGG - Intergenic
1094834617 12:34316446-34316468 GATCCCCAGGGCCCTGCTCCAGG + Intergenic
1095990280 12:48029690-48029712 GCTAGGCTGGGCCCCTCTCCAGG + Intergenic
1096298071 12:50400899-50400921 ACTCGCCTTGCCCCTCCACCCGG - Exonic
1096428956 12:51527522-51527544 GCTGGGCTAGGGCCTCCTCCAGG + Intergenic
1096771601 12:53939153-53939175 GCTCCCCTGGGCGCCCCTCAGGG + Exonic
1097956781 12:65494911-65494933 GCTGCCCTGGGGCCTCGTCCAGG - Intergenic
1100434012 12:94555087-94555109 GCTGGCTAGGGCCCTCTTCCTGG + Intergenic
1103927430 12:124430689-124430711 GCTCTCCTTGGCCCGCCGCCGGG + Exonic
1103932461 12:124457894-124457916 GCTGGCCTGGGCTGCCCTCCAGG - Intronic
1104676837 12:130716877-130716899 GCTGCCCTGGGCTCTACTCCAGG + Intergenic
1104728429 12:131092221-131092243 GCACGCCTGAGCCCTCCTCTCGG - Intronic
1104765195 12:131325862-131325884 GCTCTCCTGGGGTCCCCTCCTGG + Intergenic
1104902013 12:132194604-132194626 GCTCCCCTCGGGACTCCTCCTGG + Intergenic
1112387554 13:98954352-98954374 GCTCTCCTGGGACCTGATCCTGG - Intronic
1113201055 13:107867574-107867596 GCGCGCCTTCTCCCTCCTCCCGG - Intergenic
1113588772 13:111483547-111483569 GCACACCTGGGACCTGCTCCCGG - Intergenic
1113789283 13:113019017-113019039 CCTGGCCTGTGCTCTCCTCCCGG + Intronic
1113929026 13:113956779-113956801 GCTCTCCTTTGCCCTCTTCCTGG + Intergenic
1117819160 14:59630523-59630545 GCTCGCCGTGGCTCTCCTCGGGG + Intronic
1118482638 14:66182338-66182360 GCTCACGTGTGCCCTCCTCCAGG - Intergenic
1119564921 14:75620308-75620330 GCCTGCCTGGGCCTTTCTCCAGG + Intronic
1119738488 14:76999077-76999099 GCCCGCCTGGGTCTGCCTCCTGG - Intergenic
1120094953 14:80378272-80378294 CCTCACCAGGGCCCTCCTCCCGG + Intronic
1120993237 14:90396905-90396927 GCCCGCCTGGTCCCGCCCCCGGG - Intronic
1121595167 14:95157010-95157032 GCCCGCCTCGGCTCTGCTCCTGG - Intronic
1122236285 14:100332374-100332396 GCTCAGCTGGTCTCTCCTCCAGG + Intergenic
1122602871 14:102930049-102930071 GCTGGCCCGGGCCCTCCTGGCGG + Exonic
1122960519 14:105091880-105091902 TCTCGCCTGGGCCTGCCTCCTGG - Intergenic
1122969262 14:105145871-105145893 ACTGGCCTGGGGCCTTCTCCAGG + Exonic
1202904448 14_GL000194v1_random:60197-60219 GCCGGCCAGTGCCCTCCTCCTGG + Intergenic
1124414818 15:29466435-29466457 CCTCACCTGGGCCCTCCCCTGGG - Intronic
1124414895 15:29466638-29466660 CCTCCCCTGGGCCCTCCCCTGGG - Intronic
1124414938 15:29466739-29466761 CCTCTCCTGGGCCCTCCCCTGGG - Intronic
1124414964 15:29466807-29466829 CCTCCCCTGGGCCCTCCCCTGGG - Intronic
1124414979 15:29466841-29466863 CCTCCCCTGGGCCCTCCCCTGGG - Intronic
1124415021 15:29466943-29466965 CCTCCCCTGGGCCCTCCCCTGGG - Intronic
1124415066 15:29467044-29467066 CCTCCCCTGGGCCCTCCCCTGGG - Intronic
1124415081 15:29467078-29467100 CCTCCCCTGGGCCCTCCCCTGGG - Intronic
1124629701 15:31329272-31329294 CCTAGCCTGGCCCCTCCCCCAGG - Intronic
