ID: 1172100913

View in Genome Browser
Species Human (GRCh38)
Location 20:32483610-32483632
Sequence CTCTCCCGCCTCCCCGTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 439}

Found 22 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172100913_1172100933 10 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100933 20:32483643-32483665 CGGGCACGGGGCGGGGGCGGGGG 0: 1
1: 1
2: 40
3: 388
4: 2259
1172100913_1172100935 12 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100935 20:32483645-32483667 GGCACGGGGCGGGGGCGGGGGGG 0: 1
1: 3
2: 62
3: 577
4: 3221
1172100913_1172100928 4 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100928 20:32483637-32483659 CGGGACCGGGCACGGGGCGGGGG 0: 1
1: 0
2: 2
3: 70
4: 652
1172100913_1172100942 30 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100942 20:32483663-32483685 GGGGGAGGGGAGCGCAGGGAGGG 0: 1
1: 6
2: 65
3: 1166
4: 6715
1172100913_1172100940 26 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100940 20:32483659-32483681 GCGGGGGGGAGGGGAGCGCAGGG 0: 1
1: 0
2: 9
3: 270
4: 4049
1172100913_1172100926 2 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100926 20:32483635-32483657 GGCGGGACCGGGCACGGGGCGGG 0: 1
1: 0
2: 6
3: 117
4: 818
1172100913_1172100920 -10 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100920 20:32483623-32483645 GGCGGGAGAGGGGGCGGGACCGG 0: 1
1: 1
2: 13
3: 199
4: 2015
1172100913_1172100939 25 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100939 20:32483658-32483680 GGCGGGGGGGAGGGGAGCGCAGG 0: 1
1: 2
2: 22
3: 335
4: 2785
1172100913_1172100921 -9 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100921 20:32483624-32483646 GCGGGAGAGGGGGCGGGACCGGG 0: 1
1: 2
2: 11
3: 135
4: 1102
1172100913_1172100938 17 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100938 20:32483650-32483672 GGGGCGGGGGCGGGGGGGAGGGG 0: 3
1: 21
2: 293
3: 2348
4: 10730
1172100913_1172100923 -3 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100923 20:32483630-32483652 GAGGGGGCGGGACCGGGCACGGG 0: 1
1: 0
2: 2
3: 37
4: 531
1172100913_1172100929 7 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100929 20:32483640-32483662 GACCGGGCACGGGGCGGGGGCGG 0: 1
1: 0
2: 4
3: 107
4: 859
1172100913_1172100925 1 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100925 20:32483634-32483656 GGGCGGGACCGGGCACGGGGCGG 0: 1
1: 0
2: 7
3: 89
4: 743
1172100913_1172100930 8 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100930 20:32483641-32483663 ACCGGGCACGGGGCGGGGGCGGG 0: 1
1: 0
2: 4
3: 119
4: 919
1172100913_1172100934 11 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100934 20:32483644-32483666 GGGCACGGGGCGGGGGCGGGGGG 0: 1
1: 3
2: 40
3: 450
4: 2814
1172100913_1172100932 9 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100932 20:32483642-32483664 CCGGGCACGGGGCGGGGGCGGGG 0: 1
1: 0
2: 33
3: 292
4: 1724
1172100913_1172100936 15 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100936 20:32483648-32483670 ACGGGGCGGGGGCGGGGGGGAGG 0: 1
1: 8
2: 167
3: 1141
4: 7435
1172100913_1172100924 -2 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100924 20:32483631-32483653 AGGGGGCGGGACCGGGCACGGGG 0: 1
1: 0
2: 3
3: 23
4: 424
1172100913_1172100941 29 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100941 20:32483662-32483684 GGGGGGAGGGGAGCGCAGGGAGG 0: 1
1: 4
2: 53
3: 532
4: 3689
1172100913_1172100937 16 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100937 20:32483649-32483671 CGGGGCGGGGGCGGGGGGGAGGG 0: 1
1: 9
2: 127
3: 1322
4: 15362
1172100913_1172100927 3 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100927 20:32483636-32483658 GCGGGACCGGGCACGGGGCGGGG 0: 1
1: 0
2: 7
3: 100
4: 592
1172100913_1172100922 -4 Left 1172100913 20:32483610-32483632 CCGGGCACGGGGAGGCGGGAGAG 0: 1
1: 0
2: 0
3: 41
4: 439
Right 1172100922 20:32483629-32483651 AGAGGGGGCGGGACCGGGCACGG 0: 1
1: 0
2: 4
3: 70
4: 593

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172100913 Original CRISPR CTCTCCCGCCTCCCCGTGCC CGG (reversed) Intronic
900109206 1:998531-998553 CTTTCCCGACTCCCAGTCCCCGG - Intergenic
900109603 1:999979-1000001 GCCCCGCGCCTCCCCGTGCCGGG + Exonic
900176088 1:1292053-1292075 CCCTCCAGCCGCCCCGCGCCCGG + Intergenic
900226517 1:1535824-1535846 CTCTCCCGCCACCCCCGGCCTGG + Intronic
900570353 1:3355228-3355250 CTCTCCCTCCCCCTCCTGCCAGG - Intronic
900630651 1:3633429-3633451 CCTTCCCGCCGCCCCGGGCCGGG - Exonic
900958932 1:5907117-5907139 CTCTCAGGCCTCCCCGGCCCAGG - Exonic
901063838 1:6485667-6485689 CACCCCCGCCTCCGCCTGCCCGG + Intronic
901066612 1:6497379-6497401 CTCTGCGGCCTCCCAGTCCCCGG - Intronic
901435085 1:9242671-9242693 CTCCCCCACCTGCCCATGCCAGG + Intronic
