ID: 1172100886

View in Genome Browser
Species Human (GRCh38)
Location 20:32483548-32483570
Sequence GCTGCCGCCGCTGCTCGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 232}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172100886_1172100908 27 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100908 20:32483598-32483620 GGGGAGGGGGCACCGGGCACGGG 0: 1
1: 0
2: 5
3: 75
4: 840
1172100886_1172100891 -7 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG 0: 1
1: 10
2: 192
3: 494
4: 1380
1172100886_1172100899 11 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100899 20:32483582-32483604 CGCGGCCCGGAGGAAGGGGGAGG 0: 1
1: 0
2: 1
3: 40
4: 421
1172100886_1172100909 28 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100909 20:32483599-32483621 GGGAGGGGGCACCGGGCACGGGG 0: 1
1: 0
2: 2
3: 61
4: 539
1172100886_1172100900 12 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100900 20:32483583-32483605 GCGGCCCGGAGGAAGGGGGAGGG 0: 1
1: 0
2: 4
3: 37
4: 521
1172100886_1172100894 5 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100894 20:32483576-32483598 CGGCGCCGCGGCCCGGAGGAAGG 0: 1
1: 0
2: 4
3: 17
4: 238
1172100886_1172100907 26 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100907 20:32483597-32483619 GGGGGAGGGGGCACCGGGCACGG 0: 1
1: 2
2: 7
3: 144
4: 1407
1172100886_1172100901 13 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100901 20:32483584-32483606 CGGCCCGGAGGAAGGGGGAGGGG 0: 1
1: 0
2: 5
3: 45
4: 638
1172100886_1172100893 1 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100893 20:32483572-32483594 GCGGCGGCGCCGCGGCCCGGAGG 0: 1
1: 1
2: 11
3: 89
4: 771
1172100886_1172100895 6 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100895 20:32483577-32483599 GGCGCCGCGGCCCGGAGGAAGGG 0: 1
1: 0
2: 1
3: 5
4: 146
1172100886_1172100892 -2 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100892 20:32483569-32483591 GCGGCGGCGGCGCCGCGGCCCGG 0: 1
1: 6
2: 58
3: 298
4: 1538
1172100886_1172100902 14 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100902 20:32483585-32483607 GGCCCGGAGGAAGGGGGAGGGGG 0: 1
1: 0
2: 6
3: 103
4: 1400
1172100886_1172100897 8 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100897 20:32483579-32483601 CGCCGCGGCCCGGAGGAAGGGGG 0: 1
1: 0
2: 1
3: 73
4: 4274
1172100886_1172100896 7 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100896 20:32483578-32483600 GCGCCGCGGCCCGGAGGAAGGGG 0: 1
1: 0
2: 2
3: 22
4: 173
1172100886_1172100906 21 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100906 20:32483592-32483614 AGGAAGGGGGAGGGGGCACCGGG 0: 1
1: 0
2: 11
3: 106
4: 1090
1172100886_1172100905 20 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100905 20:32483591-32483613 GAGGAAGGGGGAGGGGGCACCGG 0: 1
