ID: 1172100887

View in Genome Browser
Species Human (GRCh38)
Location 20:32483549-32483571
Sequence CGCTGCCGCCGCTGCTCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 315}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172100887_1172100899 10 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100899 20:32483582-32483604 CGCGGCCCGGAGGAAGGGGGAGG 0: 1
1: 0
2: 1
3: 40
4: 421
1172100887_1172100891 -8 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG 0: 1
1: 10
2: 192
3: 494
4: 1380
1172100887_1172100907 25 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100907 20:32483597-32483619 GGGGGAGGGGGCACCGGGCACGG 0: 1
1: 2
2: 7
3: 144
4: 1407
1172100887_1172100909 27 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100909 20:32483599-32483621 GGGAGGGGGCACCGGGCACGGGG 0: 1
1: 0
2: 2
3: 61
4: 539
1172100887_1172100900 11 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100900 20:32483583-32483605 GCGGCCCGGAGGAAGGGGGAGGG 0: 1
1: 0
2: 4
3: 37
4: 521
1172100887_1172100905 19 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100905 20:32483591-32483613 GAGGAAGGGGGAGGGGGCACCGG 0: 1
1: 0
2: 21
3: 231
4: 2176
1172100887_1172100896 6 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100896 20:32483578-32483600 GCGCCGCGGCCCGGAGGAAGGGG 0: 1
1: 0
2: 2
3: 22
4: 173
1172100887_1172100897 7 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100897 20:32483579-32483601 CGCCGCGGCCCGGAGGAAGGGGG 0: 1
1: 0
2: 1
3: 73
4: 4274
1172100887_1172100893 0 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100893 20:32483572-32483594 GCGGCGGCGCCGCGGCCCGGAGG 0: 1
1: 1
2: 11
3: 89
4: 771
1172100887_1172100906 20 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100906 20:32483592-32483614 AGGAAGGGGGAGGGGGCACCGGG 0: 1
1: 0
2: 11
3: 106
4: 1090
1172100887_1172100908 26 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100908 20:32483598-32483620 GGGGAGGGGGCACCGGGCACGGG 0: 1
1: 0
2: 5
3: 75
4: 840
1172100887_1172100910 30 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100910 20:32483602-32483624 AGGGGGCACCGGGCACGGGGAGG 0: 1
1: 0
2: 4
3: 39
4: 426
1172100887_1172100902 13 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100902 20:32483585-32483607 GGCCCGGAGGAAGGGGGAGGGGG 0: 1
1: 0
2: 6
3: 103
4: 1400
1172100887_1172100894 4 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100894 20:32483576-32483598 CGGCGCCGCGGCCCGGAGGAAGG 0: 1
1: 0
2: 4
3: 17
4: 238
1172100887_1172100901 12 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100901 20:32483584-32483606 CGGCCCGGAGGAAGGGGGAGGGG 0: 1
1: 0
2: 5
3: 45
4: 638
1172100887_1172100892 -3 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100892 20:32483569-32483591 GCGGCGGCGGCGCCGCGGCCCGG 0: 1
1: 6
2: 58
3: 298
4: 1538
1172100887_1172100895 5 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100895 20:32483577-32483599 GGCGCCGCGGCCCGGAGGAAGGG 0: 1
1: 0
2: 1
3: 5
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172100887 Original CRISPR CGCTGCCGCCGCTGCTCGCC TGG (reversed) Intronic
900380777 1:2382773-2382795 CGTTGCTGCCCCTGCTGGCCTGG - Intronic
900762510 1:4482597-4482619 TGCTGCCGCTGCTTCTCCCCAGG + Intergenic
901000122 1:6144818-6144840 CGCAGCAGCCGCTGCTCACCGGG - Intronic
901002281 1:6154769-6154791 CGCCGCCGCCGCTGCTGCCGCGG + Exonic
901313795 1:8291477-8291499 CGCTGCAGCCTCTGCTGCCCGGG + Intergenic