901667570 1:10835373-10835395 CCTGCCCGCCTCCCCTTGCCCGG - Intergenic
901696685 1:11012907-11012929 GCCACCGGCCTCCCCGTGCCAGG - Intronic
901741753 1:11346329-11346351 ATCTCCCGCGTCCCTCTGCCTGG + Intergenic
902350059 1:15847785-15847807 CTCCCCCGCCCGCCCCTGCCCGG + Intergenic
902489598 1:16771634-16771656 CTCTCCAGCCTCCTCTTGCTTGG + Intronic
902598487 1:17525170-17525192 CTCTCCTCCCTCCCCATGCTGGG - Intergenic
903660471 1:24974163-24974185 CACTCCCTCACCCCCGTGCCAGG + Intergenic
903778664 1:25808580-25808602 GTCTCCCGCCTCGCCCTGTCCGG + Exonic
903897870 1:26620627-26620649 CTCTCCTGGCTCCCCGAGGCGGG + Intergenic
904321300 1:29699174-29699196 ATCTCCTGCCTCCCCGTTTCTGG + Intergenic
904533288 1:31182636-31182658 CTCTTCCTCCGCCCCCTGCCGGG + Intronic
904799219 1:33081201-33081223 CTCTCTCGCTTCCCCGGGCTCGG - Exonic
905037806 1:34929309-34929331 CCCTCCCCCCTCCCGGGGCCGGG + Intronic
905866985 1:41381962-41381984 CTCGGCCGCCTCCCCGAGCAGGG - Exonic
905964271 1:42077990-42078012 CCCTCCCGCCACCCCATGACAGG - Intergenic
906225485 1:44118522-44118544 CTCTCCAGCCTCCTCCTGGCTGG + Intergenic
906411768 1:45584480-45584502 CTCTCCTTCCTCCCCCAGCCCGG + Intronic
906544966 1:46614151-46614173 CTCTTCTACCTCCCAGTGCCAGG - Intronic
907289552 1:53404230-53404252 CTCTCCCCACTCCACCTGCCTGG + Intergenic
907654158 1:56325317-56325339 CTCTCGCTCCTCCTCCTGCCAGG - Intergenic
907692213 1:56680506-56680528 CTCTCCTGCCACCCCATGACAGG + Intronic
908605298 1:65792230-65792252 CTCTCTCGCCTCCCCCAACCCGG + Intergenic
908750456 1:67417618-67417640 CTCTCCCGCCTCAGCCTCCCAGG + Intronic
911025943 1:93435432-93435454 CTCTCCCTACTCCTGGTGCCTGG - Intergenic
912578347 1:110696704-110696726 CTCTCCCGCCTTCCCTCACCTGG - Intergenic
913328547 1:117648824-117648846 CTCTCCCCCCACCCCATGACGGG - Intergenic
915172264 1:153986275-153986297 CAGTCCCGCCTACCAGTGCCGGG - Exonic
915570927 1:156744650-156744672 CCCTCCCGCCTCGTCCTGCCCGG + Intronic
917971223 1:180209077-180209099 CCCTCCAGCCCCCCAGTGCCTGG - Intergenic
918403357 1:184187269-184187291 CTCTCCTGCCCCCTCATGCCTGG - Intergenic
920746358 1:208632746-208632768 CTCTCCCGCCTCAGCCTCCCGGG + Intergenic
922083506 1:222322572-222322594 CTCTCCCGCTACCCCATGACAGG - Intergenic
922440950 1:225654080-225654102 CTCTCTCCCCGCCCCCTGCCCGG - Intergenic
922698056 1:227741582-227741604 CTCTCCGGCCCTCCCATGCCAGG - Intronic
923055936 1:230426040-230426062 AGCGCCCGCCGCCCCGTGCCCGG + Intergenic
923229329 1:231969747-231969769 CTCTCCCCCCACCCCATGACAGG + Intronic
923261957 1:232276142-232276164 CTCTCCCACCTCCCCAAGGCAGG + Intergenic
923530839 1:234810895-234810917 CTCTCCAGCCTCCTCTTGCTTGG - Intergenic
924197550 1:241624039-241624061 CTGTCCTGCCTCTCCATGCCAGG + Intronic
924197564 1:241624103-241624125 CTGTCCTGCCTCCCCACGCCAGG + Intronic
924197603 1:241624295-241624317 CTGTCCTGCCTCCCGATGCCAGG + Intronic
924235869 1:241999166-241999188 CTCTCCCCACTCCCCCTCCCTGG + Intergenic
924267759 1:242300416-242300438 CTCTCCCGCCACCCCACCCCAGG - Intronic
1064028710 10:11869731-11869753 CTCGCCCACCTCCCCGTTCAGGG + Exonic
1064442948 10:15370538-15370560 CGCTCCCGGCTCCCCACGCCGGG - Intronic
1066504783 10:36029617-36029639 CTCTCCCCCCACCCCATGACAGG - Intergenic
1067769887 10:49115499-49115521 CTCTCCCGCGTCACAGCGCCGGG - Exonic
1069744461 10:70706332-70706354 CTCTCCAGCCTTCCTGTGACAGG + Intronic
1072101894 10:92237522-92237544 CTCTCCCTAATCCCCATGCCAGG + Intronic
1073063478 10:100745504-100745526 CTCCTCCCCCTCCCCGCGCCGGG - Intronic
1074107933 10:110402377-110402399 CTCGCCTGCCTCACCCTGCCTGG + Intergenic
1074826013 10:117216337-117216359 ATCTCCAGCCTCCCGGTACCTGG + Intergenic
1075583938 10:123643714-123643736 CTCTCCCGCCTCCCAGCCTCAGG + Intergenic
1075656879 10:124167892-124167914 CTCGCCCCTCTCCCCGAGCCTGG + Intergenic
1076269577 10:129139879-129139901 CTCTCCCACCTCCCTGAGTCCGG + Intergenic
1076316934 10:129548819-129548841 CTCTGCCTCCTCCCCTGGCCTGG - Intronic
1076402082 10:130190958-130190980 CTTGCCCGCCTCCCCAAGCCTGG + Intergenic
1076798397 10:132809712-132809734 TCCTCCCGCCTCACCGTGGCAGG + Intronic
1076889422 10:133276575-133276597 CTCCCCGGCCTCCCCGGCCCGGG + Intronic
1077310558 11:1887143-1887165 CTCTCCCGCCTTGCCTTACCTGG - Intronic
1077406629 11:2385340-2385362 CTGCCCCTCCTCCCCGTCCCAGG + Intronic
1077460242 11:2705470-2705492 TTTTCCCACCCCCCCGTGCCTGG - Intronic
1077886202 11:6390098-6390120 CTCTCCTACCTCCCCTTCCCGGG + Intergenic
1079553719 11:21733357-21733379 CTCTCCCCCCACCCCATGACAGG - Intergenic
1080195745 11:29606708-29606730 ATCTCCCTCCTCCTTGTGCCTGG + Intergenic
1080648845 11:34207001-34207023 CTCCCCCGCAGCCCCCTGCCAGG + Intronic
1081989451 11:47329902-47329924 CCCTCCTGACACCCCGTGCCTGG - Exonic