1: 0
2: 21
3: 231
4: 2176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172100886 Original CRISPR GCTGCCGCCGCTGCTCGCCT GGG (reversed) Intronic
900162656 1:1231789-1231811 GCCGCCGCCGCCTCCCGCCTTGG - Intronic
900204920 1:1427643-1427665 GCCGCTGCTGGTGCTCGCCTCGG + Exonic
900380776 1:2382772-2382794 GTTGCTGCCCCTGCTGGCCTGGG - Intronic
901007742 1:6179972-6179994 GCTGCCGCGGCTGTTCGCCGAGG - Exonic
901443428 1:9293034-9293056 GCCGCCGCCGCTGCTCTCCAAGG - Exonic
901443541 1:9293320-9293342 GCTGCCGCCGCTGCAGGGCAGGG + Intronic
901520531 1:9780847-9780869 GCTGCCACGGCTACTCGCCATGG - Intronic
904033513 1:27547500-27547522 GCTGCAGCCGCTGCTGGCTATGG - Exonic
904082730 1:27882284-27882306 GCCGCCGCCGCAGCTTGCCTTGG - Exonic
907430057 1:54406378-54406400 GCCGCCGCCGCTGGTCTACTTGG + Exonic
907444567 1:54499519-54499541 GCAGCCGCCGCCGCTCGGCGAGG - Intergenic
913343803 1:117787465-117787487 GCTGCCACCTCTGCTCATCTAGG + Intergenic
913963180 1:143354439-143354461 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
914057536 1:144180025-144180047 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
914121610 1:144786341-144786363 GCTGCTGCTGCTGCTGGCCTGGG - Intergenic
914243870 1:145871964-145871986 GCTACCTCAGCTGCTCACCTTGG + Exonic
916444837 1:164862702-164862724 GCTGCCCCCACAGCTCCCCTTGG + Intronic
918105426 1:181412167-181412189 GATGCCCCTGCTGCTCCCCTTGG - Intergenic
919559351 1:199097836-199097858 GCTGCTGCTGCTGCTGGCTTGGG - Intergenic
919847038 1:201648808-201648830 GCCGCCGCCGCCGGGCGCCTTGG - Exonic
922726242 1:227924318-227924340 GCGGCCCGCGCTGCACGCCTTGG + Exonic
923119665 1:230978609-230978631 GCAGCCGCCGCCGCCCGCCGGGG + Exonic
923141458 1:231163734-231163756 GCCGCCGCCGCCGCCCGCCGAGG + Exonic
1063109658 10:3023997-3024019 GCTGTTTCAGCTGCTCGCCTCGG - Intergenic
1063657789 10:8009201-8009223 GCCGCTGCCGCTGCTCGCCCAGG + Exonic
1064642334 10:17427352-17427374 GCTGCCAATGCTGCTGGCCTGGG + Intronic
1065101148 10:22334618-22334640 GCTGTCGCCGCCGCTCGCCACGG - Intergenic
1070965376 10:80527188-80527210 GCTGCAGCTGCTGCTGGTCTGGG - Exonic
1072190614 10:93073979-93074001 GCTGCCGCTGCTGCTCTTCCTGG + Exonic
1072661534 10:97366539-97366561 GCTTCCGCTGCTCCTTGCCTCGG + Exonic
1073327462 10:102650966-102650988 GCTGCTGCCGCTTCAAGCCTGGG - Intronic
1074165657 10:110871989-110872011 GCCCCCGCCGCTGCTCGCCCAGG - Exonic
1074865751 10:117543528-117543550 GGTGCCGCCGCCGCACGCCCTGG + Exonic
1075893926 10:125978368-125978390 GCTTCAGCCCCTGATCGCCTCGG + Intronic
1078507605 11:11964480-11964502 GCTGCCGCCGCTGCACTGCTGGG - Exonic
1078753965 11:14191187-14191209 GCTGCTGCCTCTGGTGGCCTGGG + Intronic
1080386729 11:31814856-31814878 GCTGTGGCCACTGCTCGGCTTGG + Intronic
