ID: 1172101506

View in Genome Browser
Species Human (GRCh38)
Location 20:32486415-32486437
Sequence CAATGTCTTCAGAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 277}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172101506_1172101516 19 Left 1172101506 20:32486415-32486437 CCCTCCAGCCTCTGAAGACATTG 0: 1
1: 0
2: 1
3: 29
4: 277
Right 1172101516 20:32486457-32486479 GATTAGGGTATGCTCTGATGGGG 0: 1
1: 0
2: 0
3: 9
4: 97
1172101506_1172101513 4 Left 1172101506 20:32486415-32486437 CCCTCCAGCCTCTGAAGACATTG 0: 1
1: 0
2: 1
3: 29
4: 277
Right 1172101513 20:32486442-32486464 CTTTTGTAAACAGATGATTAGGG 0: 1
1: 0
2: 1
3: 22
4: 300
1172101506_1172101515 18 Left 1172101506 20:32486415-32486437 CCCTCCAGCCTCTGAAGACATTG 0: 1
1: 0
2: 1
3: 29
4: 277
Right 1172101515 20:32486456-32486478 TGATTAGGGTATGCTCTGATGGG 0: 1
1: 0
2: 0
3: 12
4: 102
1172101506_1172101512 3 Left 1172101506 20:32486415-32486437 CCCTCCAGCCTCTGAAGACATTG 0: 1
1: 0
2: 1
3: 29
4: 277
Right 1172101512 20:32486441-32486463 GCTTTTGTAAACAGATGATTAGG 0: 1
1: 0
2: 0
3: 20
4: 219
1172101506_1172101514 17 Left 1172101506 20:32486415-32486437 CCCTCCAGCCTCTGAAGACATTG 0: 1
1: 0
2: 1
3: 29
4: 277
Right 1172101514 20:32486455-32486477 ATGATTAGGGTATGCTCTGATGG 0: 1
1: 0
2: 1
3: 16
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172101506 Original CRISPR CAATGTCTTCAGAGGCTGGA GGG (reversed) Intronic
900814473 1:4832940-4832962 CAATGTCCTCACATGGTGGAAGG + Intergenic
901634115 1:10662804-10662826 GTATGTCTGCAGAGGCAGGAAGG - Intronic
905261302 1:36721264-36721286 CCATGCCTTCAGAGACTTGACGG - Intergenic
906043303 1:42806282-42806304 CAGTGACTTCAGAGGCAGCAGGG + Intergenic
908265715 1:62377418-62377440 CAAGGTCTACAGTGGCAGGAGGG - Intergenic
908809608 1:67966553-67966575 CAGTGTCCTCACAGGGTGGAAGG - Intergenic
908910311 1:69065340-69065362 CCATGTCCTTAGAGTCTGGAGGG + Intergenic
908969940 1:69815904-69815926 CTATGTCTTCAGCTGGTGGAAGG + Intronic
910189883 1:84584544-84584566 AAATGTTTTTAGAGGCTGGGTGG + Intergenic
910873820 1:91858805-91858827 CAGCGTTTTCAGAGGCTGAAGGG + Intronic
911474405 1:98358120-98358142 CAATGTCTTCAGAGGGAGCGTGG + Intergenic
911724151 1:101224027-101224049 CTATGTCTTCACATGGTGGAAGG - Intergenic
912075704 1:105873055-105873077 CGATGTCTGCACAGGATGGATGG + Intergenic
913074916 1:115333959-115333981 TAATGTCTTCAGAGGGTAGGAGG - Intronic
915300254 1:154947611-154947633 GAATGTCTCCAGAGGCAGGTGGG - Intronic
915511586 1:156389750-156389772 CCAGGTCTTCAGTGGCAGGAAGG + Intergenic
915663080 1:157419855-157419877 CCATGTCCTCAGATGGTGGAAGG - Intergenic
917950308 1:180025951-180025973 AAAAGTCTTCAGGGGGTGGAAGG + Intronic
919109359 1:193198425-193198447 CAGTGTCTTCACATGGTGGAAGG - Intronic
919702056 1:200641014-200641036 CAATGACCTCAGAGGCTCTAGGG - Intronic
920493667 1:206438776-206438798 TGATGGCTCCAGAGGCTGGAGGG + Intronic