901377504 1:8849755-8849777 CGCTGCAACCGCTGCTTCCCGGG + Intergenic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
903413678 1:23167765-23167787 CGCGGCCGCTGCGGGTCGCCAGG + Intronic
903907707 1:26697492-26697514 CCCCGCCGCCGCTGCTCCCGGGG - Exonic
904392285 1:30193949-30193971 CGCTGTCCCCTCTGCTCCCCTGG - Intergenic
904719986 1:32500601-32500623 CGCTGCAGCTGCTGCGCCCCAGG - Intronic
905819552 1:40979324-40979346 CGCTGCCGCCGTCCCTCGCCCGG + Exonic
905862675 1:41361609-41361631 CGCCGCTGCCGCCGCTCCCCGGG - Intergenic
905990754 1:42335174-42335196 TGCTGCCGCCGCCGCTCTCGGGG - Intronic
906640560 1:47438395-47438417 CGCTGCGGCCGCCGCCCCCCGGG - Exonic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG + Exonic
911188449 1:94926420-94926442 GGCTGCGGCAGCGGCTCGCCGGG + Intronic
912431955 1:109632724-109632746 CGCTGCCCCTGCTGCTGGCTGGG + Intergenic
913963179 1:143354438-143354460 GGCTGCTGCTGCTGCTGGCCTGG + Intergenic
914057535 1:144180024-144180046 GGCTGCTGCTGCTGCTGGCCTGG + Intergenic
914121611 1:144786342-144786364 GGCTGCTGCTGCTGCTGGCCTGG - Intergenic
915278785 1:154808220-154808242 CGCTCCAGCTGCTGCTCACCAGG + Intronic
920458310 1:206117367-206117389 CGCTCCAGCCGCTGCTCACCAGG - Intronic
921023823 1:211259632-211259654 CGCTGCCGCCGCCGCCTGCCGGG - Exonic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
922558126 1:226548665-226548687 CTCTGACGCCCCTCCTCGCCAGG - Intergenic
923119664 1:230978608-230978630 TGCAGCCGCCGCCGCCCGCCGGG + Exonic
923674039 1:236065008-236065030 TGCTGCCGCTGCTGCTGGCGGGG - Exonic
1064443167 10:15371233-15371255 CGCCGCCGCCGCGGCTCTTCGGG - Intergenic
1064982009 10:21174343-21174365 CGCCACCGCCGCTGCAGGCCGGG + Intergenic
1066429342 10:35336883-35336905 CGCCGCCGCCGCTGCTGACCCGG + Exonic
1068620588 10:59177025-59177047 CTCCGCCGACGCCGCTCGCCAGG + Intronic
1071086636 10:81874555-81874577 CGCTGTCGCCGCCGCGAGCCAGG - Intergenic
1072915540 10:99535511-99535533 CGCCGCCGCCGCCGCCCGCCGGG - Exonic
1074169678 10:110919828-110919850 CGCCGCCGCCGCCGCTTTCCTGG + Intronic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1075129495 10:119726069-119726091 CGCTGCCGCCGCCGCTGCCGGGG + Intergenic
1076670963 10:132120929-132120951 CGCTGCCCCCGCAGCTCGAGCGG - Intronic
1076702885 10:132283421-132283443 CTCTGCCTCCGCTGGTCGCACGG - Intronic
1076792848 10:132786034-132786056 CGCTGCAGCCGACGCCCGCCCGG - Exonic
1076848176 10:133080265-133080287 CGCTGCCGGCTCTGGTCCCCAGG + Intronic
1077074898 11:695872-695894 CGCGCCCGCCGCTGCAAGCCCGG - Intronic
1078507606 11:11964481-11964503 GGCTGCCGCCGCTGCACTGCTGG - Exonic
1078753964 11:14191186-14191208 CGCTGCTGCCTCTGGTGGCCTGG + Intronic
1078758397 11:14232859-14232881 TGCTGCCGCCGCTGCCCCACTGG - Intronic
1081779943 11:45703245-45703267 CGCTGCCGCCCCTGCTTTCCTGG - Intergenic
1081925749 11:46826820-46826842 CGCCGCCGCCGCCGCCTGCCGGG - Intronic
1082842925 11:57704046-57704068 GGCTGCTGCTGCTGCTGGCCTGG + Exonic
1083812309 11:65112647-65112669 CGCTGCTGCTGTGGCTCGCCTGG + Exonic
1084146215 11:67266638-67266660 CGCCGCCGCTCCTGCTCGCTCGG - Exonic
1084377284 11:68786283-68786305 CACTGCAGCCTCTGCTCCCCAGG - Intronic
1084556662 11:69879833-69879855 AGCTGCCCCCACTGCTGGCCAGG + Intergenic
1084952508 11:72674396-72674418 CACTGCCTCTGCTGCTCGGCTGG + Exonic
1084973034 11:72781709-72781731 CGCCGCCGCCGCAGCTGCCCGGG + Intronic
1085274183 11:75287669-75287691 CTCTGCCGCTGCTGCTCCACTGG - Intronic