1082000864 11:47393172-47393194 CTCCCCCACCTCCCACTGCCTGG - Intergenic
1082029532 11:47594345-47594367 CCCTCACGCCTCCCCACGCCCGG - Exonic
1083148403 11:60774999-60775021 CTCTCCCGACTGCCCTGGCCTGG - Intronic
1083233827 11:61339472-61339494 CTTTCCAGCCTTCCCTTGCCTGG + Intronic
1083448938 11:62729472-62729494 CACTGCAGCCTCCCCGTCCCGGG + Intronic
1083593530 11:63908567-63908589 CTATCCCACCTCCCTGTGCTCGG + Intronic
1083710163 11:64543015-64543037 CGCTGCCGCCTCCCCGGGCCCGG - Intergenic
1084000260 11:66292113-66292135 CTCTCACGCCGCCCCAGGCCCGG - Intronic
1084145566 11:67263391-67263413 CTCTCCCGCCTCCCCATCTCAGG - Intergenic
1084694635 11:70746249-70746271 CTCTCCCGCCTCTCCAGGACAGG + Intronic
1084694667 11:70746348-70746370 CTCTCCCGCCTCTCCAGGACAGG + Intronic
1084694698 11:70746447-70746469 CTCTCCCGCCTCTCCAGGACAGG + Intronic
1085617079 11:78008843-78008865 CTCTCCTGCCTCAGCCTGCCAGG + Intergenic
1086362062 11:86069368-86069390 CTCTCCCGCCCCGCCCCGCCCGG - Intronic
1086981014 11:93197872-93197894 CTCTCCCGCCGCTGCGTGGCCGG + Exonic
1088504174 11:110512993-110513015 CTCTGCAGCCTCCCCTTGGCTGG + Intergenic
1089305334 11:117522838-117522860 CTCTACAGCCTCTCCCTGCCAGG - Intronic
1089557083 11:119320695-119320717 CTCTCCCCCCACCCCCTGGCAGG - Intronic
1089848727 11:121479207-121479229 CCCTCCCGCCTCCACCTCCCTGG - Intronic
1090198726 11:124839262-124839284 CTCCCCCACCTCCCCGGGCTGGG + Intergenic
1090755000 11:129782734-129782756 CCCTCCCGCCTCCCCACGACAGG - Intergenic
1091718551 12:2795937-2795959 CTCCGCCGCCTCCCGGAGCCAGG + Intronic
1091888092 12:4031309-4031331 CGCCCGCGCCTCCCCGCGCCCGG + Intergenic
1093648914 12:21621007-21621029 TTCTCCCGCCTCCACCTCCCAGG + Intergenic
1093662471 12:21773652-21773674 CTCACCTGCCTCTCCGTCCCTGG + Exonic
1095120704 12:38414840-38414862 CTCTCCCTCCTCCCCATCTCAGG + Intergenic
1096077773 12:48815648-48815670 CTCTCCCCCTCCCCCGGGCCAGG - Intronic
1096411310 12:51378979-51379001 CTCCCCAGTCACCCCGTGCCAGG + Intronic
1096677226 12:53232303-53232325 CTCCCCTGCCTGCCCCTGCCCGG + Intronic
1100099364 12:91084238-91084260 CTCTCCCCCCACCCCATGACAGG + Intergenic
1100396279 12:94188854-94188876 CTCTGCCACCTCCCCATGCTTGG - Intronic
1100907243 12:99315818-99315840 CTCTCCCCCCACCCCATGACAGG + Intronic
1102908275 12:116694045-116694067 CCCTCCCCACTCCCAGTGCCGGG - Intergenic
1103361373 12:120356347-120356369 CTCTCCAGCCTCCCCATCACTGG + Intronic
1103678809 12:122677256-122677278 CTCTCCCGTGTCCTCCTGCCTGG + Intergenic
1104095426 12:125552854-125552876 CTCTCCTGACTCCCTGTGCAGGG - Intronic
1104988533 12:132611214-132611236 CCGCCCCTCCTCCCCGTGCCCGG - Intergenic
1105432848 13:20352688-20352710 CTCCCTCTCCTCCCCGAGCCTGG + Intergenic
1106934741 13:34705565-34705587 CTCTCCTGCCTCCACCTCCCAGG + Intergenic
1110159594 13:72359570-72359592 CCCTCCCCCCTCCCCATGACAGG - Intergenic
1111124262 13:83893326-83893348 CTATCCCTCCACCCCGTGACAGG - Intergenic
1111823694 13:93243538-93243560 CTCTCCGGTCTCCCAGTGGCAGG + Intronic
1113513202 13:110872153-110872175 CCCTCCCGCCTCTCCCTGCGGGG + Intergenic
1114614221 14:24059764-24059786 GTCCCCAGCCTCCCTGTGCCTGG + Intronic
1118035533 14:61862274-61862296 CTCTCCCACCTCCCGGACCCTGG + Intergenic
1119192280 14:72691106-72691128 CTTGCCCGCCTCTCCTTGCCAGG - Intronic
1119777224 14:77256776-77256798 CCCTCCTGCCTCCCCTTGCCAGG - Exonic
1120135912 14:80868059-80868081 GTCTCCCCCCACCCCCTGCCAGG - Intronic
1120917660 14:89723799-89723821 TTCTCCTGCCTCCCCCTCCCAGG - Intergenic
1121245120 14:92456587-92456609 CTGTCCCCCTTCTCCGTGCCGGG + Exonic
1121314945 14:92955497-92955519 CCCTCCCTCCACCCTGTGCCAGG - Intronic
1121455424 14:94035817-94035839 CTCACCCCCTTCTCCGTGCCAGG + Intronic
1122255382 14:100472375-100472397 CTCTTCTGCCTCCCCGAACCAGG + Intronic
1122277922 14:100604800-100604822 CTCCCCCCACCCCCCGTGCCCGG + Intergenic
1122296556 14:100709323-100709345 CGCTCCCGCCTCCACTTGCCGGG + Intergenic
1202829968 14_GL000009v2_random:17470-17492 CTCTCCCCCCACCCCATGACAGG + Intergenic
1124226817 15:27901976-27901998 CTCCCCCTCCGCCCCCTGCCAGG - Intronic
1124235170 15:27983871-27983893 CTTTCCCACCTCCCCCTTCCTGG + Intronic
1124427110 15:29571123-29571145 CTCTCCCGGCTCCCGGGTCCCGG - Intergenic
1124626849 15:31312561-31312583 CTCTCCCTCCACCCACTGCCCGG - Intergenic
1125769407 15:42154841-42154863 CTCGGCCTCCTCCCTGTGCCTGG - Intronic
1126541870 15:49832782-49832804 CTCTTCCGCCACCTAGTGCCAGG + Intergenic
1127988458 15:64093695-64093717 CTCTCCGGCCTCTCTGAGCCGGG - Exonic
1128767602 15:70260693-70260715 CTCTCCTCCCTCCCCTTGCTTGG - Intergenic
1129208015 15:74048596-74048618 CCCCCCCGCCACCCGGTGCCTGG + Intergenic
1130870614 15:87969020-87969042 CTATCCCCCCACCCCCTGCCAGG + Intronic