1127096347 15:55515437-55515459 GCTCGACTGGGCTCTCATACTGG + Intergenic
1129516890 15:76162499-76162521 GCTCTCCTGGCCCTTCCTACTGG - Intronic
1129672167 15:77613427-77613449 GCAGGCCTGGGCCCAGCTCCGGG - Exonic
1129676275 15:77633698-77633720 GCTTGACTGTTCCCTCCTCCCGG + Intronic
1130018927 15:80210834-80210856 GCTCCCCAGGGCTCTCTTCCTGG + Intergenic
1131062332 15:89411609-89411631 GCACGCGTCGGGCCTCCTCCGGG + Intergenic
1131108441 15:89750036-89750058 GATCGCCCGTGCCCTCTTCCAGG + Exonic
1132178534 15:99733831-99733853 GGTCCCCTGAGCCCTCCTGCGGG + Intergenic
1132179476 15:99741673-99741695 GCACGGCTAGGCCCTCTTCCAGG - Intergenic
1132351151 15:101140560-101140582 GCTCGCCAGGGCTCCCCTCCAGG + Intergenic
1132473078 16:117780-117802 CCTCACCTGGGCCCTGCTCAGGG - Intronic
1132688466 16:1171984-1172006 GTTCGCGTGGGCCCCCCGCCAGG + Intronic
1132912909 16:2324793-2324815 GCTCCCCTGGGCCTTGCTGCAGG - Intronic
1133277673 16:4648392-4648414 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277698 16:4648464-4648486 GGTCACCTGGCTCCTCCTCCCGG + Intronic
1133277727 16:4648535-4648557 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277742 16:4648571-4648593 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277756 16:4648606-4648628 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277782 16:4648677-4648699 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277821 16:4648784-4648806 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133277835 16:4648819-4648841 GGTCACCCGGGTCCTCCTCCCGG + Intronic
1133850812 16:9501578-9501600 GCTCAGCTGAGCCCTCTTCCTGG - Intergenic
1137674726 16:50298697-50298719 GCTTGCCTGGGGGTTCCTCCTGG + Intronic
1138567540 16:57844601-57844623 GCCAGCCGGGGGCCTCCTCCTGG + Intronic
1139678243 16:68539765-68539787 CCTCGCCAGGGCCCGGCTCCGGG - Exonic
1139972548 16:70785181-70785203 GCTACCCTGTCCCCTCCTCCAGG - Intronic
1140032729 16:71351252-71351274 GCTCACCTCCTCCCTCCTCCTGG + Intergenic
1140565940 16:76042609-76042631 GCTTGCTGTGGCCCTCCTCCTGG + Intergenic
1143107836 17:4538296-4538318 GGTCTCCTGGGCCCTGCCCCTGG - Exonic
1144565067 17:16353205-16353227 GCTCCCCCGGGCCCTCCTCCTGG + Exonic
1145925751 17:28645308-28645330 GCTCCCCCTCGCCCTCCTCCCGG - Intronic
1145992402 17:29086954-29086976 GCTCGCCTCGGCCTCCTTCCTGG + Exonic
1147232466 17:39029351-39029373 GCTCAGCTGGGGCCTCCTCCTGG - Intergenic
1147490754 17:40863828-40863850 CCTCGCCTGGGCCGCCCACCCGG + Exonic
1147611852 17:41806550-41806572 GCTCACATGGTGCCTCCTCCAGG - Intronic
1147951739 17:44111366-44111388 CCTCGCCTGGCGCTTCCTCCTGG - Intronic
1148555810 17:48578007-48578029 ACCCGCCGGGGCCCTCCTCCCGG - Exonic
1148697370 17:49568656-49568678 GATCGCCTGGGTCCCCATCCTGG - Intergenic
1148738547 17:49879110-49879132 CCTCCTCTGGGCCCTCCTGCAGG - Intergenic