1085456908 11:76670623-76670645 CGCGGCCGCAGCTCCTCTCCCGG + Intronic
1089966068 11:122655924-122655946 CGCTGCCGCCGCCTCCTGCCTGG + Exonic
1090662214 11:128890662-128890684 CCCAGCCGCCGCCGCACGCCGGG + Intergenic
1091286737 11:134412225-134412247 CGGTGCCGCCGCGGCTCTGCCGG + Intergenic
1091558687 12:1594467-1594489 TGCCGCCGCCGCTGCTCCGCGGG + Intronic
1092172935 12:6384663-6384685 TGCTGCTCCCGCTGCCCGCCAGG + Exonic
1092659499 12:10723027-10723049 GGCGGCCGCCGCGGCTCCCCAGG - Exonic
1093925255 12:24902946-24902968 CGCTGCGGCCCTTGCCCGCCAGG - Exonic
1094375404 12:29783757-29783779 CGCCGCCGCCGCTGCTGCCCTGG + Exonic
1095584561 12:43836062-43836084 CGCTGCCGCTGCTGCTGTCACGG - Intronic
1096773701 12:53951699-53951721 GGCTCCCGCCGCAGCTGGCCAGG - Intergenic
1097079031 12:56415994-56416016 CGCTGCAGCCTCTGCCTGCCAGG - Intergenic
1097457006 12:59812168-59812190 TGTTGCCGCTGCTGCTCCCCGGG + Intergenic
1097929626 12:65169829-65169851 CGCCGCCGCCGCTGGTCCCGCGG - Exonic
1098161421 12:67649924-67649946 CGCTGCCGCCGCAGCCCACACGG + Exonic
1101144823 12:101830941-101830963 CGCCGCAGCCGCCTCTCGCCCGG - Intergenic
1101716662 12:107318525-107318547 CGCCGCCGCCGCAGCTCCGCGGG - Exonic
1102554252 12:113716218-113716240 CGCTGCAGCCTCTGCTTCCCAGG - Intergenic
1103509923 12:121467259-121467281 CGCCGCCGCCGCCGCCCGCCCGG + Intronic
1103563393 12:121804061-121804083 CGCTGCTGCTGCTGCTGCCCGGG - Intergenic
1103764124 12:123269804-123269826 CGCTGCCGCCGCTGCTCCTCCGG - Intronic
1104441753 12:128798988-128799010 GGCTGCAGCAGCTGCTCGCTGGG + Intronic
1104981527 12:132575035-132575057 CGCTCCCGCAGCTCCTAGCCTGG - Intronic
1107954210 13:45494919-45494941 CACTGCAGCCTCTGCTTGCCGGG + Intronic
1108002491 13:45916938-45916960 TGCTGCTGCTGCTGCTGGCCTGG - Intergenic
1108227461 13:48303954-48303976 CGCTGCCGCCGCGGAACCCCCGG + Exonic
1108541498 13:51451736-51451758 CGCCGCCGCCGCTGCCGGGCCGG + Intronic
1108689266 13:52847296-52847318 CGCCGCCGCCGCTGCACTCGGGG - Exonic
1108727794 13:53201121-53201143 CGCCGCCGCCGCTGCCCTCGGGG + Intergenic
1109543539 13:63811840-63811862 CACTTCAGCCGCTGCTCGCGGGG + Intergenic
1112431697 13:99355815-99355837 CTGTGCCGCCGCTGCCCTCCAGG - Intronic
1115320888 14:32077606-32077628 CGCTGCAGCTGCTGCCCGCCCGG - Intronic
1115490032 14:33950356-33950378 CCCTGCCGCAGCTGCTCCCGCGG - Intronic
1116973877 14:51095025-51095047 CACAGCCGCCGCCGCTGGCCAGG - Exonic
1117690391 14:58299346-58299368 CGCTGCCGCCACCGCGGGCCCGG + Intronic
1120850171 14:89162746-89162768 CGCTGCCCTCGCTGCCCTCCTGG + Exonic
1122202240 14:100129619-100129641 CGCCACCCCCGCTGCTTGCCCGG - Exonic
1123023862 14:105414622-105414644 CGCCGCCGCCTCTGCCCACCAGG - Intronic
1124133052 15:27007153-27007175 CACTGCAGCCTCTGCTCTCCAGG + Intronic
1124158886 15:27251868-27251890 CTCTGCCGCCTCTGATAGCCCGG + Intronic
1124735522 15:32242945-32242967 CGCTGTCCCCACTTCTCGCCCGG + Intergenic
1125200752 15:37099063-37099085 CGCTGCCGCCGTGGCTCGCGCGG - Intronic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1126392863 15:48178140-48178162 GGCTCTCGCCGCGGCTCGCCCGG + Exonic
1126649734 15:50908697-50908719 CCCGGCCGCCGCTGCCGGCCCGG - Exonic
1129870069 15:78934379-78934401 CCCTGCCCCCGCTGTTCTCCCGG - Intronic
1129871583 15:78944949-78944971 CGCTGCCGCTGCTCTGCGCCGGG - Exonic
1129956053 15:79637780-79637802 TGCTACAGCCGCTGCTTGCCAGG - Intergenic
1130716917 15:86343812-86343834 TGCTGTTGCCGCTGCTCGCAGGG + Intronic