1131536178 15:93239870-93239892 CTGGCCTGCCTCCCCCTGCCTGG + Intergenic
1132374217 15:101318148-101318170 CTCTCCCGGCCCCCAGTCCCTGG + Intronic
1132799928 16:1747000-1747022 CTCTCCCTCCTCCCTGTGTTTGG + Intronic
1132945817 16:2530976-2530998 CTCACCTGCCTCTCCCTGCCTGG - Exonic
1133036420 16:3036476-3036498 CTCTCCCTCCTCCTCTCGCCCGG + Intronic
1133204365 16:4224112-4224134 CTCTCCCTCCTCCAGATGCCCGG - Intronic
1133730742 16:8576505-8576527 CTTTCCCGCTTGCCAGTGCCTGG - Intronic
1133945659 16:10346014-10346036 CTCTCCTGCCTCCCCTTTCTAGG - Intronic
1134058002 16:11182315-11182337 CTCTCCCTCCTCCCCGCACCAGG + Intergenic
1136261734 16:29082085-29082107 TTCTCCCACCTCCCCGGCCCCGG - Intergenic
1137578189 16:49617713-49617735 CTCTCCCTCCTCTCCCAGCCTGG + Intronic
1138565559 16:57830311-57830333 CTCTGCAGCCTCCCCCTCCCGGG + Intronic
1141615151 16:85206157-85206179 CCCTCCCCCCTTCCCGTGCCCGG - Intergenic
1141773678 16:86107324-86107346 GTCTCCTGCCTGCCCTTGCCTGG + Intergenic
1142631533 17:1229298-1229320 TTCTCCGGCCGCCCCGGGCCCGG + Intergenic
1144101402 17:11945178-11945200 CTCTTCCCCTTCCCCCTGCCAGG - Intronic
1144489361 17:15695013-15695035 CTCTGCAGCCTCCCCCTCCCAGG + Intergenic
1144658207 17:17051532-17051554 CTCCCCCGCCACCCCGCCCCAGG - Intronic
1144729598 17:17518841-17518863 ATCTCCCGCCCCCCAGTCCCTGG - Intronic
1144911612 17:18686940-18686962 CTCTGCAGCCTCCCCCTCCCAGG - Intergenic
1146249103 17:31322402-31322424 CTCTGCAGCCTCCACGTCCCGGG - Intronic
1147617011 17:41835810-41835832 CTCTCCAGCCGCCCCCAGCCCGG + Intronic
1147792073 17:43020206-43020228 CTCTCCCTCCTCCTCCTTCCTGG - Intronic
1148164129 17:45470551-45470573 CACTGCAGCCTCCCCGTCCCGGG - Intronic
1148585975 17:48780652-48780674 CTCTCCCTCCGCCCAGTCCCTGG + Intronic
1148752463 17:49953136-49953158 CTCTTCCCACTCCCCCTGCCTGG - Intergenic
1149470718 17:56913409-56913431 CTCTCCCGCGTCCCTGAGCCAGG - Exonic
1149685434 17:58532054-58532076 CCCTCCCGCCTCCCCGAGTGCGG + Intronic
1150202512 17:63372034-63372056 CTCTCCCTCCTCCCCTTTGCTGG - Intronic
1151191806 17:72404128-72404150 CTCTTCCCCCTCCCTGTCCCAGG - Intergenic
1151321747 17:73356692-73356714 TCCTCCCTCCTCCCTGTGCCTGG + Intronic
1151370740 17:73644880-73644902 CTCCCCCGCCGCCCCGCGGCTGG - Intergenic
1151664302 17:75536599-75536621 CCCTCCCGCCTGACCATGCCTGG + Intronic
1152362683 17:79839777-79839799 CTCGCCCACATCCCGGTGCCCGG + Intergenic
1152461776 17:80445559-80445581 CTCTCCCGCCCCCGCGCTCCCGG - Intergenic
1152749398 17:82055704-82055726 CTCTCCCCCCTCCCCGCCCCCGG + Intronic
1155172441 18:23276792-23276814 TTCCCCTGCCTCCCCTTGCCAGG + Intronic
1157324316 18:46657782-46657804 CTCTCCCCGCTCCCCCTGCCAGG + Intergenic
1157910784 18:51615646-51615668 CTCGCCCTCCTCCACGTGCATGG + Intergenic
1158436305 18:57437256-57437278 CCATCCCGCCTCCCAGTACCTGG - Intronic
1158443494 18:57498772-57498794 CCTTCCCGCCTCCCTGTGACGGG - Intergenic
1160011514 18:75110052-75110074 CTCTCCCTCCTCCCCTGGCTTGG - Intergenic
1160528855 18:79552176-79552198 CCCTCCAGCCTCCCTGGGCCTGG + Intergenic
1160690163 19:457989-458011 CTCTTCTGCCTCCCCGGGACCGG - Intronic
1160728996 19:632257-632279 TTCTCCCGCCTCTCCCTTCCCGG + Intronic
1160747931 19:720370-720392 CCCTCGCCCCTCCCCGGGCCTGG - Intronic
1160806521 19:994562-994584 CTCTCCGGCCTCCTTGTGTCCGG + Exonic
1161264650 19:3358752-3358774 CTCCCCTGCCGCCCCCTGCCTGG + Intergenic
1161382812 19:3975252-3975274 CTCTCCTGCCTCAGCCTGCCAGG - Intergenic
1161614557 19:5262802-5262824 CTCTCCCTCCTCCCCGCGACCGG - Intronic
1161772786 19:6240313-6240335 CTCCCCCGCCTCCCCTGACCAGG - Intronic
1161925252 19:7294513-7294535 CCTCCCCGCCTCCCTGTGCCGGG + Intergenic
1163029926 19:14537286-14537308 CGGTCCCGCCTCCCCCTCCCTGG - Intronic
1163104204 19:15114274-15114296 CTCTCTTGCCTCCCCTTGGCCGG + Exonic
1163289436 19:16369925-16369947 CTGTCAGGGCTCCCCGTGCCTGG - Intronic
1164132570 19:22378584-22378606 CACTCCCCCCTCCCCATGACAGG + Intergenic
1164543301 19:29138574-29138596 CTCTCCCCCCACCCCATGACAGG - Intergenic
1165396942 19:35569613-35569635 TTCTCCCGCCTCTCCAGGCCAGG + Intergenic
1165685672 19:37817660-37817682 CTCTCCCGCCTCCTCAGGCCCGG + Intergenic
1166289653 19:41854326-41854348 CTTTCCCACTTCCCAGTGCCAGG + Intergenic
1166371292 19:42302600-42302622 CCCTCCCCCCACCCCGTGCCGGG - Exonic
1166869760 19:45864238-45864260 CCCTCCCGCCTCCCCGAGGGCGG - Exonic
1166945489 19:46393695-46393717 CTCCCCCACCTCCGTGTGCCTGG - Intergenic
1167065350 19:47181584-47181606 TTCTCCTGCCTCCCCCTCCCAGG + Intronic
1167134978 19:47610345-47610367 CTCTCCCGCGGCTCCTTGCCCGG - Intronic
1167621460 19:50563279-50563301 CTCTCCTGCCACCCCCTGTCTGG + Intronic
1167622442 19:50567481-50567503 CTCTCCCCCCTCCCCATCACTGG + Intronic
1167648812 19:50719055-50719077 CTCCCCCGCCTCGCCCTCCCTGG - Intronic