920498106 1:206469736-206469758 AAATGTCCTAGGAGGCTGGAGGG - Intergenic
920539767 1:206769553-206769575 CACTGTGTTCACAGGCTGGCCGG + Intronic
920735391 1:208528762-208528784 AAATGTCTTCAGCTCCTGGAAGG - Intergenic
921490161 1:215765641-215765663 CCATGTGTTCAGAGGTGGGATGG - Intronic
922788001 1:228292918-228292940 CAATAGCTCTAGAGGCTGGAAGG - Intronic
923276931 1:232404647-232404669 CAATGTTTTAAGAGGTCGGAAGG + Intronic
923291611 1:232551620-232551642 CTCTGTCTGCGGAGGCTGGAGGG - Intronic
923757549 1:236806383-236806405 CACTGTGTTCACAAGCTGGAAGG - Intronic
924192379 1:241567365-241567387 CTGTGTCTTCACATGCTGGAAGG + Intronic
924464321 1:244286258-244286280 CAGTGTTTTCAGAGGGTGGCAGG - Intergenic
1063230954 10:4065207-4065229 CCATGTCCTCACAGGGTGGAAGG - Intergenic
1064937261 10:20692081-20692103 CAATGTCTTCATAGCTTAGAAGG + Intergenic
1064937326 10:20692583-20692605 CAATGTCTTCATAGCCTAGTAGG + Intergenic
1066264597 10:33763944-33763966 CAATGATTTCTGAGGCTGCATGG - Intergenic
1066347047 10:34597816-34597838 CACTGTCTCCAGAAGCAGGAGGG + Intronic
1066701994 10:38139741-38139763 CAATATTTTCAGAGGCTTGAAGG - Intergenic
1066714163 10:38268513-38268535 CAATGTTGTCACAGGATGGAAGG + Intergenic
1067895110 10:50170495-50170517 CACTGTCTTCACAGGGTGGCAGG - Intergenic
1070261080 10:74856475-74856497 CAATGTCTTCAGAAGCAAAAAGG - Intronic
1071025629 10:81109463-81109485 CAATGACCTCGGAGGCAGGATGG + Intergenic
1071404641 10:85318331-85318353 TAATGTATTCACAGGCTGAATGG + Intergenic
1073757084 10:106592349-106592371 GAATGTCATTAGAGACTGGATGG - Intronic
1075692928 10:124412042-124412064 AAATGTCATCAGAGGTTGGAGGG + Exonic
1075970768 10:126650257-126650279 TAATGTCTTCAGAGACTTAAGGG - Intronic
1076428831 10:130387583-130387605 CAATGCCTTCAGAGGGTGCGTGG + Intergenic
1077048709 11:557153-557175 CACTGCCTTGTGAGGCTGGACGG - Intronic
1077051749 11:569626-569648 CCATGTCCTCAGGGGCTTGAAGG + Intergenic
1078527638 11:12112236-12112258 GCATCTTTTCAGAGGCTGGAAGG - Intronic
1078909978 11:15722052-15722074 CAGTGTCCTCACAGGATGGAAGG + Intergenic
1080686868 11:34523251-34523273 TAATGTCCTCAGAGCCTGCATGG + Intergenic
1081222235 11:40476037-40476059 CAATGTCTGGAGATGCAGGAGGG - Intronic
1083185670 11:61016503-61016525 CAGTGTCTTGAGAGGTTGGCAGG + Intronic
1083879898 11:65543219-65543241 CAATGTCTGTAGGGGATGGAAGG + Exonic
1084471676 11:69364918-69364940 CAATTTCTTTAGAGGCTAAAGGG - Intronic
1085096462 11:73764431-73764453 CACTGTCTTCAAAGGATGAATGG + Intergenic
1085156748 11:74302536-74302558 CAAGGTCCTCAAAGGCTGGAAGG + Exonic
1085771824 11:79332344-79332366 AAATGGCTTCAGAGGCCAGAAGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1090819693 11:130330393-130330415 CAGTTTCTTCAGAGTTTGGAGGG + Intergenic
1091021457 11:132103792-132103814 AAAGGTCTTCCCAGGCTGGAGGG + Intronic