1132255571 15:100373478-100373500 CGCCGCCGCCGCGCCTGGCCGGG - Intergenic
1132404338 15:101533299-101533321 GGCTGCCCCCTCTGCTCCCCAGG - Intergenic
1132519748 16:381738-381760 TGCTGCTGCTGCTGCTTGCCCGG - Exonic
1132589853 16:721868-721890 CGCTGGCGCGGCTGCACGCCTGG + Exonic
1132593488 16:737257-737279 TGATGCAGCCGCTGCACGCCAGG + Exonic
1132725014 16:1334669-1334691 CGCTGCAAACGCTGCTCCCCGGG - Exonic
1133945920 16:10348460-10348482 CACTGCAGCCGCTGCGTGCCAGG + Intronic
1135821887 16:25692388-25692410 CGCCGCCGCCGCCGCGAGCCGGG + Exonic
1136498835 16:30659691-30659713 CGTCGCCGCCGCCGCCCGCCAGG + Exonic
1136641548 16:31569416-31569438 GGCGGCCGCCGCGGCTCCCCAGG - Intergenic
1137988718 16:53131323-53131345 CGCCGCCGCCGCTGCTCGGCCGG + Intronic
1140087308 16:71808692-71808714 CGCTGCCGCGGGCGCTCGACCGG - Intronic
1140222984 16:73057854-73057876 CGCGGCCGCCACCGCTGGCCGGG - Intronic
1140481713 16:75265857-75265879 CGCTGGCGCCGCTGCCCGCCAGG - Exonic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1142177283 16:88651050-88651072 CACTGCCGCCCCTGCGCTCCCGG + Exonic
1142395345 16:89828556-89828578 CGCCGCCGCAGCTGCCCGCCCGG - Exonic
1142631445 17:1229011-1229033 CGCTGCGGCCGCCGCCCCCCGGG + Intronic
1142764076 17:2056111-2056133 CGCTGCCTCCGCTCCCCGCGCGG + Intronic
1143036940 17:4004836-4004858 CGCACCCGCGGCTGCTCTCCCGG - Exonic
1143183542 17:4998038-4998060 AGCTGCCCCCGCCCCTCGCCGGG - Exonic
1143904413 17:10198034-10198056 CGCTGCCGTCGCTGCCCCCCAGG + Intronic
1144586758 17:16491987-16492009 CCATGCCGCCGCCGCCCGCCGGG + Exonic
1144838007 17:18167641-18167663 TGCTGCAGCAGCTGCTCGCTGGG - Exonic
1145236783 17:21214101-21214123 CGCTGCCGCCACTGCTGCCCGGG + Exonic
1145247013 17:21275950-21275972 CGCTGCCGCCTTTGCTTGCGCGG + Intergenic
1145940650 17:28741769-28741791 GGCTGCCTCCACTGCTCCCCAGG + Intronic
1146896213 17:36544332-36544354 CCCTGACACCGCGGCTCGCCAGG - Intergenic
1147582918 17:41636994-41637016 CGCTGCCGGGGCTGCAGGCCTGG - Intergenic
1148214072 17:45824963-45824985 CTCTGCAGCCCCTGCTGGCCTGG + Intronic
1148559592 17:48598167-48598189 CGCGGCCGCTGCTGCTCCGCCGG + Exonic
1149038171 17:52158091-52158113 CGCCGCCGCCGCTGCTAGTGCGG - Exonic
1149599712 17:57885528-57885550 CGCTGCCGCTGCTGCTCCGGCGG + Exonic
1150208070 17:63424199-63424221 CGCTGATGCCGCTTCTCCCCAGG + Exonic
1151683524 17:75634104-75634126 CGTGGGCGCCGCTGCTCCCCTGG - Intronic
1151854434 17:76710875-76710897 CGCTGGCCCTTCTGCTCGCCTGG - Exonic
1152164055 17:78689958-78689980 CGCTGCTTCCGCTGCTGCCCAGG + Intronic
1152356625 17:79810607-79810629 CTCCTCCGCCGTTGCTCGCCGGG - Intergenic
1152689687 17:81712353-81712375 CGCTGCGGCCGGTACACGCCGGG + Exonic
1152759049 17:82098746-82098768 CGCCGCCGTCGCTGCCCGCGCGG + Intergenic
1157095099 18:44680204-44680226 CGCCGCCGCCTCCGCGCGCCCGG + Intronic
1158954699 18:62526615-62526637 CGCCGCCGCCGCCGCGCACCCGG + Intronic
1160499713 18:79395741-79395763 CGCCGCGGCAGCCGCTCGCCTGG - Intergenic
1160788737 19:913172-913194 CGCCGCCGCCGCCGCCCGGCAGG + Exonic
1160839542 19:1139717-1139739 CACTGCAGCCTCTGCTTGCCTGG - Intronic
1160869229 19:1269470-1269492 CGCTGCGGCCCCGCCTCGCCTGG - Intronic
1160887051 19:1354974-1354996 CGCCGCCGCCGCTCCCCGCGGGG - Intronic
1160995728 19:1881216-1881238 CGCGGCCACAGCTGCTCACCTGG + Exonic
1161156137 19:2732712-2732734 CCCTGCCGCCGGAGCCCGCCGGG - Exonic
1161975981 19:7607909-7607931 CCCAGCCCCCGCTGCTGGCCTGG + Intronic
1162731782 19:12722482-12722504 AGTTGCCGCCGCTGCTGCCCGGG - Intronic