1081931554 11:46875048-46875070 GCTCCCACCTCTGCTTGCCTCGG - Exonic
1082842926 11:57704047-57704069 GCTGCTGCTGCTGCTGGCCTGGG + Exonic
1083811210 11:65107993-65108015 GCTGCCGCAGCTGCTGGGCCAGG - Exonic
1083951977 11:65961649-65961671 GCTGCTTCCGTCGCTCGCCTTGG - Intergenic
1084697042 11:70761925-70761947 GCTGCTGCTGCTGCTGGTCTGGG + Intronic
1085328040 11:75623593-75623615 GATGCCACCTCTGCTCTCCTAGG - Intronic
1088596853 11:111447636-111447658 TCTGCCGCCTCTGCTCTCCACGG - Intronic
1091271183 11:134312985-134313007 GCTGGTGCTGCTGCTCACCTGGG + Intronic
1091686514 12:2566578-2566600 GCTGGGGCCGCCGCTCACCTTGG - Exonic
1095703629 12:45216059-45216081 GCGGCCGCCGCGGCTCGCTGCGG - Intronic
1096103129 12:48981232-48981254 GCTGCCCACGCTGCGCGCCGTGG + Exonic
1096626173 12:52897414-52897436 GCTGCCGCAGCTGTTCACTTGGG + Exonic
1096710463 12:53452102-53452124 GCTGCTGCCTCTGCTGGTCTGGG - Intronic
1097794014 12:63843799-63843821 GCTCCCGCCCCTGCTCCGCTAGG - Intergenic
1102278385 12:111599495-111599517 GCTGCGGCCGCTGAGCGCATCGG + Exonic
1103720990 12:122975347-122975369 GGCGCAGCTGCTGCTCGCCTCGG - Intronic
1104779961 12:131413662-131413684 GCGGCAGCCGCTGCCCGCATGGG - Intergenic
1104782590 12:131431390-131431412 GGTGAAGCCGCTGCTCCCCTTGG + Intergenic
1104965039 12:132505217-132505239 GCGGCCGCTGCTGGTCTCCTTGG + Intronic
1108002490 13:45916937-45916959 GCTGCTGCTGCTGCTGGCCTGGG - Intergenic
1108727791 13:53201119-53201141 GCCGCCGCCGCCGCTGCCCTCGG + Intergenic
1111227575 13:85294550-85294572 GCAGCAGCTGCTGCTTGCCTTGG - Intergenic
1112402071 13:99086321-99086343 GCCGCCGCTGCTCCCCGCCTCGG - Intronic
1113914798 13:113863845-113863867 GCTGCTGCTGCTGCTGGCCGCGG - Exonic
1113914831 13:113863958-113863980 GCGGCGCCCGCGGCTCGCCTCGG - Exonic
1114069724 14:19097544-19097566 GCGGCCGCTGCTGCCCGGCTGGG + Intergenic
1114092537 14:19302459-19302481 GCGGCCGCTGCTGCCCGGCTGGG - Intergenic
1115179384 14:30604590-30604612 GCTGCTGCTGCTGCTGGTCTGGG + Intronic
1117176733 14:53153213-53153235 GCTGCCGCCGCAGCTCGGGTCGG - Intronic
1118210513 14:63761875-63761897 GCTGCCGCCGCCGCTCGGGCTGG - Intergenic
1118730627 14:68663502-68663524 GCTCCCCCCGCTGCTAGCCCTGG + Intronic
1119602511 14:75986006-75986028 GGCTCCGCCGCTGCTGGCCTGGG + Intronic
1120167899 14:81220344-81220366 GCCGCCGCCGCTTCCCGCCTCGG - Intronic
1121137164 14:91509763-91509785 ACTGCCGCCGCTGGGCGCCGCGG + Exonic
1122130691 14:99603312-99603334 GCTGCCGCCGCTGCCCGCGCTGG + Exonic
1122581959 14:102777051-102777073 GCTGGCGCCGCTCCTCCCCGCGG - Intergenic
1122618856 14:103041666-103041688 GCTGCGGCCGGTGCGCACCTTGG - Intronic
1124500732 15:30225048-30225070 GCCGCCGCCGCAGGTCACCTCGG + Intergenic
1124742837 15:32313619-32313641 GCCGCCGCCGCAGGTCACCTCGG - Intergenic