1149516406 17:57284202-57284224 GCTGTGCTGGGCCCTCCACCCGG + Intronic
1150350778 17:64442853-64442875 GCTCGCCAGGGCCCACCTCCTGG - Intergenic
1151680012 17:75618104-75618126 GCCCTTCTGTGCCCTCCTCCAGG + Intergenic
1151936365 17:77264382-77264404 GCTGGCCTCGGCCCTCAGCCTGG + Intergenic
1152066000 17:78112845-78112867 GCTGCCCTGGGGCCACCTCCAGG - Exonic
1152097022 17:78278368-78278390 CCCAGCCTGGGCCCTACTCCCGG - Intergenic
1152314574 17:79572615-79572637 ACTCACCTGGGGCCACCTCCGGG - Intergenic
1152337515 17:79706976-79706998 GCCCTGCTAGGCCCTCCTCCTGG + Intergenic
1152611710 17:81318151-81318173 CCTCGCCTGGGGCCACCTTCTGG - Intronic
1154208307 18:12356552-12356574 CCTGGCCTGAGCTCTCCTCCAGG - Intronic
1154241331 18:12657182-12657204 GGTGGGCTGGGCCCTGCTCCGGG - Intronic
1154311034 18:13266309-13266331 GCTAGCCTGGGAGCTCCTCGAGG + Intronic
1156481673 18:37440281-37440303 GCTGGGCTGCGCTCTCCTCCTGG + Intronic
1157274482 18:46301275-46301297 GCTCCCTTGTGCCCTCCCCCTGG - Intergenic
1157718237 18:49904027-49904049 GCTGGCCTGGGCCCTCAGGCAGG + Intronic
1157945284 18:51972706-51972728 ACTGTCCTGGGTCCTCCTCCAGG + Intergenic
1160190125 18:76708627-76708649 TCTCGCGTGGGCCCTTTTCCTGG + Intergenic
1160397003 18:78580031-78580053 GCCTGCCTGGCCCCTCCTCCTGG + Intergenic
1160576075 18:79854413-79854435 GCACCCCTGGGCCCTCCACGGGG - Intergenic
1160709446 19:544341-544363 GCTCACCTCGCCCATCCTCCCGG + Intronic
1160919628 19:1513511-1513533 GCGCGCCTGGGCTCCCATCCGGG + Intronic
1162351722 19:10154464-10154486 CCTCGCCTGGGCTCGCCTACGGG + Exonic
1162905261 19:13819298-13819320 GCTCGCCTCTGCCCTTCCCCAGG - Intronic
1162911059 19:13847886-13847908 GCTCGGCCTCGCCCTCCTCCAGG - Intergenic
1163310171 19:16509569-16509591 CCTCGCCTGGGCCTGCCTCGGGG - Exonic
1163831936 19:19551112-19551134 CCTTCCCTGGGCCCTCCTCTGGG - Intergenic
1165081867 19:33311513-33311535 GCTTCCCTGGGCGCCCCTCCTGG - Intergenic
1165257830 19:34590252-34590274 GGACACCTGGGACCTCCTCCAGG - Intergenic
1165431760 19:35776902-35776924 ACTCACATGTGCCCTCCTCCAGG - Intronic
1165476549 19:36033998-36034020 GCTACCCTGGGCCCTCATCTTGG + Intergenic
1166118909 19:40673338-40673360 GCTCACCTGTGCCCTTCACCTGG + Exonic
1166226245 19:41397413-41397435 GCCGGGCTGGGCCATCCTCCTGG + Exonic
1166287200 19:41838486-41838508 TCTCCCTTGTGCCCTCCTCCAGG + Intronic
1166939052 19:46351904-46351926 GCTCACATGTCCCCTCCTCCGGG - Intronic
1168308443 19:55449363-55449385 GCACTCCTGTGGCCTCCTCCCGG + Intergenic
925177388 2:1795102-1795124 GCTTCCCTGAGCCTTCCTCCAGG + Intronic
925372410 2:3356270-3356292 TCTCAGCTGGGCCCTGCTCCAGG - Intronic
927936663 2:27080083-27080105 TAGCCCCTGGGCCCTCCTCCAGG + Intronic
927967827 2:27282693-27282715 CCTGGCCTGGGCCCTGCTCCTGG - Exonic
928086114 2:28347430-28347452 GCCCAGCTGGCCCCTCCTCCAGG - Intergenic