1162778635 19:12995536-12995558 CCATGCCGCCGCCGCTCGGCCGG - Intergenic
1163708554 19:18832095-18832117 CGCTGTCGCCCCCGCGCGCCCGG - Exonic
1164658635 19:29942684-29942706 CGCTTCCGCCTCCGCCCGCCGGG + Intronic
1165070847 19:33254131-33254153 CCCAGCCACCGCTGCTGGCCAGG - Intergenic
1165153099 19:33772289-33772311 CCCGGCGGCTGCTGCTCGCCCGG - Exonic
1165961637 19:39539837-39539859 CGCTGCCACCGGGGCTCCCCTGG + Exonic
1167171642 19:47836248-47836270 CGCTCCCGCCGCTGCTTCCTGGG - Exonic
1167308022 19:48719995-48720017 ACCTGCCGCTGCTGCTCACCCGG - Intergenic
1167557473 19:50205306-50205328 CGCCGCCGCCGCCGCCCACCTGG + Intronic
1168721808 19:58558496-58558518 CGCTGCTGCCGCCACCCGCCCGG + Exonic
1168721984 19:58559233-58559255 CGCTGCTGCCGCCACCCGCCCGG + Intergenic
1202697019 1_KI270712v1_random:132697-132719 GGCTGCTGCTGCTGCTGGCCTGG + Intergenic
925398945 2:3558190-3558212 CCCTGCCGCCGCGGCTCTCGCGG - Exonic
927714315 2:25342176-25342198 CGCTCCCGCCGCGGCGCCCCGGG - Intronic
929107202 2:38376999-38377021 CGCCGCCGCGCCTGCCCGCCGGG - Intronic
929681275 2:43995755-43995777 CCCTGGCGCCGCAGCTTGCCTGG + Intronic
931516640 2:63054052-63054074 CGCTCCCGCCGCTGCTTCCGCGG - Exonic
933985106 2:87584343-87584365 CGCTGCCTGCGCTGCGCTCCCGG + Intergenic
934079052 2:88452278-88452300 CGCCGCCGCCGCCGCCCCCCGGG - Exonic
934278180 2:91589711-91589733 GGCTGCTGCTGCTGCTGGCCTGG + Intergenic
934993307 2:98936304-98936326 CGCCGCCTCCGCAGCTGGCCCGG + Intergenic
936038314 2:109129619-109129641 CGACGCCGCCGTCGCTCGCCTGG - Exonic
936308735 2:111366468-111366490 CGCTGCCTGCGCTGCGCTCCCGG - Intergenic
937986970 2:127642306-127642328 CGCTGCCGCCTCGGCTCTGCAGG - Intronic
938465479 2:131522145-131522167 CGCTGCTGCCCTTGCTCCCCAGG - Intergenic
941104942 2:161341255-161341277 CGCTGGCCCTTCTGCTCGCCTGG - Intronic
942046519 2:172102301-172102323 CGCCGCCGCCGCCGCCCGCCGGG + Exonic
943715726 2:191150677-191150699 CGCAGCCGCCGCAGCTCCCCTGG + Intronic
944675846 2:202033872-202033894 CGCCGCCGCCGCCGCCCGCCGGG - Intergenic
945999810 2:216472277-216472299 CACTGCAGCCGCTGCTTCCCAGG - Intronic
946767346 2:223052899-223052921 CGCTGCCGCCGCCGGCCGCACGG - Exonic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
947641614 2:231710414-231710436 CCCTGCCCCCACTGCTCCCCGGG + Intronic
948140476 2:235669506-235669528 CGCCGCCGCCGCCGCGCTCCCGG + Intronic
948910250 2:240999098-240999120 CGCCCCGGCCGCTGCCCGCCGGG + Intronic
1168839176 20:898182-898204 CCCTGACGCTGCTCCTCGCCAGG + Intronic
1169065561 20:2692797-2692819 CGCCGCCGCCGCCGCTCCCGGGG - Intergenic
1171346724 20:24470857-24470879 CGCTGGCGCCGCGGCGCTCCTGG + Intronic
1172100851 20:32483458-32483480 TGCTGCCGCCGCGGCTGCCCGGG + Exonic
1172100887 20:32483549-32483571 CGCTGCCGCCGCTGCTCGCCTGG - Intronic
1172474528 20:35226884-35226906 CGCCGCCGCCGCCGCCCGCGCGG - Exonic
1172939342 20:38643953-38643975 CCGTGCCGCCCCTGCTCTCCAGG + Intronic
1173166205 20:40688864-40688886 CGCAGCCGCCGCTGCCGCCCGGG + Exonic
1173454158 20:43189991-43190013 CGCCGCCGCCGCCGCCCGCCCGG + Intergenic
1173999002 20:47360724-47360746 CGCTCCTGCTGCTGCTCGCCTGG - Intergenic
1175036247 20:56004094-56004116 CGCTGCCGGGGCTGCCCGTCTGG - Exonic
1175517193 20:59577318-59577340 CGCTCCCGCTCCCGCTCGCCCGG + Intergenic
1176249704 20:64114666-64114688 CACTGCCCCAGCTGCCCGCCCGG - Intergenic
1178104005 21:29298887-29298909 CGCTGCCCTCGCCGCCCGCCGGG + Intronic