1127789916 15:62390559-62390581 GCTGCCGCCGCCGCTGGCTCCGG - Intronic
1128582753 15:68820492-68820514 GCTGCCGCCGCCGCTGCCCTTGG - Intronic
1131154669 15:90067556-90067578 GCAGCCGCCACTGGCCGCCTCGG - Exonic
1131425563 15:92342931-92342953 GATGCCGATGCTGCTGGCCTGGG + Intergenic
1132404337 15:101533298-101533320 GCTGCCCCCTCTGCTCCCCAGGG - Intergenic
1133784384 16:8963444-8963466 GCCGCCGCCGCCGCCCGCCGCGG - Exonic
1134149882 16:11797236-11797258 GCTGCCGCCGCCGCTAACCGAGG - Intronic
1135330654 16:21557173-21557195 GCTGCGGCCCCTGCCTGCCTGGG - Intergenic
1136550664 16:30980765-30980787 GCAGCCGCCGCTGCTCGGACCGG - Exonic
1136637935 16:31537579-31537601 GCTCCGGCCGCAGCTCACCTGGG + Intergenic
1138516172 16:57536482-57536504 CCTGCCGCCCCCGCTCACCTCGG + Exonic
1138776544 16:59729981-59730003 GCTGTCGCTGCTGCTGGCATGGG + Intronic
1140378583 16:74465550-74465572 GCTGCTGCTGCTGCTCGTCTAGG + Intronic
1141720404 16:85752336-85752358 GCTGCCCCAGCTGCTGGGCTGGG + Intergenic
1141890969 16:86926293-86926315 GGGGCCGGCGCTGCTCGCCGCGG - Intergenic
1142043678 16:87911640-87911662 GCTGCGGCCCCTGCCTGCCTGGG - Intronic
1142395344 16:89828555-89828577 GCCGCCGCAGCTGCCCGCCCGGG - Exonic
1143027947 17:3951970-3951992 GCTGCTGCTGCTGCTGGTCTGGG - Intronic
1144909955 17:18672678-18672700 GCCGCCGCCGCCGATCGCCATGG + Intronic
1145912879 17:28552586-28552608 GCTGCCGCCGCTGCCTGCGCCGG + Exonic
1145940651 17:28741770-28741792 GCTGCCTCCACTGCTCCCCAGGG + Intronic
1147582917 17:41636993-41637015 GCTGCCGGGGCTGCAGGCCTGGG - Intergenic
1147830745 17:43297054-43297076 GCAGCCCGCGCTCCTCGCCTGGG - Intergenic
1147994608 17:44353948-44353970 GCTGACGCCGCTGCTGGACGAGG - Exonic
1148725742 17:49788787-49788809 GCTGCCGCCGCTGCCCGAATCGG + Exonic
1150217157 17:63477157-63477179 GCTGCCGCCGCAGCCCGCCCTGG + Intergenic
1151267223 17:72966163-72966185 GCTGGCACCCCTGCTGGCCTGGG + Intronic
1151683523 17:75634103-75634125 GTGGGCGCCGCTGCTCCCCTGGG - Intronic
1151704205 17:75758170-75758192 GCTGCCGCTCCTGCCCGCCCAGG + Intronic
1151876069 17:76868853-76868875 GCTCCCTCCGCTGCACGCCCAGG + Intronic
1152345128 17:79746836-79746858 GATTCCGCTGCTGCTGGCCTGGG + Intergenic
1152593040 17:81222942-81222964 GCTGCCGCCGCTGCTCACCCCGG - Intronic
1156036623 18:32772136-32772158 GCCGCCGCCGCCGCCCGGCTCGG + Exonic
1157006491 18:43589946-43589968 GCTGCCACAGCTTCTGGCCTTGG + Intergenic
1157778998 18:50420798-50420820 CCTTCCACCGCTGGTCGCCTTGG + Intergenic
1160423636 18:78766104-78766126 GGTGCCCACGCTCCTCGCCTCGG - Intergenic
1160499712 18:79395740-79395762 GCCGCGGCAGCCGCTCGCCTGGG - Intergenic
1160725382 19:615958-615980 GCCGCCGCCGCAGGTCACCTCGG + Exonic
1160887054 19:1354976-1354998 GCCGCCGCCGCCGCTCCCCGCGG - Intronic
1161103916 19:2434036-2434058 GCTGCCGCTGCTGCTCGAGGTGG + Exonic