928201055 2:29247666-29247688 CATTGCCTGGGGCCTCCTCCAGG - Intronic
932739678 2:74282134-74282156 GTTTTGCTGGGCCCTCCTCCAGG - Intronic
933647425 2:84823942-84823964 ACTCGCCTGACCTCTCCTCCAGG + Exonic
934502192 2:94870202-94870224 GCCGGCCAGTGCCCTCCTCCTGG - Intergenic
936008915 2:108912372-108912394 GGACGCCTGGTCTCTCCTCCTGG + Intronic
937127059 2:119481696-119481718 GCTCTCCTGGGCTCTCTGCCTGG - Intronic
937956379 2:127423665-127423687 GCGCACCTGGGGCCACCTCCTGG + Intronic
938274480 2:130005967-130005989 CCGCGCCTAGGCCCTCCGCCAGG + Intergenic
938440893 2:131331313-131331335 CCGCGCCTAGGCCCTCCGCCAGG - Intronic
941765137 2:169288607-169288629 GCTCCCCTGGCCTCTTCTCCAGG - Intronic
942531064 2:176911046-176911068 GCTCACATGGTCCCACCTCCTGG + Intergenic
942890264 2:180980281-180980303 TCCGGCCTGGGCCCGCCTCCGGG - Intronic
946007845 2:216540808-216540830 GCTGGCCTGGGAGCTCCTCAAGG + Intronic
946329604 2:219001908-219001930 GCTTTCCTGGCCCCTCCGCCCGG + Intergenic
946880818 2:224175713-224175735 GCTGGCCAGCGCCCTCTTCCTGG - Intergenic
948856055 2:240731180-240731202 GCTGCAGTGGGCCCTCCTCCAGG - Intronic
1168928000 20:1598748-1598770 TGTGGGCTGGGCCCTCCTCCTGG + Intronic
1169130659 20:3164942-3164964 GCTCGCCTTCGCCCAGCTCCAGG + Exonic
1172100883 20:32483536-32483558 GCTCGCCTGGGCCCTCCTCCTGG - Intronic
1172118385 20:32584381-32584403 GCTCGCCTGGGCAGCGCTCCGGG - Intronic
1172801988 20:37582232-37582254 GGTGGCCTGTGCCCTACTCCAGG - Intergenic
1173803814 20:45911437-45911459 GCTCGCCATGGCCCTCTTCGGGG - Exonic
1174420625 20:50396913-50396935 GCCCTGCTGTGCCCTCCTCCTGG + Intergenic
1175219410 20:57408404-57408426 GTGCGCCTGGGAGCTCCTCCGGG - Exonic
1175757568 20:61539153-61539175 GCACTCCTGGGGACTCCTCCAGG - Intronic
1175778832 20:61669376-61669398 TGTGGCCTGGGCCCTCCTCCAGG - Intronic
1175931868 20:62497332-62497354 GCTCCCGTGGCCCCTCCCCCTGG - Intergenic
1175975787 20:62709786-62709808 GCTCGCCTCGGCCCTGCTGGCGG + Exonic
1176013097 20:62911015-62911037 TCTCGGCGGGACCCTCCTCCCGG + Exonic
1176102519 20:63370914-63370936 GCGCGGCTGGGCTCTTCTCCCGG - Intronic
1176113809 20:63422465-63422487 ACCCGCCCCGGCCCTCCTCCTGG - Intronic
1176387822 21:6147879-6147901 GATTGTCAGGGCCCTCCTCCAGG - Intergenic
1176623818 21:9074964-9074986 GCCGGCCAGTGCCCTCCTCCTGG + Intergenic
1176898043 21:14406186-14406208 GCTCCTCTGTGCCTTCCTCCAGG + Intergenic
1176952759 21:15065325-15065347 GCGCGCCCGGGCCGTCCCCCGGG + Intergenic
1179735650 21:43390369-43390391 GATTGTCAGGGCCCTCCTCCAGG + Intergenic
1179800604 21:43810015-43810037 CCACTCCTGGGCCCTCTTCCTGG - Intergenic
1179996427 21:44976499-44976521 GCTGCCCCGGGCCCTCCTCGTGG - Intronic
1181808034 22:25386765-25386787 GCTTGCCTGGGCCACACTCCCGG + Intronic
1182547417 22:31084221-31084243 GCTCCTCTGGCCCCTCCTCCAGG - Intronic
