ID: 1172100886

View in Genome Browser
Species Human (GRCh38)
Location 20:32483548-32483570
Sequence GCTGCCGCCGCTGCTCGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 232}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172100886_1172100909 28 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100909 20:32483599-32483621 GGGAGGGGGCACCGGGCACGGGG 0: 1
1: 0
2: 2
3: 61
4: 539
1172100886_1172100895 6 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100895 20:32483577-32483599 GGCGCCGCGGCCCGGAGGAAGGG 0: 1
1: 0
2: 1
3: 5
4: 146
1172100886_1172100896 7 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100896 20:32483578-32483600 GCGCCGCGGCCCGGAGGAAGGGG 0: 1
1: 0
2: 2
3: 22
4: 173
1172100886_1172100908 27 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100908 20:32483598-32483620 GGGGAGGGGGCACCGGGCACGGG 0: 1
1: 0
2: 5
3: 75
4: 840
1172100886_1172100891 -7 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG 0: 1
1: 10
2: 192
3: 494
4: 1380
1172100886_1172100907 26 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100907 20:32483597-32483619 GGGGGAGGGGGCACCGGGCACGG 0: 1
1: 2
2: 7
3: 144
4: 1407
1172100886_1172100899 11 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100899 20:32483582-32483604 CGCGGCCCGGAGGAAGGGGGAGG 0: 1
1: 0
2: 1
3: 40
4: 421
1172100886_1172100906 21 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100906 20:32483592-32483614 AGGAAGGGGGAGGGGGCACCGGG 0: 1
1: 0
2: 11
3: 106
4: 1090
1172100886_1172100897 8 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100897 20:32483579-32483601 CGCCGCGGCCCGGAGGAAGGGGG 0: 1
1: 0
2: 1
3: 73
4: 4274
1172100886_1172100902 14 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100902 20:32483585-32483607 GGCCCGGAGGAAGGGGGAGGGGG 0: 1
1: 0
2: 6
3: 103
4: 1400
1172100886_1172100900 12 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100900 20:32483583-32483605 GCGGCCCGGAGGAAGGGGGAGGG 0: 1
1: 0
2: 4
3: 37
4: 521
1172100886_1172100894 5 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100894 20:32483576-32483598 CGGCGCCGCGGCCCGGAGGAAGG 0: 1
1: 0
2: 4
3: 17
4: 238
1172100886_1172100892 -2 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100892 20:32483569-32483591 GCGGCGGCGGCGCCGCGGCCCGG 0: 1
1: 6
2: 58
3: 298
4: 1538
1172100886_1172100905 20 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100905 20:32483591-32483613 GAGGAAGGGGGAGGGGGCACCGG 0: 1
1: 0
2: 21
3: 231
4: 2176
1172100886_1172100901 13 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100901 20:32483584-32483606 CGGCCCGGAGGAAGGGGGAGGGG 0: 1
1: 0
2: 5
3: 45
4: 638
1172100886_1172100893 1 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100893 20:32483572-32483594 GCGGCGGCGCCGCGGCCCGGAGG 0: 1
1: 1
2: 11
3: 89
4: 771

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172100886 Original CRISPR GCTGCCGCCGCTGCTCGCCT GGG (reversed) Intronic