1091603692 12:1933409-1933431 GAATGCGTTCAGATGCTGGAAGG + Intergenic
1092292112 12:7166602-7166624 CAATTTTTCCAGAGACTGGAGGG - Intergenic
1096183469 12:49563975-49563997 TAATGTCTTCAGAGCTTGGTTGG - Intronic
1096994689 12:55831173-55831195 CAAGGTCCTTACAGGCTGGAGGG - Intergenic
1098096983 12:66968650-66968672 CAATGTCATAAGAGATTGGAGGG - Intergenic
1098861037 12:75710348-75710370 CAATGTCTTCATAGAATGGAGGG + Intergenic
1100362996 12:93895052-93895074 AAGTGACTTCAGAGGCTGCAGGG - Intergenic
1102953425 12:117045019-117045041 AAGTGTCCTCAGAGGCTGGGAGG + Intronic
1103860443 12:124008307-124008329 GAATGTCTTCAGAGGGTGCTGGG + Intronic
1106046860 13:26150522-26150544 CAAAGTCTTAAGCGGCTGAAAGG - Intronic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1106807732 13:33328235-33328257 CAATATGTTCAGAGGTTTGAGGG + Intronic
1106934126 13:34699614-34699636 GAATGCCTTCAGAGGCTAGGAGG - Intergenic
1108005488 13:45941919-45941941 CAGTGGCTTCACAAGCTGGAAGG - Intergenic
1108238922 13:48441211-48441233 CCATGTCCTCAGATGGTGGAAGG + Intronic
1108240148 13:48456293-48456315 CAATGGCTTCTGGGTCTGGAAGG - Exonic
1108344012 13:49526379-49526401 CGATTTCTTCATAGTCTGGAGGG - Exonic
1113092457 13:106630048-106630070 CAATGTGTACAAAGGCTGCATGG + Intergenic
1114214241 14:20643849-20643871 CAATTTCTATAGAAGCTGGAGGG - Intergenic
1116147927 14:41099567-41099589 CTGTGACTTCAGAGGGTGGAAGG + Intergenic
1117084117 14:52181407-52181429 CCATGGCTTCAGAGGGTGCAAGG - Intergenic
1118064910 14:62180249-62180271 CCTTGTCTTCTGAAGCTGGATGG + Intergenic
1119060802 14:71471812-71471834 CAAAGTCTTCAGTCTCTGGATGG + Intronic
1119198607 14:72736259-72736281 CATTGTCTTCAAAGTCTGGTGGG + Intronic
1119879853 14:78091603-78091625 CAAAGCCTTCAGAGACAGGATGG - Intergenic
1119880050 14:78092604-78092626 CTAGCTCTTCAGGGGCTGGAAGG + Intergenic
1120169571 14:81235557-81235579 CCATGTCTTCACATGATGGAAGG + Intergenic
1121636366 14:95456526-95456548 CAATGTCCTAAGAGGGTAGAGGG - Intronic
1122970062 14:105148853-105148875 CAATGTCTGCAGAGGCGAGCGGG + Exonic
1124187194 15:27541482-27541504 CAATGGCTTCACAGGCAGGAAGG - Exonic
1125146918 15:36481765-36481787 CTATGTCTTCACATGGTGGAAGG + Intergenic
1126722206 15:51592977-51592999 CAATGTCTTCTTAGCCTCGATGG - Intronic
1127563299 15:60162025-60162047 TTATGTCTTCAGAGACTGAAAGG + Intergenic
1128336177 15:66787094-66787116 CAGTGTGGTCAGAGCCTGGATGG - Intergenic
1129105205 15:73302354-73302376 CAATGACTTCACAGGCCAGAAGG - Intronic
1131475540 15:92735511-92735533 CTGTGTCTTCATAGGGTGGAAGG + Intronic
1131731694 15:95288155-95288177 CTATTTCTTCAGAGCCTGCAGGG + Intergenic
1132063482 15:98711930-98711952 CACTGTCTTCACATGTTGGAAGG + Intronic
1132376668 15:101332623-101332645 AAATGTCTGCAGAAGCTGGGTGG + Intronic
1132538094 16:493540-493562 AAATGTATTTAGAGGCTGCAGGG - Intronic
1135399952 16:22159843-22159865 CAGTGTCTTCAGAGGGAGCATGG - Intergenic