1161112609 19:2478613-2478635 GCTGCAGCCCCTGACCGCCTAGG + Intergenic
1161294107 19:3510977-3510999 GCTACCGCCTCACCTCGCCTGGG + Intronic
1161550908 19:4911576-4911598 GCTGCGGCTGCTGCTGACCTGGG + Intronic
1162416955 19:10544029-10544051 GCTGCGGCCGCTGCCCCCCAAGG - Exonic
1162731781 19:12722481-12722503 GTTGCCGCCGCTGCTGCCCGGGG - Intronic
1163220044 19:15912086-15912108 GCTGCTGCTGCTCCTCGGCTGGG - Intergenic
1165732229 19:38153120-38153142 GCTGGTTCCGCTGCTCTCCTAGG - Intronic
1167279468 19:48558452-48558474 GCGGCCACCGCAGCTCTCCTTGG - Intronic
1168071949 19:53958425-53958447 CCGGCCGCCGCTGCCAGCCTTGG + Intergenic
1202697020 1_KI270712v1_random:132698-132720 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
925293880 2:2765469-2765491 GCTGCCTCCGCTCCTCTCCTAGG + Intergenic
925609910 2:5693746-5693768 GCTGCCGCTGCTGCTGGACGAGG - Exonic
926166210 2:10523258-10523280 GCAGCCGCAGGTGCTGGCCTCGG + Intergenic
926172385 2:10560512-10560534 GCTGCTGCTGCAGCTGGCCTGGG - Intergenic
927937091 2:27082244-27082266 GCTGACGCGGCTGCCCGCCCTGG + Exonic
930136227 2:47906055-47906077 GCCGCCGCCGCGCTTCGCCTCGG - Intergenic
932123115 2:69119269-69119291 GCTGCCTCGGATGCTCTCCTCGG + Intronic
933808548 2:86017746-86017768 GCTGCCGTTGCTGCTTACCTGGG + Intergenic
934278181 2:91589712-91589734 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
936047043 2:109196249-109196271 CCTGCATCCGCTGCTCTCCTGGG + Intronic
941431820 2:165422749-165422771 GCTGCCACAGCTGCTCTCATTGG + Intergenic
942461573 2:176171988-176172010 GCCGCCGCCGTTGCTCGCCATGG - Exonic
945907895 2:215615107-215615129 CCTTCCGCAGCTGCTGGCCTGGG + Intergenic
946406063 2:219492705-219492727 GGCGCCGCCGCTGCTCGCCCAGG - Exonic
947315480 2:228853429-228853451 GCTGCCGCTGCTGCTCCCGCAGG + Intronic
947835221 2:233170267-233170289 GCTGAGGCGGCTGCTCCCCTTGG + Intronic
948467435 2:238159068-238159090 GCCGCCGCCGCCGCGGGCCTGGG + Exonic
1170331196 20:15212816-15212838 GCTGCTGATGCTGCTGGCCTAGG - Intronic
1170524691 20:17226596-17226618 GCCGGCGCCCCTGCTCCCCTCGG + Intronic
1172100852 20:32483459-32483481 GCTGCCGCCGCGGCTGCCCGGGG + Exonic
1172100886 20:32483548-32483570 GCTGCCGCCGCTGCTCGCCTGGG - Intronic
1172502674 20:35437953-35437975 GCTGCTGCCGCTGTTCTCTTTGG - Exonic
1173454159 20:43189992-43190014 GCCGCCGCCGCCGCCCGCCCGGG + Intergenic
1173478620 20:43381929-43381951 GCTGCTGCTGCTGCTGGTCTGGG - Intergenic
1174563822 20:51450294-51450316 GCTGCCCCAGGTGCTGGCCTAGG - Intronic
1174611675 20:51802336-51802358 GCTGCGGCTGCTGCTCGCCCTGG + Exonic
1175036246 20:56004093-56004115 GCTGCCGGGGCTGCCCGTCTGGG - Exonic
1175362638 20:58425693-58425715 GCTGCTGCTGCTGCTGGCCCAGG - Intronic
1176200639 20:63858755-63858777 GCTGCTGCAGCTGGTCGTCTGGG + Intergenic