1182549053 22:31091256-31091278 GCCCCCTGGGGCCCTCCTCCTGG - Exonic
1183230098 22:36576721-36576743 GCCCGCTTGGGGTCTCCTCCTGG + Intronic
1183255487 22:36759017-36759039 GCTCGGCTGGGACCGCCTCCAGG + Intronic
1183906969 22:41048992-41049014 CCGCGCCTGGGCCCGCCCCCTGG - Intergenic
1184265602 22:43344146-43344168 GCCCGCCCTGCCCCTCCTCCTGG - Intergenic
1184788899 22:46687256-46687278 GCTGGCCTGAGCCCCACTCCTGG + Intronic
1185151380 22:49165452-49165474 GCTCGCCAGGGGCCTTTTCCTGG - Intergenic
952829682 3:37554310-37554332 ACTGGTCTGAGCCCTCCTCCAGG - Intronic
953562044 3:43999180-43999202 GCGCGCCAGGGGGCTCCTCCCGG + Intergenic
953791617 3:45951867-45951889 GTTTGCCTTGCCCCTCCTCCTGG - Intronic
953960907 3:47264958-47264980 CCTAGCGAGGGCCCTCCTCCTGG - Intronic
954646319 3:52133774-52133796 GCTTGCTGGGGCCCTTCTCCTGG + Intronic
955146973 3:56329437-56329459 GCTCTCCTGGTTCCTCCTGCAGG + Intronic
955392493 3:58531638-58531660 GGCCACCTGGGCTCTCCTCCTGG + Intronic
959541086 3:107539504-107539526 GTTAGCCTGGGCCCTCCACTGGG - Intronic
960057284 3:113284537-113284559 GCTCGCCTGGGCAGTGCTGCTGG - Exonic
960637374 3:119796698-119796720 GCTCTCCTGGGGGCTCCCCCTGG + Intronic
961044750 3:123700704-123700726 GCTCGGCTGGGATCTCCTTCAGG + Exonic
961455170 3:127020451-127020473 GCAGGCCTGGACCCTCCCCCAGG - Intronic
961654230 3:128432777-128432799 GATCACCTGGGTCCTCCTCCAGG - Intergenic
961675422 3:128562275-128562297 TCTGTCCTGGGACCTCCTCCAGG + Intergenic
961808626 3:129507582-129507604 TGTTGCCTGGCCCCTCCTCCTGG + Intronic
962286776 3:134093048-134093070 TCTGGCCTGGGCTCTCTTCCTGG + Intronic
962960541 3:140307346-140307368 GCTCTCCTTGCCCTTCCTCCTGG + Intronic
963091418 3:141486976-141486998 GCGCGCCTGGCCCCGCCCCCGGG - Intergenic
966878090 3:184335067-184335089 GGCTGCCTGGGCCCCCCTCCAGG + Exonic
968583886 4:1407051-1407073 ACTGGCCTGGCCTCTCCTCCGGG + Intergenic
968652666 4:1766401-1766423 GCAGGCCTGGGCCATCCTCTGGG - Intergenic
971331377 4:25684322-25684344 GCTCTCCTGTCCCCACCTCCTGG - Intergenic
974591533 4:63954288-63954310 GCTGGTAAGGGCCCTCCTCCTGG + Intergenic
980966287 4:139524507-139524529 ACTAGCCTGGGCCTTCCTCATGG + Intronic
982534627 4:156594822-156594844 GCTGGCCAGGGTCCTCCTTCTGG - Intergenic
985996476 5:3599973-3599995 GCGCGCACGGGCCCTCCGCCGGG + Exonic
986728342 5:10616973-10616995 TCTGGCCCGGGCCCTCTTCCAGG + Intronic
986747964 5:10760915-10760937 GCTCGCCGGGGCCCTCCCCGCGG + Intronic
989229807 5:39073887-39073909 CCTCGCCCGAGCCCTTCTCCGGG - Intronic
991769220 5:70025331-70025353 GCCCTCGTGGGCCCTCCGCCCGG - Exonic
991848515 5:70900749-70900771 GCCCTCGTGGGCCCTCCGCCCGG - Exonic
992529170 5:77638839-77638861 GCTCGCCTGCGCCCGCCTGAAGG + Exonic
993460180 5:88173069-88173091 GCTCGGCTGGTCCCACCCCCAGG - Intergenic
993884493 5:93399831-93399853 CCTCACCTGTTCCCTCCTCCTGG + Intergenic