1135471149 16:22732308-22732330 GAATGTCTACAGAGGATGTAGGG + Intergenic
1137470005 16:48745750-48745772 CACTTTCTTCTAAGGCTGGAAGG - Intergenic
1139689604 16:68631935-68631957 CAAAGTCTTCAGGGGCTGTCTGG - Intergenic
1142158524 16:88545081-88545103 CAATGTCTGCAGTGGCTGGAGGG + Intergenic
1142770520 17:2093533-2093555 CACTCTCTTCAGAGGTGGGAGGG + Intronic
1142987257 17:3703658-3703680 ACGTGTCTTCAGAGGCTGCAGGG - Intergenic
1143271567 17:5679307-5679329 CTATGTCTTCACATGGTGGAAGG - Intergenic
1143362372 17:6382557-6382579 CAATGTGGCCGGAGGCTGGATGG - Intergenic
1144930603 17:18855977-18855999 CACTGGCTTCAGAGGGTGGAGGG + Intronic
1146621984 17:34405851-34405873 CAATGTCATCAAAGCATGGATGG + Intergenic
1146972665 17:37085390-37085412 GCATGTCTTCAGAGGCAGGGTGG - Exonic
1148731377 17:49838856-49838878 TAATGTCTCCAGAGCATGGATGG + Intronic
1149889346 17:60372723-60372745 CAATGTCTTCAGTAGCTTGGAGG - Intronic
1150474354 17:65463381-65463403 CAGTGTGCTCAGAGGCTGGCTGG - Intergenic
1151418200 17:73980521-73980543 CTATGTCTGCAAAGCCTGGAAGG + Intergenic
1153421926 18:4916701-4916723 CCATGGCTTCAGAGGGTGCAAGG - Intergenic
1153757625 18:8300041-8300063 CAATGTTGTCAGAGGCGGGATGG + Intronic
1156228460 18:35131504-35131526 CACTGTCTTCACATGCTGAAAGG + Intronic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1157217550 18:45798144-45798166 CAATTTCTTCCTAGGCTTGACGG + Intergenic
1157498315 18:48171909-48171931 CACAGTCTTCAGAGACTGGAAGG - Intronic
1157993501 18:52526402-52526424 CAAGGTCTTCAGACACTGCAAGG + Intronic
1158032642 18:52985369-52985391 CAATGTCTTCAGAGTTCTGAGGG - Intronic
1160672494 19:372889-372911 CAATGGGCTCAGAGGCTTGAAGG + Intronic
1161390146 19:4016459-4016481 CAAGGGCTTCAGAGGCTGAAGGG - Intronic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1162919641 19:13893023-13893045 CATGGTCTACAGGGGCTGGAGGG - Intronic
1164015852 19:21255442-21255464 CAAAAGCTTCAGAGGCTGGAAGG + Intronic
1164554330 19:29239282-29239304 CAATGTCTTCTATGGCAGGATGG + Intergenic
1166216032 19:41335685-41335707 CTAGGTCTTGAGAGACTGGACGG - Intronic
1167711234 19:51112479-51112501 CAAGGCATTCTGAGGCTGGAAGG - Intergenic
925719595 2:6814065-6814087 CAATGCCCTCAGAGGATGCATGG - Intergenic
926044763 2:9702497-9702519 CAATGTGTACAAAGGCAGGAAGG - Intergenic
926745198 2:16151173-16151195 CAATGTCTTCTGAAGATGGATGG + Intergenic
927060952 2:19418870-19418892 CTCTGTCTTCACAGGCTGGAAGG - Intergenic
927366526 2:22303515-22303537 GAATGTCTGCAGAGTCTGCAAGG - Intergenic
927792352 2:26020245-26020267 CAGAGTCCTCAGATGCTGGAAGG - Intergenic
928328173 2:30336537-30336559 CAATGTCTTCAGAGGAATCAGGG - Intergenic
931027629 2:58131108-58131130 CAATGGTATCAGAGGCTGGGGGG - Intronic
931634872 2:64332110-64332132 CTATGTCTTCACACGGTGGAAGG - Intergenic
932749608 2:74363046-74363068 CAATGTCTCCAGCAGCTGGCTGG + Exonic