1176313148 21:5165314-5165336 GAGGCCCCTGCTGCTCGCCTTGG - Intergenic
1176550163 21:8217355-8217377 GCCGCCGCCGCCGCGCGCCGAGG - Intergenic
1176569091 21:8400390-8400412 GCCGCCGCCGCCGCGCGCCGAGG - Intergenic
1176577005 21:8444625-8444647 GCCGCCGCCGCCGCGCGCCGAGG - Intergenic
1178488486 21:33033348-33033370 GCTGCCGCTCCTGCCGGCCTAGG + Intergenic
1179197866 21:39183069-39183091 GCTGGCGCCGCTGGACGCCGCGG + Intronic
1179843900 21:44096716-44096738 GAGGCCCCTGCTGCTCGCCTTGG + Intronic
1180488192 22:15820107-15820129 GCGGCCGCTGCTGCCCGGCTGGG + Intergenic
1180837257 22:18936128-18936150 GCGGCCGCCGGTGCCCGCCGTGG - Exonic
1181085127 22:20436393-20436415 GCCGCCGCCGCTGCATTCCTGGG + Intronic
1181235461 22:21445596-21445618 GCAGCCCCCGCTGCTCCCGTTGG - Exonic
1181572032 22:23772945-23772967 GCCGCCGCCGCTGCTGGCCCGGG + Exonic
1183665074 22:39242400-39242422 GCTGCCGCCTCGCCTCGCCGTGG - Intronic
1184226026 22:43129260-43129282 GCTGCTGCCGCTGCTCAGCGGGG + Exonic
1185281512 22:49971899-49971921 CCTGCCCCCGCAGCCCGCCTGGG - Intergenic
1203255056 22_KI270733v1_random:133687-133709 GCCGCCGCCGCCGCGCGCCGAGG - Intergenic
1203263112 22_KI270733v1_random:178766-178788 GCCGCCGCCGCCGCGCGCCGAGG - Intergenic
1203287350 22_KI270734v1_random:161427-161449 GCGGCCGCCGGTGCCCGCCGTGG - Intergenic
950864219 3:16175818-16175840 GCTGCTGACGCTGCTGGCCCAGG - Intronic
950964786 3:17138723-17138745 GCTGCTGGCACTGCTTGCCTGGG - Intergenic
951995200 3:28719751-28719773 GCTGCTGCTGCTGCTGGTCTGGG + Intergenic
954416452 3:50395736-50395758 GCTGTGGCCTCTGCTCTCCTGGG + Intronic
955228422 3:57079284-57079306 GCTGCGGCGGCGGCTCCCCTGGG + Exonic
959931462 3:111987925-111987947 GCTGCTGCTGCTGCTAGCCTAGG - Intronic
964622622 3:158732316-158732338 GCTGCTGCTGTTGCTCGCCCCGG - Exonic
969032568 4:4226624-4226646 GCTGCTGCTGCTGCTGGCCTGGG - Exonic
971279891 4:25234247-25234269 GCTGCTACCGCGGATCGCCTGGG + Exonic
973613760 4:52659572-52659594 GCTGCCGCAGCGGCGCGCCCCGG - Intergenic
974161852 4:58150389-58150411 GCTGCAGACCCTGCTTGCCTAGG - Intergenic
975585059 4:75940883-75940905 GCTGCTGCTGCTGCTGGCCGGGG - Exonic
975883551 4:78939233-78939255 GCCGCCGCCGCTCCCCGGCTCGG + Exonic
975986235 4:80203144-80203166 GCCGCCGCCGCCGCTCGGCAGGG - Exonic
977065816 4:92313593-92313615 CCTGCATCCGCTGCTCTCCTTGG - Intronic
977928601 4:102728732-102728754 GCTGCCGCAGCTGTTCACTTGGG + Intronic
981270743 4:142845722-142845744 GCCGCCGCCGCCGCCGGCCTGGG - Intronic
981569089 4:146132482-146132504 GCTGCACCTGCTGCTGGCCTGGG + Intergenic
984167589 4:176320557-176320579 GCCGGCGCCGCCGCCCGCCTGGG + Intronic
985559880 5:579738-579760 GCTGCCTCAGATGCTGGCCTTGG + Intergenic
990607126 5:57422516-57422538 GCTGCGGCTGCTGCTCGCCCTGG - Intergenic
991567715 5:68021759-68021781 GCTGCTGCGGCTGCTGGTCTGGG - Intergenic