1167955102 19:53058032-53058054 ACCTCCCTCCTCCTCGTGCCGGG - Intergenic
1167960754 19:53102897-53102919 ACCTCCCTCCTCCTCGTGCCGGG - Intronic
1167964501 19:53132407-53132429 ACCTCCCTCCTCCTCGTGCCGGG - Intronic
1167967316 19:53158247-53158269 ACCTCCCTCCTCCTCGTGCCGGG - Intronic
1167971865 19:53192846-53192868 ACCTCCCTCCTCCTCGTGCCGGG - Intronic
1168236893 19:55069202-55069224 GTCTCCCTCCTCCTCCTGCCAGG + Intronic
1168297305 19:55383741-55383763 CGCGCCCGCCGCCCCGGGCCCGG + Exonic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
1202642718 1_KI270706v1_random:110315-110337 CTCTCCCCCCACCCCATGACAGG - Intergenic
925335401 2:3095464-3095486 TTCTCCTGCCTCACCTTGCCAGG - Intergenic
925942918 2:8837384-8837406 CCCGCCCGACTCCCCGAGCCCGG + Intronic
926152255 2:10431935-10431957 CTCCCTCCCCACCCCGTGCCAGG + Intergenic
927484533 2:23479473-23479495 CTCCACCGCCTCCTCCTGCCAGG + Intronic
927652356 2:24920237-24920259 GCCTCCCGCCTCCCGGGGCCTGG - Intergenic
927698303 2:25252142-25252164 CCCTGCCGCCTCCCCGCCCCCGG + Intronic
927810875 2:26179637-26179659 CTCTCCTGCCTCCCCCTGTATGG - Intronic
928067848 2:28184476-28184498 CTCTCCCCCCACCCCATGACAGG + Intronic
928261132 2:29767749-29767771 CCCTGCCTCCTCCCCCTGCCTGG + Intronic
928471694 2:31581692-31581714 CTCTCCCGCCACCCCACTCCCGG + Intergenic
929765408 2:44839939-44839961 CTCTCCCGCCTCCACGAATCTGG + Intergenic
929795717 2:45056905-45056927 CTGTCCCACCTCCCAGTCCCAGG - Intergenic
930135909 2:47904920-47904942 TTCCCCCGCCCCCCCGTCCCTGG - Intronic
932567580 2:72919076-72919098 CTCTGCCCCCGCCCCCTGCCCGG - Intronic
933782431 2:85811696-85811718 TTCTCCTGCCCCCACGTGCCAGG + Intergenic
934763560 2:96868909-96868931 TGCTCCAGCCTTCCCGTGCCAGG + Intronic
935173301 2:100627293-100627315 CTCTCCCTCCTCCCCGACCTGGG + Intergenic
935394451 2:102591666-102591688 CTCTCCGGCCTCCCCGGCCCTGG - Intergenic
935696832 2:105777453-105777475 CTCTCCACCCACGCCGTGCCAGG - Intronic
936412945 2:112276208-112276230 CGCGCCCGCCTCCCCGAGCCGGG + Intronic
937043062 2:118835901-118835923 CCCGGCCGCCTCCCCGCGCCAGG - Intergenic
937114892 2:119397884-119397906 CTCCCCCAACTCCCCTTGCCTGG - Intergenic
937203826 2:120223379-120223401 CACTCCCGCCTCCATGTTCCCGG - Exonic
937221496 2:120345290-120345312 CTCGCCCGGCGCCCCGCGCCCGG + Intergenic
937290663 2:120779807-120779829 CCATCCTGCCTCCCCGGGCCAGG + Intronic
937359100 2:121216920-121216942 CTCTGCAGCCTCCCCGTGCTGGG - Exonic
937993084 2:127674970-127674992 CAGTCCCGCCTCCCCGGCCCGGG + Intronic
938073475 2:128319999-128320021 CTCCCCCCCCACCCCGTCCCCGG - Intergenic
939581137 2:143947135-143947157 CTCTCCCTCCTCCTCGTTGCAGG - Exonic
941021030 2:160407917-160407939 CGCTGCCGCCTCCCCGCCCCCGG - Intronic
941304255 2:163841760-163841782 CTCTCCCCACTCCCTGTCCCTGG - Intergenic
944703533 2:202266097-202266119 TTCTCCCTCCTCCCAGAGCCCGG - Intronic
946130736 2:217604696-217604718 CACTGCCGCCGCCCCGTGCCAGG + Intronic
946235576 2:218322924-218322946 CCCGCCCGCCTCCCCGTCCAGGG - Intronic
946415100 2:219536298-219536320 CCCTCCTGCCTCCCCCTGCAGGG - Intronic
947668889 2:231924635-231924657 CCCTACCGCCACCCCCTGCCGGG - Intronic
947958805 2:234217491-234217513 CTGTCCTGCCTCCCAATGCCAGG - Intergenic
948467508 2:238159251-238159273 GCCTCCCGCCGCCCCGAGCCGGG - Intronic
948687359 2:239677581-239677603 CGCTGCCGCCTTCCCCTGCCCGG + Intergenic
949035311 2:241813430-241813452 CTGTGCCACCTCCCTGTGCCGGG + Intronic
949048322 2:241882429-241882451 TTCTCCCTCCTCTCCGTCCCTGG + Intergenic
1168799210 20:633731-633753 TCCTCCCGCCTCCTCTTGCCAGG + Intergenic
1169141675 20:3230340-3230362 GTCCCCTGCCTCCCCCTGCCAGG + Intronic
1170717793 20:18847066-18847088 CTCTCCTGCCTCCTCTTGCCAGG - Intergenic
1170786803 20:19474279-19474301 CTCCCCCACTTCCCTGTGCCTGG + Intronic
1171123075 20:22582287-22582309 CTCGAGCGCCTCCCCGTGCCAGG - Exonic
1171215699 20:23350750-23350772 CTCTCCCGCATTCCCGTGACGGG - Exonic
1171444742 20:25195645-25195667 CTCTCCCGCCTGCGCATGCGCGG + Intergenic
1171460941 20:25297575-25297597 CACCCCCACCTCCCAGTGCCAGG - Exonic
1172100913 20:32483610-32483632 CTCTCCCGCCTCCCCGTGCCCGG - Intronic
1172195257 20:33087107-33087129 CTCACCCTCCTCTCCTTGCCTGG - Intronic
1172455727 20:35071429-35071451 CCCTCCCCCCACCCCATGCCAGG + Intronic
1173642918 20:44616134-44616156 CTCCCCTCCCTCCCCTTGCCTGG + Intronic
1173803570 20:45910157-45910179 CACTCCCGCTTCCCCAGGCCTGG - Intronic
1173980533 20:47220446-47220468 CACTCCCACCTGACCGTGCCAGG - Intronic
1174277740 20:49416045-49416067 CTCTCCCTACTCCTCTTGCCTGG + Intronic
1174484112 20:50850884-50850906 CTCTCCAGCCTTCCAGTGCCTGG - Intronic
1175269427 20:57723430-57723452 CTCTGCCTTCTCCCCCTGCCTGG - Intergenic
1175863498 20:62162730-62162752 CACTCCCTGCTCCCCATGCCAGG + Exonic
