ID: 1172100891

View in Genome Browser
Species Human (GRCh38)
Location 20:32483564-32483586
Sequence CGGCAGCGGCGGCGGCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2077
Summary {0: 1, 1: 10, 2: 192, 3: 494, 4: 1380}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172100887_1172100891 -8 Left 1172100887 20:32483549-32483571 CCAGGCGAGCAGCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG 0: 1
1: 10
2: 192
3: 494
4: 1380
1172100875_1172100891 26 Left 1172100875 20:32483515-32483537 CCGGCCCGGGGGCGGGGGTGGCC 0: 1
1: 0
2: 5
3: 62
4: 509
Right 1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG 0: 1
1: 10
2: 192
3: 494
4: 1380
1172100878_1172100891 21 Left 1172100878 20:32483520-32483542 CCGGGGGCGGGGGTGGCCAGGAG 0: 1
1: 0
2: 6
3: 83
4: 736
Right 1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG 0: 1
1: 10
2: 192
3: 494
4: 1380
1172100874_1172100891 27 Left 1172100874 20:32483514-32483536 CCCGGCCCGGGGGCGGGGGTGGC 0: 1
1: 0
2: 13
3: 157
4: 906
Right 1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG 0: 1
1: 10
2: 192
3: 494
4: 1380
1172100877_1172100891 22 Left 1172100877 20:32483519-32483541 CCCGGGGGCGGGGGTGGCCAGGA 0: 1
1: 0
2: 7
3: 96
4: 956
Right 1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG 0: 1
1: 10
2: 192
3: 494
4: 1380
1172100886_1172100891 -7 Left 1172100886 20:32483548-32483570 CCCAGGCGAGCAGCGGCGGCAGC 0: 1
1: 0
2: 1
3: 40
4: 232
Right 1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG 0: 1
1: 10
2: 192
3: 494
4: 1380
1172100883_1172100891 5 Left 1172100883 20:32483536-32483558 CCAGGAGGAGGGCCCAGGCGAGC 0: 1
1: 0
2: 3
3: 28
4: 337
Right 1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG 0: 1
1: 10
2: 192
3: 494
4: 1380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172100891 Original CRISPR CGGCAGCGGCGGCGGCGCCG CGG Intronic
Too many off-targets to display for this crispr