992866269 5:80960375-80960397 GCTGCCGCCCCAGCCCGCCGCGG + Intergenic
994323865 5:98426158-98426180 GCTGCTGCTGCTGCTGGTCTTGG - Intergenic
997528085 5:134566319-134566341 GCTGCAGCCGCTGCTTGCGCAGG - Exonic
999189212 5:149733661-149733683 GCTGTCTCCCCTGCTAGCCTGGG - Intronic
1002526489 5:179818572-179818594 GCTGCCCCGGCTGGTCTCCTGGG + Intronic
1002618073 5:180467749-180467771 GCTGCCGCTGATTCTGGCCTGGG + Intergenic
1003188109 6:3850090-3850112 GCTGCAGCCGCTGCTCCTCCAGG - Exonic
1003870384 6:10398270-10398292 GCCGCCGCCGCCGCTGCCCTTGG - Exonic
1003982464 6:11402802-11402824 GCCTCCGCAGCTGCTGGCCTGGG + Intergenic
1004265421 6:14144868-14144890 GCTGCGGCCGCTGGGCCCCTGGG + Intergenic
1005948310 6:30611657-30611679 GCTTCTGCTGCTGCTCGCCTAGG - Intronic
1006048879 6:31324579-31324601 GAGGCCACCGCTCCTCGCCTAGG + Intronic
1007234166 6:40378551-40378573 GCTGCTGCCCGTCCTCGCCTAGG + Intergenic
1007414693 6:41684632-41684654 GCTCCGGCGGCTGCTGGCCTTGG + Exonic
1008018825 6:46552744-46552766 GCTGCTGCTGCTGCTTGTCTGGG - Intronic
1008369408 6:50715454-50715476 GCTCCCGCCTCTGCTCGTCCAGG - Exonic
1013242725 6:108260984-108261006 GCCGCCGCTGCTGCCCGCCGTGG + Exonic
1013273357 6:108561435-108561457 GCCGCCGCCGCCGATCGCCATGG - Exonic
1013803331 6:113970966-113970988 GCTGCCGCCGCGGCTCGGCCGGG + Exonic
1014137623 6:117907477-117907499 GCCGCCGCCGCCGCCCGCCCCGG - Intergenic
1016330128 6:142946043-142946065 GCGGCGGCCGCTCCTCGCCAAGG + Intergenic
1018331040 6:162727707-162727729 GCTGGCGCCGCTGCGCGCATGGG - Exonic
1018876618 6:167827147-167827169 GCTTCCGCCGCTCCTCGTCACGG - Exonic
1019373587 7:676797-676819 GCAGCCCCCGTTGCTCTCCTGGG - Intronic
1019373686 7:677087-677109 GCAGCCCCCGTTGCTCGCCTGGG - Intronic
1019435475 7:1020241-1020263 GCTGCAGCCTCTGCCCTCCTGGG + Intronic
1019827868 7:3299678-3299700 GCTGCTGCTGCTGCTGCCCTGGG + Intergenic
1021894780 7:25223468-25223490 GCTGCAGCTGCTGCTCCCCCAGG + Intergenic
1022815106 7:33905651-33905673 GTTACTGCCGCCGCTCGCCTGGG + Exonic
1023768933 7:43536936-43536958 GGTGCCGCCGCTGCCTGCCCAGG - Intronic
1026522774 7:71131626-71131648 GGCGCCGCCGCCGCTCCCCTCGG + Intergenic
1028762260 7:94509688-94509710 GCAGCCGCCGCCGCCCGCCGGGG + Intronic
1032085182 7:128880032-128880054 GCTGCCCCCGCTGCCTGCCTCGG - Exonic
1032250618 7:130254317-130254339 GCTTCAGACGCTGCTTGCCTGGG + Intergenic
1032511159 7:132473391-132473413 CCTGCCGCCACTGCCCTCCTGGG - Intronic
1035448162 7:158957068-158957090 GCTGCTGCTGCTGCCGGCCTGGG + Intergenic
1035705742 8:1673022-1673044 TTTGACGCCGCTGCTAGCCTGGG + Intronic
1037855313 8:22367339-22367361 TCTGCCGCCGCCGGCCGCCTGGG + Exonic
1037947735 8:22999727-22999749 GCCGCCGCCGCTACGCGCCCGGG - Intronic
1038578062 8:28722363-28722385 TCTACCACCGCTCCTCGCCTAGG - Intronic