995912726 5:117207256-117207278 GCTAGCCTGGGCCATCTCCCAGG - Intergenic
996029054 5:118684804-118684826 GCTTGACAGGTCCCTCCTCCAGG + Intergenic
997521875 5:134528181-134528203 GGCCGCCTGGCCCCTCCTCTCGG + Intronic
998171345 5:139873628-139873650 GCAGGCCTGGGCCCTCCTGTGGG + Intronic
998957629 5:147453719-147453741 GCCCGCCTCCGCCCCCCTCCCGG + Intronic
1001580400 5:172794281-172794303 GCTGGCCTGGTCCCTCCGTCAGG - Intergenic
1001705012 5:173735294-173735316 TCTCCCCAGGGCCCTCCTGCCGG + Intergenic
1001949110 5:175803778-175803800 GATCCCCTGGGCCCTCCTTCAGG + Intronic
1002094095 5:176820829-176820851 GCTCACCTGGGCCCTGCTGCTGG - Intronic
1002190006 5:177473208-177473230 GCGCGCCTTGGGCCGCCTCCGGG + Intronic
1002861363 6:1082394-1082416 GGACGCCTGGGTCCTGCTCCTGG - Intergenic
1003175975 6:3752220-3752242 ACTGGCCTGGGCCCTCGTCGGGG - Intergenic
1004595273 6:17093787-17093809 GCTCAGCTGGGCCCTCCTGTTGG - Intergenic
1004864028 6:19836892-19836914 GAGCGCCTGGGCCCTGCTCGCGG - Intergenic
1005011708 6:21342091-21342113 GGTGGCCTGGGCACTCTTCCAGG - Intergenic
1005840756 6:29743352-29743374 GCTCCCCATGGGCCTCCTCCAGG - Intergenic
1005928471 6:30464063-30464085 GCGCACCCGGTCCCTCCTCCAGG - Intergenic
1006097634 6:31665897-31665919 GCCCGCAAGCGCCCTCCTCCGGG + Exonic
1007096145 6:39214467-39214489 CCTCAGCTGGGCCCACCTCCTGG - Intronic
1007701763 6:43770102-43770124 GCTCGCCTGTCCCCGCCCCCCGG + Intergenic
1008952717 6:57178019-57178041 GCTGGCCTGGGCTGTGCTCCTGG - Intronic
1010207110 6:73332787-73332809 GCTGGCCTGGGCCATCTTGCTGG - Intergenic
1017914233 6:158819244-158819266 GCCCGCCCGGGCCCTCCACCAGG + Intronic
1018199185 6:161379500-161379522 GCTGGCCAGACCCCTCCTCCAGG + Intronic
1018377416 6:163226560-163226582 GATTGCCTGGGACCTCCTCCAGG - Intronic
1018443515 6:163834581-163834603 GCCCGTCTGGGCCCCTCTCCAGG + Intergenic
1019472431 7:1228021-1228043 GCTCGCCTTTCCACTCCTCCGGG - Intergenic
1019515166 7:1436680-1436702 GGTCGCCTGGTCCATGCTCCCGG - Intronic
1019621685 7:1995548-1995570 CCTCTCCTGGGCCCCCCGCCTGG - Intronic
1019651905 7:2164332-2164354 GCTCAGCTGGGCCCTTCACCTGG - Intronic
1019915776 7:4131323-4131345 GCTCCCCTGAGCCCTCTCCCAGG - Intronic
1024324490 7:48098220-48098242 GCTCACCTGGGCCCCACTCTAGG + Intronic
1029443471 7:100600691-100600713 GCAGGCCTGGGCCATCCCCCCGG - Exonic
1029926950 7:104328564-104328586 GCTCGCCTGGCACAGCCTCCCGG - Intergenic
1030068559 7:105679140-105679162 ACTGGCCAGGGCCCTCATCCAGG - Intronic
1031812039 7:126382492-126382514 GCTCCACTGAGCCCTCTTCCAGG + Intergenic
1032848395 7:135771455-135771477 GCCATCCTGGGCCCTCATCCTGG + Intergenic
1033241373 7:139682521-139682543 GCGTGCCTGTGCCCTCCTCTGGG + Intronic
1034891820 7:154846414-154846436 GCTCTGCTGGGCTATCCTCCAGG - Intronic
1035239267 7:157519460-157519482 GCATGCCTGGGCCCTCCCCTGGG + Intergenic