1179674910 21:42974753-42974775 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1180899780 22:19361864-19361886 CGCTGTCACTGCTGCTCTCCAGG + Exonic
1181085126 22:20436392-20436414 CGCCGCCGCCGCTGCATTCCTGG + Intronic
1181155488 22:20917568-20917590 CGCCGGCGCCGCAGCTCGACGGG - Exonic
1181458149 22:23070932-23070954 CGCCGCTCCCGCAGCTCGCCTGG - Intronic
1181572031 22:23772944-23772966 AGCCGCCGCCGCTGCTGGCCCGG + Exonic
1182429012 22:30289373-30289395 CGCCGCAGCCGGTGCGCGCCCGG - Exonic
1183247212 22:36703231-36703253 CGCCGCCGCCGCCGCTGCCCGGG - Exonic
1183842542 22:40511769-40511791 CTCTGCCACTGCTGCTGGCCTGG - Intronic
1183898890 22:40990570-40990592 TGCTTCCGCCACTGCTCACCCGG - Intergenic
1183931446 22:41238155-41238177 CGCAGCCGGCGCAGCTGGCCCGG + Exonic
1184226025 22:43129259-43129281 TGCTGCTGCCGCTGCTCAGCGGG + Exonic
1184662285 22:45970899-45970921 CGCAGCCGGGGCTGCCCGCCGGG + Intronic
1185045317 22:48525687-48525709 AGCTGCTGCTGCTGCTGGCCTGG + Intronic
1185345067 22:50307432-50307454 CGCAGCCGCCGCAGGTCCCCGGG + Intronic
950153819 3:10707962-10707984 CGCTGCCGCTGGTGCGCGCCCGG + Intronic
951717483 3:25664604-25664626 CGCGGGCGCCGCTGCAGGCCGGG + Intronic
954265934 3:49470359-49470381 CGCCGCCACCGCCGCTCCCCGGG - Exonic
955769247 3:62372550-62372572 CGCCTCCGCCGCCGCCCGCCCGG + Exonic
959539880 3:107525261-107525283 CTCTGCCTCCGCTGCCCCCCAGG - Intronic
961144715 3:124584552-124584574 GGCTCCGGCCGCTGCTGGCCAGG + Intronic
961545296 3:127629139-127629161 CGCCGCCGCCGCCGCCCGCGCGG + Intergenic
963503913 3:146161272-146161294 ACCCGCCGCCGCTGCGCGCCCGG + Intronic
966362832 3:179148533-179148555 CGCCGCCGCCGCCGCCCGCGGGG + Exonic
967190474 3:186980246-186980268 CGCTGCATCCACTGCTCCCCAGG - Intronic
967357642 3:188590496-188590518 CGCTGCAACCTCTGCTTGCCAGG - Intronic
968463475 4:737567-737589 CTCTGCAGCCCCTGCTCTCCTGG + Intronic
968479128 4:826107-826129 AGCCGCCGCCGCAGCTCACCGGG - Exonic
968514415 4:1010271-1010293 CGCAGCCGCCGCTGTGCACCCGG - Intronic
968583698 4:1406337-1406359 CGCTCCCGCCGCCGCTGCCCAGG - Intergenic
968651961 4:1763721-1763743 CGCTGCCGGCGCCTCTCGGCCGG - Intergenic
968812549 4:2806530-2806552 GGCTGGCACTGCTGCTCGCCTGG - Intronic
969032569 4:4226625-4226647 GGCTGCTGCTGCTGCTGGCCTGG - Exonic
969715870 4:8867842-8867864 CGCAGCCGCCGCTGGGCCCCCGG - Exonic
971257901 4:25030790-25030812 TGCCGCCGCCGCTGCTGGCGAGG + Exonic
971279890 4:25234246-25234268 CGCTGCTACCGCGGATCGCCTGG + Exonic
972497942 4:39651528-39651550 CGCTGCAGCCTCTGCCCCCCAGG + Intergenic
972589460 4:40470816-40470838 CGCTGCAGCCTCTGCTTCCCGGG + Intronic
973916074 4:55636100-55636122 TGCTGCTGCTGCTGCTCGCCTGG - Exonic
975585060 4:75940884-75940906 TGCTGCTGCTGCTGCTGGCCGGG - Exonic
975702067 4:77075951-77075973 CGCTGCCGCGTCCGCTCGCGGGG + Exonic
975986236 4:80203145-80203167 GGCCGCCGCCGCCGCTCGGCAGG - Exonic
978285383 4:107072041-107072063 CACTGCAGCCGCTGCCCCCCGGG - Intronic
978621360 4:110637185-110637207 CGCTCCCCCCGGCGCTCGCCCGG - Intronic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
982157417 4:152535854-152535876 TGCAGCCGCCGCTGCCGGCCGGG + Exonic
985520998 5:373842-373864 CGCTCCCGCCCCCGCCCGCCCGG - Intronic
987086485 5:14474360-14474382 AGCTGCCGGAGCTGCTGGCCTGG + Intronic
990323177 5:54649241-54649263 ACCTTCCGCAGCTGCTCGCCGGG + Intergenic
990955023 5:61332320-61332342 CGCCGCCGCCGCCGCCCGGCCGG - Exonic
991676485 5:69094016-69094038 CCCTACCGCCGCTGCTTCCCGGG + Exonic