1041167200 8:55102111-55102133 GCGGCCGCCGCGGCGCTCCTCGG - Intergenic
1043769685 8:84183146-84183168 GCGGCGGCAGCTGCGCGCCTCGG + Intronic
1048072706 8:131039460-131039482 GCTGCCGCTGCCGCTCACCTGGG - Exonic
1049075905 8:140396022-140396044 GCTGTCAGCACTGCTCGCCTGGG + Intronic
1049237241 8:141518493-141518515 GCTGCGGCCCCTGCACGCCACGG + Exonic
1049707655 8:144050328-144050350 GCTGACGCCGCTGCTGGACTGGG + Intergenic
1049845530 8:144799063-144799085 ACTGTCGCCTCCGCTCGCCTTGG + Intronic
1050091023 9:2016524-2016546 GCCGCCGCCGTGGCTCTCCTGGG - Intronic
1050749049 9:8915604-8915626 GCTGCCGCATCAGCTCACCTAGG - Intronic
1051351048 9:16198159-16198181 GCTGCCGCCGCCGCTGCCCTGGG + Intergenic
1055208603 9:73762688-73762710 GCTTCAGCCTCTGGTCGCCTTGG - Intergenic
1056475258 9:86946680-86946702 GCTGCTGCAGCTGCTGGGCTCGG - Exonic
1056475287 9:86946776-86946798 GCGGCCGCCGCTGCCCGCGATGG - Exonic
1057297708 9:93859281-93859303 GCTCCCGCCCCTGCTGGGCTAGG + Intergenic
1057488625 9:95506079-95506101 GCCGCTGCCGCTGTCCGCCTGGG - Intronic
1059320256 9:113463549-113463571 GCTGCCGTCGCTGCTCAGCGCGG + Intronic
1060468742 9:123930181-123930203 GCCGCCGCCGCTGCCCGCTGGGG + Intergenic
1060921212 9:127421892-127421914 GATGCTGCTGCTGCTGGCCTGGG + Intergenic
1061725973 9:132582264-132582286 GCAGCCGCCGCCGCTCTCCGCGG + Exonic
1061817162 9:133204457-133204479 GGTTCCGCCTCGGCTCGCCTGGG + Intergenic
1062230603 9:135479808-135479830 GCTGCCGCCGCCCCGCGCCCGGG - Exonic
1062306021 9:135907483-135907505 GCCGCCGCCGCCGCTCACCCGGG - Intergenic
1062349648 9:136132683-136132705 GCTGGGGCCGCGGCTCGGCTGGG + Intergenic
1062574712 9:137200758-137200780 GCCGCCGCCGCGGCCAGCCTGGG + Exonic
1062617241 9:137403416-137403438 GCTGCTGCTGCTGCTGGGCTGGG - Intronic
1062659081 9:137619045-137619067 GCCGGCCCCGCTGCTCACCTCGG - Exonic
1203471456 Un_GL000220v1:116827-116849 GCCGCCGCCGCCGCGCGCCGAGG - Intergenic
1203479277 Un_GL000220v1:160799-160821 GCCGCCGCCGCCGCGCGCCGAGG - Intergenic
1186849902 X:13569885-13569907 GCTCCCGCTGCTGCTCTCCTGGG + Exonic
1187507210 X:19887496-19887518 GCTGCTGCCGCTGCTGCCCCGGG + Exonic
1188437117 X:30173687-30173709 GCTGCTGCTGCTGCTGGCCTGGG - Intergenic
1189893704 X:45632273-45632295 GCTGCCGCAGCTGTTCCCTTGGG + Intergenic
1190008055 X:46758936-46758958 GCTGCCGCTGCTGCTGGGTTGGG - Exonic
1190296400 X:49030185-49030207 GCTGCGGCGGCTGCTGGCCTTGG + Exonic
1190304417 X:49073951-49073973 GCTGCCACCGCTACGCGCCCTGG - Exonic
1190881529 X:54495597-54495619 GCTGCCACGGCTGCTGGCCCGGG - Exonic
1191220836 X:57986125-57986147 GCTGCCACCGCTGTTCACTTGGG - Intergenic
1193250863 X:79289231-79289253 GCTGCTGCTGCTGCTGGCATGGG + Intergenic
1199927346 X:152481016-152481038 GCTGCCGCAGCTGTTCACTTGGG - Intergenic