1176285432 21:5016693-5016715 GCCTCCCGCCTCCCCCGGCCGGG - Intergenic
1176428386 21:6562330-6562352 CTCTCCCACCTCTCAGTGCCTGG - Intergenic
1176609154 21:8862310-8862332 CTCTCCCCCCACCCCATGACAGG + Intergenic
1177573740 21:22923686-22923708 CTCTCCCCCCACCCCATGACAGG - Intergenic
1177762516 21:25418255-25418277 CACTCCTGCCTCTCCATGCCAGG + Intergenic
1177909739 21:27016437-27016459 CCCTCCCGCCGCCCCCTGACAGG - Intergenic
1177956774 21:27607390-27607412 CTCTCCCCCCACCCCATGACAGG + Intergenic
1178550701 21:33536367-33536389 CTCTCCTGCTTCACTGTGCCTGG + Intronic
1179126393 21:38594967-38594989 CTCTCCAGCCTCTCTGTTCCAGG - Intronic
1179449376 21:41458077-41458099 CACTGCAGCCTCCCCCTGCCTGG + Intronic
1179703876 21:43170646-43170668 CTCTCCCACCTCTCAGTGCCTGG - Intronic
1179871749 21:44246782-44246804 GCCTCCCGCCTCCCCCGGCCGGG + Intronic
1179955212 21:44734658-44734680 CCCACCCACCCCCCCGTGCCGGG + Intergenic
1180004640 21:45014660-45014682 CTCTCTCGGCTCCCCTGGCCCGG - Intergenic
1180359248 22:11872141-11872163 CTCTCCCCCCACCCCATGACAGG + Intergenic
1180626764 22:17198944-17198966 CCCCCTCGCCTCCCCCTGCCTGG - Intronic
1180913507 22:19469747-19469769 GTCACCCGCCTGCCCATGCCAGG + Intronic
1180946242 22:19695341-19695363 CTCCCTCGCCTCTCCTTGCCTGG - Intergenic
1181147397 22:20858692-20858714 CGCCTCCGCCTCCCCGGGCCGGG + Exonic
1181505208 22:23350971-23350993 TTCTCCCACCTCCCTGTCCCTGG - Intergenic
1181710519 22:24683306-24683328 TTCTCCCACCTCCCTGTCCCTGG - Intergenic
1182162590 22:28137905-28137927 CTCTCCTGCCTCAGCCTGCCGGG - Intronic
1183071426 22:35399287-35399309 CTCACCCGCGTCCCCGACCCGGG - Intergenic
1183216189 22:36481667-36481689 CTCTTCCGCCTGCCTGTACCCGG - Exonic
1183425866 22:37739140-37739162 CTCTCCCGCCTCCAGGACCCTGG - Intronic
1184239463 22:43204213-43204235 CTCTCTCCCCTCCCCCAGCCTGG - Intronic
1184469978 22:44690865-44690887 GTCTCCCGCCACGCCCTGCCAGG - Intronic
1184470021 22:44691066-44691088 CTCTCCTGCCTCCCCGCCCCGGG - Intronic
1184596402 22:45516748-45516770 CTCACCCGGCTCCCCGAGGCTGG - Intronic
1184784597 22:46665533-46665555 CCCTCCCGCCTCCCCCCACCAGG - Intronic
1184978801 22:48081606-48081628 CTCTCCCTGCTCCGCGTCCCGGG + Intergenic
1185005730 22:48275744-48275766 CTCTCCAGCCTGCCTGGGCCAGG - Intergenic
1185071724 22:48660206-48660228 CTGTCCCATCTCCCAGTGCCTGG + Intronic
1185106387 22:48872177-48872199 CCCTCCTGCCTCCCCATGACAGG + Intergenic
1185397426 22:50600320-50600342 CTCGCCCGCCACCCCGCTCCGGG + Intronic
949414507 3:3800269-3800291 CCCTCCTCCCTCCCCGTCCCCGG - Intronic
949530202 3:4947918-4947940 CTTTCCCGCCTCCACGAGGCTGG - Intergenic
949807044 3:7966828-7966850 CTCTGCCACCTCCCAGTACCTGG + Intergenic
950438491 3:12994153-12994175 CGCCCCCGCCCCCCCGCGCCCGG - Intronic
950890630 3:16400940-16400962 CCCTCCCACCTCGCCCTGCCTGG + Intronic
951033928 3:17912490-17912512 CTCTTCTGCCTCCTCCTGCCGGG + Intronic
951976995 3:28522107-28522129 CTCTCCCTCCACCCCATGACAGG - Intronic
953142547 3:40242381-40242403 CTCTTCTGCCTCCTGGTGCCAGG + Intronic
953883127 3:46701622-46701644 CTCTCCCCCAGCCCCCTGCCTGG - Intronic
954447342 3:50553815-50553837 GCCTCCCACCTCCCCGTGCCTGG + Intergenic
954462978 3:50638229-50638251 CTCCTCCCCCTCCCCCTGCCTGG - Intronic
956664010 3:71625031-71625053 CACTCCAGCCTCCCCGTCCTGGG - Intergenic
958141717 3:89570914-89570936 CCCCCCCACCTCCCCGTGACTGG - Intergenic
960772436 3:121209580-121209602 CTCTCCCCCCACCCCATGACAGG + Intronic
961360803 3:126365961-126365983 CTCTACCTCCTCCCCCTTCCTGG - Intergenic
961397090 3:126601937-126601959 CTCTCCTGCTTCCCCTTTCCGGG + Intronic
961957026 3:130814971-130814993 CTCAGCCGCCTCCCCTTGCGGGG - Intergenic
963947662 3:151163995-151164017 CCGTCCAGCCTCCCCATGCCGGG + Exonic
966919641 3:184603169-184603191 CTCCCCCAACACCCCGTGCCTGG + Intronic
967969161 3:194986479-194986501 CTCCCACGGCTCCCCGTCCCAGG + Intergenic
968372893 4:11651-11673 CGCGCCCCCCTCCCCGCGCCTGG - Intergenic
968495046 4:910731-910753 CTCTCCCCTCTCTCCCTGCCTGG + Intronic
968556140 4:1247446-1247468 CTCCCCTGCCTGCCCGGGCCTGG - Intronic
968557164 4:1251440-1251462 CCCACCCGCCTCCCTGTGCCTGG + Intergenic
969458281 4:7313522-7313544 CCCTCCTTCCTCCCCGTGCCTGG - Intronic
971421336 4:26476608-26476630 ATCTGCCGACTCCCCGTGGCTGG - Intergenic
972414371 4:38824081-38824103 CGCCCCCGCCCCCCCCTGCCTGG + Exonic
973025679 4:45266911-45266933 CCCTCCCGCCTCCACATGACAGG - Intergenic
975512290 4:75207348-75207370 CTCTCCTGCCTCAGCCTGCCAGG + Intergenic
975701884 4:77075317-77075339 CCCTCCCGCATCCCCCAGCCCGG - Intronic
976326349 4:83776136-83776158 CTCACACGGCACCCCGTGCCTGG - Intergenic
976830393 4:89308078-89308100 CTCCCCCGCCTTCCCGGTCCTGG + Intergenic
977496719 4:97783911-97783933 CTCTCCCCCCACCCCATGACTGG - Intronic