992627632 5:78649066-78649088 CGCCGCCGCCGCTGCCCGGCGGG - Intronic
993901111 5:93584811-93584833 CGCTGCCGCCGCTACTGCCTCGG - Exonic
994197560 5:96936389-96936411 CAGCGCCGCCGCCGCTCGCCCGG + Intronic
995048173 5:107672470-107672492 CGCTGCTGCCGCTGCGGCCCGGG + Intergenic
996978288 5:129460359-129460381 CGCGGCCGCGGCTTCTCGCCCGG - Exonic
997583985 5:135034051-135034073 TGCCGCCGCCTCTGCCCGCCCGG - Exonic
998228894 5:140346705-140346727 CGCTGCCGGCGCCGCGAGCCGGG - Intergenic
998957771 5:147454292-147454314 CGCCGCCTCTGCTGCTCGCGGGG + Intronic
1000220521 5:159209541-159209563 CGCGGCCGCCGCAGAGCGCCGGG - Intronic
1001476075 5:172051833-172051855 CACTGCAGCCGCTGCTGGCATGG - Intronic
1002505877 5:179678847-179678869 CGCGGTCGCCGCTGCTCTCGCGG - Exonic
1004216944 6:13711807-13711829 CGCCGCGGCCGCTGCTCTCGCGG + Intergenic
1004272930 6:14211280-14211302 CGCTGCCGCCGATGCCCACAAGG + Intergenic
1004558715 6:16726303-16726325 CACTGCAGCCTCTGCTCCCCCGG - Intronic
1005040345 6:21595191-21595213 CGCCGCCGCCGCCGCCTGCCAGG - Exonic
1005832383 6:29681103-29681125 CGCTCCAGCCGCTGGTCCCCGGG - Intronic
1006137144 6:31902038-31902060 CGCCGCCGCCGCCGCGCGCGCGG - Intronic
1007614332 6:43171514-43171536 CGCGGCCGCCGCTGCGAACCCGG - Exonic
1007788915 6:44297791-44297813 TGCCGCTGCCGCTGCGCGCCAGG + Intronic
1007954325 6:45902437-45902459 CGCTGCTGCTGCTGCGCACCTGG - Exonic
1008018826 6:46552745-46552767 CGCTGCTGCTGCTGCTTGTCTGG - Intronic
1011470333 6:87701844-87701866 CGCTGCCGCCGCTGCCTCCGCGG + Exonic
1013117652 6:107115046-107115068 CGCTGCCGCCGCCGCGCGGCCGG + Intronic
1013803330 6:113970965-113970987 TGCTGCCGCCGCGGCTCGGCCGG + Exonic
1014543953 6:122710649-122710671 CGCTGCCTCCACTGCTCACGTGG + Intronic
1015994930 6:138987900-138987922 CGCAGCCGCAGCCGCGCGCCGGG - Exonic
1017470421 6:154733323-154733345 CGCGGCCGCCGGGGCTCGCACGG + Intronic
1017671962 6:156777685-156777707 CGCCGCCGCTGCTGCCCGCGCGG - Intergenic
1018331041 6:162727708-162727730 GGCTGGCGCCGCTGCGCGCATGG - Exonic
1019279321 7:192292-192314 CTCGGCCGCAGCTGCTGGCCTGG + Intergenic
1019373687 7:677088-677110 GGCAGCCCCCGTTGCTCGCCTGG - Intronic
1019435474 7:1020240-1020262 CGCTGCAGCCTCTGCCCTCCTGG + Intronic
1022018444 7:26376221-26376243 CGCTCCCGCCGCGTCCCGCCCGG + Intergenic
1022090076 7:27102251-27102273 GGCTGCCGCGGCTGCCCGCGGGG + Exonic
1022106221 7:27199711-27199733 GGCTGCCGCCGCTGCTGCCGCGG - Exonic
1022687303 7:32608855-32608877 CACTGCCTCCACTGCTCACCAGG - Intergenic
1022815105 7:33905650-33905672 CGTTACTGCCGCCGCTCGCCTGG + Exonic
1026000435 7:66556571-66556593 CGCTGCAGCGGCTGGTCCCCAGG - Intergenic
1026941589 7:74290400-74290422 CGCGGCCGCCGCCCCTCCCCGGG - Intronic
1027374567 7:77537294-77537316 CGCTAGCGCAGCGGCTCGCCTGG + Exonic
1028762259 7:94509687-94509709 CGCAGCCGCCGCCGCCCGCCGGG + Intronic
1029205996 7:98869730-98869752 CCCTGCAGCCGCAGCCCGCCCGG - Intronic
1029438769 7:100576219-100576241 AGCTCCCGCCTCTGCTCACCTGG + Exonic
1030727131 7:112939453-112939475 CCCAGCCGCTGCTGCTCTCCCGG - Intronic
1031134717 7:117873004-117873026 CGCTGCGGTCGCTTCTGGCCGGG - Intronic
1032306232 7:130734191-130734213 CGCTGCCGCCGCCGCCCGCGCGG + Intergenic
1033253190 7:139777818-139777840 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1034306284 7:150047674-150047696 CGCCGCCGCCGCCGCGCTCCCGG + Intergenic
1034578927 7:152025927-152025949 CGCCGCCGCCGCAGCTCTCGAGG - Intronic
1034618022 7:152435854-152435876 CGCCGCCGCCGCTGCTGCTCGGG + Exonic