1035708613 8:1695893-1695915 GCTGGCCAGGGCCGCCCTCCTGG + Intronic
1037888187 8:22606099-22606121 TCTCTTCTGGGCCCTCCTCCTGG + Exonic
1039834478 8:41245862-41245884 GCTCCCCTGGGAACTCTTCCTGG - Intergenic
1041053049 8:53956165-53956187 GCTCGCCTGGTCCTGTCTCCTGG - Intronic
1041353518 8:56974568-56974590 GTTTGCTTGTGCCCTCCTCCTGG - Intronic
1041870065 8:62623745-62623767 TCTAGACTGGGACCTCCTCCTGG - Intronic
1044158536 8:88882098-88882120 GCTTGCTTGGGCCCTCCTGTAGG - Intergenic
1047830598 8:128625713-128625735 GCCTTCCTGGGCCCTCCTGCTGG - Intergenic
1048338774 8:133523102-133523124 GCTCGCCAGGGCCCTGGGCCAGG - Intronic
1048844832 8:138596378-138596400 GCTCACATGGCCCCTCCTCCAGG + Intronic
1048888040 8:138924374-138924396 GCTTGCCCGGGCCCTCCTGTGGG - Intergenic
1049182578 8:141230590-141230612 ACTGGCCTGGGCGCTGCTCCTGG - Intronic
1049687336 8:143944212-143944234 GTGCGGCTGGCCCCTCCTCCCGG - Intronic
1049697950 8:143992879-143992901 GCTGGCCTGGACCCTGCCCCTGG + Exonic
1051501823 9:17786430-17786452 GATAGCCTGGCCCCTTCTCCTGG - Exonic
1052896338 9:33750958-33750980 GCCCACCTGGGGCCCCCTCCGGG + Intronic
1053414271 9:37937015-37937037 CCTCAACTGGCCCCTCCTCCAGG + Intronic
1057269928 9:93644998-93645020 GCCAGCCAGGGGCCTCCTCCTGG + Intronic
1057573223 9:96219477-96219499 GCATGCCTGCGCCCTCCTGCAGG + Intergenic
1057600082 9:96450236-96450258 GCTCGCGTGGGCTGCCCTCCCGG + Exonic
1060700562 9:125746829-125746851 GCCCGCCGGGGCCCTCCTCCGGG + Intergenic
1061105711 9:128528767-128528789 GCTCGCCTTGTTCATCCTCCAGG + Intronic
1061387838 9:130300943-130300965 GCTCCCCTCGGGCCACCTCCAGG - Intronic
1061515895 9:131090333-131090355 ACACGCCTGGCCCCTTCTCCAGG + Intronic
1061647447 9:132016655-132016677 GCTTGGCAGGGGCCTCCTCCTGG + Intronic
1061726234 9:132583353-132583375 GCTCACCTGGGGGCTCCCCCAGG + Intronic
1062013317 9:134278369-134278391 GCTCGGCTGGACCCCCCGCCAGG - Intergenic
1062532489 9:137008038-137008060 GCCCGCCCCGGCCCTCCTGCAGG + Intronic
1062571024 9:137185439-137185461 GCTCGCCTGGGCCCCCCGGCTGG - Intronic
1062629945 9:137459064-137459086 GCTCCTCAGCGCCCTCCTCCTGG + Exonic
1203791570 EBV:154451-154473 GCTAGCCTGTGCTCTTCTCCCGG + Intergenic
1203747003 Un_GL000218v1:45392-45414 GCCGGCCAGTGCCCTCCTCCTGG + Intergenic
1203563100 Un_KI270744v1:74088-74110 GCCGGCCAGTGCCCTCCTCCTGG - Intergenic
1186104642 X:6192793-6192815 ACTCACCTGGGCTGTCCTCCAGG + Intronic
1186466152 X:9786111-9786133 GCGCGCCTGAGCGCCCCTCCCGG + Intronic
1190726511 X:53193776-53193798 TCTTACCTGAGCCCTCCTCCGGG + Exonic
1190879966 X:54484994-54485016 CCCCACCTGGGCCCTCCCCCAGG + Intronic
1192208225 X:69110084-69110106 GCTCATCAGGGCCGTCCTCCAGG - Intergenic
1199724802 X:150569067-150569089 CCTCGCCTTGGCCCTCCGCACGG + Intronic
1200080484 X:153573746-153573768 GCTCAGCTGGGCCTTCCTCCTGG + Intronic