978357687 4:107894185-107894207 CTCCCCTGCCTCCCCGTTTCAGG - Intronic
978795787 4:112706151-112706173 TTCTCCCACCTCCCCGGCCCCGG + Intergenic
979296941 4:119043828-119043850 TTCTCCTGCCTCACCCTGCCGGG - Intronic
979981841 4:127265731-127265753 CCCTCCCGCCACCCCATGACAGG - Intergenic
981236355 4:142420316-142420338 CTCTCCCACTTCTCCTTGCCAGG - Intronic
982685378 4:158482630-158482652 CTATCCCCCCACCCCGTGACAGG + Intronic
983204937 4:164902179-164902201 CTCTCTCGCCGCTCCATGCCTGG + Intergenic
984308355 4:178023856-178023878 CCCTCCCCCCACCCCGTGACAGG - Intergenic
984538755 4:181010963-181010985 CTCTCCCCCCACCCCATGACAGG + Intergenic
985255425 4:188065533-188065555 CCCTCCCGCCACCCCATGACAGG + Intergenic
985292750 4:188403716-188403738 CTCTCCCGCCTCTGCCTCCCAGG + Intergenic
985462503 4:190120916-190120938 CGCGCCCCCCTCCCCGCGCCTGG + Intergenic
1202770091 4_GL000008v2_random:196214-196236 CTCTCCCCCCACCCCATGACAGG - Intergenic
986434974 5:7720544-7720566 CTCTCCCCCCACCCCATGACAGG + Intronic
986662080 5:10068190-10068212 CTCCCTCTCCTCCCCGTACCTGG + Intergenic
987169039 5:15234134-15234156 CTCTCCCACCTCCCCTCTCCAGG + Intergenic
992179210 5:74180467-74180489 TTCTCCCGCCCCCTCATGCCTGG + Intergenic
996355568 5:122592689-122592711 CTCTCCCCCCACCCCGTGACAGG + Intergenic
996387281 5:122922736-122922758 TTCTCCCCCTTCCCCATGCCAGG + Intronic
996419886 5:123251078-123251100 CTCTCCCCCCACCCCATGACAGG + Intergenic
997759475 5:136431324-136431346 CTCTCCCTCCTCCCTGGGGCTGG + Intergenic
998025592 5:138813224-138813246 CTCTGCAGCCACCCAGTGCCAGG - Intronic
999341696 5:150778796-150778818 CTCTCCCGCCTCCCGGGGCTCGG + Exonic
999458109 5:151734751-151734773 TTCTCCCGCCTCAGCCTGCCTGG - Intergenic
1000235124 5:159351025-159351047 CTCTCCCCCCACCCCATGACAGG - Intergenic
1000284009 5:159810788-159810810 CACTCCCGCCACCCCATGACAGG - Intergenic
1001249703 5:170137733-170137755 TTCTCCAGCCTCCCCCTGACTGG + Intergenic
1001468140 5:171987110-171987132 CCATCCCCACTCCCCGTGCCTGG + Intronic
1001724878 5:173888395-173888417 CGCCACCGCCTCCCGGTGCCCGG - Exonic
1002071612 5:176681717-176681739 CTGTCCCGCCTCCCAGGGCCGGG + Intergenic
1002290102 5:178194514-178194536 GCTTCCAGCCTCCCCGTGCCAGG - Intergenic
1002475344 5:179461977-179461999 CACTCCCTCCACCCCATGCCTGG + Intergenic
1002633964 5:180598136-180598158 CTGTGCTGCCTCCACGTGCCAGG + Intergenic
1003180039 6:3783408-3783430 CTTTCCAGAATCCCCGTGCCTGG + Intergenic
1003571215 6:7257871-7257893 CTCTCCTGCCTCCCTGGGACGGG - Intergenic
1004114177 6:12750017-12750039 CACTTCCTCCTCCCCGTGCCGGG - Intronic
1004144416 6:13051612-13051634 TTCTCCCTCTTCCCCTTGCCAGG + Intronic
1005826056 6:29632539-29632561 CTCTCCCCCCACCCCGCGCGGGG - Intronic
1006706760 6:36027523-36027545 CTCGCGCGCCTCACCGTGGCCGG - Intergenic
1007165146 6:39823883-39823905 CTTTCCCTCCTCCCCCTGCTGGG + Intronic
1007232041 6:40355070-40355092 CTCCCCCTCCTCCCAGTCCCTGG - Intergenic
1007418056 6:41703485-41703507 CTCCCCAGCCTCCCTGTGGCTGG + Intronic
1008965841 6:57311901-57311923 TTCTCCCGCCTCGGCCTGCCAGG - Intergenic
1010182473 6:73103478-73103500 CTCTCCCCCCCCCCCATGACAGG - Intronic
1011099817 6:83708803-83708825 CTCGGCCCCCTCCCCGCGCCAGG - Intronic
1011554777 6:88563168-88563190 GTCTCCCTCCTCTCCGTTCCAGG + Intergenic
1013575842 6:111483082-111483104 CTCTCCTGCGGCCCCTTGCCGGG - Exonic
1017769137 6:157631610-157631632 CTCTCCCGCCCCTCCCTGTCTGG - Intronic
1017846279 6:158261206-158261228 CTCAACAGCCTCCACGTGCCTGG - Intronic
1018769260 6:166957147-166957169 CTCTCCAGTCTCCCGGTGCTAGG + Intronic
1018918147 6:168150753-168150775 CTCTCCTCCCTGCCCCTGCCTGG - Intergenic
1019274999 7:171537-171559 CCCTCCCGGCTCCCCTTGTCTGG + Intergenic
1019329454 7:455463-455485 CCTTCCCTCCTCCCTGTGCCAGG + Intergenic
1019345979 7:531159-531181 CTGCCCCGCCTGCCCCTGCCCGG - Intergenic
1019433835 7:1011849-1011871 CTCTTCAGCCTCTCTGTGCCAGG - Intronic
1019539628 7:1545859-1545881 CTCTTCTTCCTCCACGTGCCAGG - Exonic
1019659747 7:2217514-2217536 CTCTCCTGCCTCCTGTTGCCTGG - Intronic
1019758015 7:2787701-2787723 CTCTCCCCCTTCCCGATGCCTGG - Intronic
1020114188 7:5466535-5466557 CTCTCCTGCCTCCACGGCCCTGG + Intronic
1020117097 7:5482014-5482036 CACACCTGCCTCCCCGTCCCGGG + Intronic
1022812105 7:33880049-33880071 CTCTCTCACCTCCCTGGGCCTGG + Intergenic
1023850223 7:44146160-44146182 CTCCCCCTCCTCCCCGTCTCGGG + Intronic
1024948468 7:54834557-54834579 TCCTCCCGCCTCCCAGTGCCTGG + Intergenic
1025602118 7:63010972-63010994 CACTCCAGCCTCCCCCTCCCAGG + Intergenic
1027233122 7:76283205-76283227 CCCCCCCCCATCCCCGTGCCAGG - Intronic
1027253047 7:76411099-76411121 CCCTCCCTCCTCCCCTGGCCTGG + Intronic
1029705267 7:102272736-102272758 CTCTCCCTCCTCCAGGTGCCAGG - Intronic