1034800563 7:154052979-154053001 CGCCGCCGCCGCCGCGCTCCCGG - Intronic
1034900840 7:154907047-154907069 CTCTGCTGCTGCTGCTGGCCCGG - Intergenic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1035404381 7:158588121-158588143 GCCTGCCGCCGCTCCCCGCCCGG + Intergenic
1035448161 7:158957067-158957089 CGCTGCTGCTGCTGCCGGCCTGG + Intergenic
1035705741 8:1673021-1673043 CTTTGACGCCGCTGCTAGCCTGG + Intronic
1037947736 8:22999728-22999750 GGCCGCCGCCGCTACGCGCCCGG - Intronic
1039559195 8:38498938-38498960 CACTGCAGCCTCTGCTTGCCAGG - Intergenic
1041552684 8:59119264-59119286 CGCTGCCGCCGCCGCCGGGCAGG + Intergenic
1042785098 8:72537388-72537410 CGCCGCCGCCGCTGCGCCTCGGG + Exonic
1045096216 8:98800728-98800750 CCCTTCCGCAGCTGCTGGCCCGG - Intronic
1045564365 8:103298796-103298818 CGCCGCCGCCGCCGCGAGCCCGG + Intronic
1045738011 8:105318838-105318860 CGCCGCCGCCGCCGCTGGCCAGG - Exonic
1048072707 8:131039461-131039483 TGCTGCCGCTGCCGCTCACCTGG - Exonic
1049694487 8:143976753-143976775 CGCCGCCTCCGCCGCTCTCCCGG - Intergenic
1049707654 8:144050327-144050349 AGCTGACGCCGCTGCTGGACTGG + Intergenic
1049711145 8:144063936-144063958 AGCTGCCGCCGCTGGCTGCCAGG - Intergenic
1051023082 9:12569346-12569368 CACTGCAGCCTCTGCTTGCCAGG + Intergenic
1051351047 9:16198158-16198180 TGCTGCCGCCGCCGCTGCCCTGG + Intergenic
1052991792 9:34522944-34522966 CGCTCCCGCCGCGGCGCGACCGG + Exonic
1055757567 9:79572458-79572480 CGCCGCGGCCGCCGCTCACCCGG - Intronic
1057488626 9:95506080-95506102 CGCCGCTGCCGCTGTCCGCCTGG - Intronic
1057489293 9:95508941-95508963 CGCAGCTGCCGCTGCTCCCGCGG + Intronic
1060468741 9:123930180-123930202 TGCCGCCGCCGCTGCCCGCTGGG + Intergenic
1060825106 9:126683289-126683311 GGCTCCCGCCGCCGCCCGCCCGG + Intronic
1061144121 9:128787270-128787292 CGCCGCCGCCGCCGCCCCCCAGG - Exonic
1061610040 9:131740027-131740049 CGCGCCCGCCGCCGCTCCCCCGG + Intronic
1061802763 9:133121185-133121207 CGCCGCCCCCGCCGCGCGCCGGG - Intronic
1062230604 9:135479809-135479831 CGCTGCCGCCGCCCCGCGCCCGG - Exonic
1062244951 9:135561506-135561528 TGCTCCCGCCGCTGCCAGCCTGG + Intergenic
1062306022 9:135907484-135907506 CGCCGCCGCCGCCGCTCACCCGG - Intergenic
1062349647 9:136132682-136132704 CGCTGGGGCCGCGGCTCGGCTGG + Intergenic
1186546925 X:10459670-10459692 CACTGCTGCGGCTGCCCGCCTGG + Exonic
1186849901 X:13569884-13569906 CGCTCCCGCTGCTGCTCTCCTGG + Exonic
1187507209 X:19887495-19887517 TGCTGCTGCCGCTGCTGCCCCGG + Exonic
1188437118 X:30173688-30173710 TGCTGCTGCTGCTGCTGGCCTGG - Intergenic
1189262524 X:39688870-39688892 CGCCGCCGCCGCGGCTCTGCAGG + Intergenic
1189333851 X:40158284-40158306 GGCTGTCGCCGCTTCTCCCCCGG + Intronic
1189407086 X:40735271-40735293 CGCTGCAGCTGCGGCTAGCCCGG - Exonic
1189534606 X:41923528-41923550 CGCAGCCGCCACCGCCCGCCCGG + Intergenic
1190108337 X:47574218-47574240 CCCTGGCGCTGCTGCCCGCCCGG + Exonic
1190881530 X:54495598-54495620 CGCTGCCACGGCTGCTGGCCCGG - Exonic
1195894697 X:109733419-109733441 CGCGCCCGCCCCCGCTCGCCCGG + Intergenic
1196819570 X:119692460-119692482 CGGCGCCGCCGCCGCCCGCCCGG + Intronic
1197754474 X:129984232-129984254 CGCCGCCGCCGCTTCTGGGCGGG + Intronic
1199500369 X:148500673-148500695 CGCCGCCGCCGCTGCCGCCCCGG + Exonic
1199705863 X:150424401-150424423 TGCTGCTGCTGCTGCTCCCCAGG - Intronic
1199986843 X:152958956-152958978 CTCTGCCTGCGGTGCTCGCCGGG + Intronic
1200100746 X:153688279-153688301 CGCCGCCGCCGCCGCCCGGCCGG + Exonic