1029799746 7:102934012-102934034 CTCTCCGGCCTCCACCCGCCCGG - Exonic
1032352888 7:131182056-131182078 CACTGCAGCCTCCCCGTCCCGGG - Intronic
1033043230 7:137937400-137937422 CCCTCCCTCCTCCCCTTGCAGGG + Intronic
1033153028 7:138933049-138933071 CTCTCCAGCCTGCACGTGCCTGG - Intronic
1033898642 7:146108250-146108272 CTCTCTCTCCTCCCTGTTCCTGG + Intergenic
1034475027 7:151276840-151276862 TTCCCCCTCCTCCCCCTGCCTGG - Intronic
1034475053 7:151276909-151276931 ATCCCCCTCCTCCCCCTGCCTGG - Intronic
1034843398 7:154420492-154420514 ATTTCCCTCCTCCCAGTGCCTGG - Intronic
1035663336 8:1363393-1363415 CTCTCCTGCCTCCACGTCGCAGG + Intergenic
1036389995 8:8317174-8317196 CTCTCCCTCCTCCCTGCCCCAGG + Intergenic
1037977619 8:23224695-23224717 CTCTGCCCCCTCCCGGTGCCAGG + Intronic
1038542777 8:28402790-28402812 CTCCCACGCCTCTCCGTTCCTGG + Intronic
1039436222 8:37561215-37561237 CTCTCCCGTCTCCACATCCCAGG + Intergenic
1041470105 8:58198716-58198738 CTCTCCCCCCACCCCATGACAGG + Intronic
1044726290 8:95196690-95196712 CTCTCCCTCCTCACCTTGTCAGG - Intergenic
1045251136 8:100484340-100484362 CTCTCCCGGGTACCAGTGCCTGG - Intergenic
1046252834 8:111655162-111655184 CCCTCCCCCCACCCCGTGACAGG - Intergenic
1049807500 8:144547599-144547621 CTCTTCCGCTTGCGCGTGCCCGG + Exonic
1051170571 9:14315378-14315400 CTCCACCTCCTCCCCGCGCCCGG + Intronic
1051171572 9:14322712-14322734 CGCTCCCGCCTCCCGGGTCCCGG - Intronic
1051874831 9:21780820-21780842 CTCTCCCCCCACCCCATGACAGG - Intergenic
1053161305 9:35815050-35815072 CTACCCCGCTTCCCCGCGCCCGG - Intronic
1053554855 9:39125351-39125373 CTCTCCCCCCACCCCATGACAGG - Intronic
1056826585 9:89880188-89880210 CTCCCCCATCTCCACGTGCCAGG + Intergenic
1057546184 9:96021651-96021673 CCCTCCCGGCTCCAGGTGCCTGG - Intergenic
1057594985 9:96408055-96408077 CGCTCCCGCCACCCCGCGACAGG - Intronic
1058047665 9:100373921-100373943 CTCTCCTGCCTCCCACTGGCAGG + Intergenic
1058262159 9:102847904-102847926 CTCTCCCCCCACCCCATGACAGG - Intergenic
1060403221 9:123360405-123360427 CTGTCCCCCCTTCCCGGGCCAGG - Intronic
1060439388 9:123625017-123625039 CTCTCCCGCCTCCCCATCACGGG + Intronic
1060555309 9:124504813-124504835 CGCCCCCGCCTCCCCGTCCCCGG - Intronic
1060895671 9:127215641-127215663 CTCTCCTGCCTCCACTTCCCTGG + Intronic
1061637468 9:131922016-131922038 CCCTCCCCCCTCCCCATGACAGG - Intronic
1061836102 9:133331387-133331409 CTCCCCCGACTCCCAGTGCCAGG + Exonic
1062029031 9:134353700-134353722 CTCTCCTGCCTGCCAGGGCCTGG - Intronic
1062137165 9:134935308-134935330 CTCTCCAGCCTCCCTGGGACTGG + Intergenic
1062161710 9:135083960-135083982 CTGGCCCGGCTCCCTGTGCCTGG - Intronic
1062230604 9:135479809-135479831 CGCTGCCGCCGCCCCGCGCCCGG - Exonic
1062259775 9:135655750-135655772 CTCTGCCTCCTCTCTGTGCCTGG + Intergenic
1062540970 9:137041422-137041444 CACTCCTTCCTCCCCGTGCCCGG - Intronic
1203694989 Un_GL000214v1:89891-89913 CTCTCCCCCCACCCCATGACAGG - Intergenic
1203704557 Un_KI270742v1:27542-27564 CTCTCCCCCCACCCCATGACAGG + Intergenic
1203641284 Un_KI270751v1:14172-14194 CTCTCCCCCCACCCCATGACAGG + Intergenic
1185750901 X:2609180-2609202 CTCTGTCCCCTCCCCGGGCCCGG + Intergenic
1185761216 X:2691138-2691160 CTCTGTCTCCTCCCCGGGCCCGG + Intergenic
1186379552 X:9043599-9043621 CTCTCCCTCCACCCCATGACAGG + Intronic
1187269142 X:17764119-17764141 CCCTCCCGCCTCAGCCTGCCAGG - Intergenic
1188126779 X:26377891-26377913 CTCTCCCCACTCCCCATGACAGG + Intergenic
1189321647 X:40090721-40090743 CTCTCTCCCCTCCCCCTTCCCGG - Intronic
1189578244 X:42378438-42378460 CTCTCCCGCCTCCCCTTTCATGG - Intergenic
1190215040 X:48474276-48474298 CACTGCTGCCTCCCAGTGCCTGG - Intergenic
1190708394 X:53048876-53048898 CTCACCCCGCTCCCCGGGCCTGG - Intergenic
1191005639 X:55708424-55708446 CTCCCCTGGCTCCCCATGCCTGG - Intergenic
1191056604 X:56248152-56248174 CTCTCCCCCCACCCCATGACAGG - Intronic
1192203836 X:69083243-69083265 CTGTCCCGCCTCCCCATGGTTGG - Intergenic
1192210176 X:69123000-69123022 CTCTCCCTCTTCCCAGTGCTGGG + Intergenic
1193400235 X:81033902-81033924 CTCTCCCCCCACCCCATGACAGG + Intergenic
1193593037 X:83413033-83413055 CTCTCCCCCCACCCCATGACAGG - Intergenic
1194862818 X:99025254-99025276 CCCTCCCACCTCCCAGTCCCTGG + Intergenic
1195626740 X:107011342-107011364 CTCTCCCTCCACCCCATGACAGG - Intergenic
1196270187 X:113700466-113700488 CTCTCCCTCCTCCATGTGCACGG + Intergenic
1197575418 X:128204913-128204935 CCCTCCCCCCACCCCGTGACAGG - Intergenic
1197694893 X:129540293-129540315 CGCTCCCGGCTCCCGGCGCCCGG + Exonic
1197772439 X:130097947-130097969 CTCTGCCCCCTCCCCTTGCCGGG + Intronic
1197939949 X:131778980-131779002 CGCTCCCGACTTCCTGTGCCGGG - Intergenic
1198807001 X:140503165-140503187 GTCTCCCGCCTCGCCGCCCCTGG - Exonic
1200791075 Y:7299541-7299563 CTCTGCCACCTCCGCCTGCCAGG + Intergenic