934975587 2:98799870-98799892 GAAGGGCCTCAGAGGCTGGAGGG - Intronic
936270914 2:111048204-111048226 CAATGTCTTTATTGGCTGGATGG + Intronic
937047812 2:118861365-118861387 CCCTGTCATCAGAGGCTGGAGGG + Intergenic
944692222 2:202168687-202168709 CACTGAATGCAGAGGCTGGAAGG - Intronic
944948710 2:204721391-204721413 CAGTCGTTTCAGAGGCTGGAGGG + Intronic
945914596 2:215689952-215689974 GAATATCTTCAAAGGCTGGATGG + Intergenic
948320554 2:237065443-237065465 CCTTGACTTCACAGGCTGGAGGG + Intergenic
948384914 2:237575271-237575293 GAATGTCTTTAGGGACTGGATGG - Intronic
1169279571 20:4255490-4255512 CTATGTCAGCAGAGGCTGGAGGG + Intergenic
1169566372 20:6857651-6857673 TAATGTCTCCAGAGGCTACAGGG + Intergenic
1170219840 20:13930182-13930204 AAATCTCTTCAGAAGCAGGAAGG - Intronic
1172101506 20:32486415-32486437 CAATGTCTTCAGAGGCTGGAGGG - Intronic
1172835444 20:37870258-37870280 CTATGTCTCCAGTGGCAGGAGGG - Intronic
1174049950 20:47760550-47760572 CACTGTTTTCAGAGGCAGGTGGG - Intronic
1174494069 20:50927255-50927277 CAATGACTTCCAAGGTTGGAAGG + Intronic
1174689645 20:52491169-52491191 AATTGTCTTCAGAGGCTAAATGG + Intergenic
1175241847 20:57555604-57555626 CAATGTCTTTGCAGTCTGGAGGG - Intergenic
1175400276 20:58696286-58696308 GAATGTGGGCAGAGGCTGGATGG - Intronic
1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG + Intergenic
1175515030 20:59564059-59564081 CAAGGTCTTCAGAACCTGGGAGG + Intergenic
1177183461 21:17768161-17768183 CAATCTCTCTAGAGGGTGGAAGG + Intergenic
1179964486 21:44793527-44793549 AAATGAGTTCAGAGGCTGGAGGG + Intronic
1180758919 22:18183890-18183912 CAATGTCCAGAGAGGCTGTAGGG - Intergenic
1180769206 22:18367681-18367703 CAATGTCCAGAGAGGCTGTAGGG - Intergenic
1180777106 22:18494714-18494736 CAATGTCCAGAGAGGCTGTAGGG + Intergenic
1181103948 22:20560875-20560897 CATTCTATTAAGAGGCTGGATGG - Intronic
1182350188 22:29695136-29695158 CAATGACTTCCCAGGCTGGGCGG - Exonic
1183044974 22:35212190-35212212 AAATGTCCTCAGCAGCTGGAAGG + Intergenic
1184012113 22:41757010-41757032 CAAGGTGTTCAGAGGCCTGAAGG - Intronic
1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG + Intergenic
1203277223 22_KI270734v1_random:96815-96837 CAATGTCCAGAGAGGCTGTAGGG - Intergenic
949119207 3:365414-365436 CAGTGTCTCCAGAGCCTAGAAGG - Intronic
951677362 3:25257420-25257442 AATTGTCTTCAGATTCTGGAAGG + Intronic
951935235 3:28015330-28015352 CGTTGTCTTCAGAGTCTAGAAGG + Intergenic
953020907 3:39112460-39112482 CTATGTGCTCAGAGGCTGGGTGG + Exonic
953099840 3:39813103-39813125 GAATCTCTTCAGAGGTTTGAAGG + Intronic
953439973 3:42908699-42908721 CAGTGTCTTCAGGGGTAGGAGGG - Intronic
954015825 3:47689841-47689863 CAATGCCTTCTGAGGATAGAGGG + Intronic
954103140 3:48393356-48393378 CAGTGTCTTCAGGGCCTGGTGGG + Intronic
955609766 3:60744712-60744734 AAATGTATTCAGATGCAGGAAGG - Intronic
956033633 3:65066729-65066751 CTAAGTCCTCTGAGGCTGGAGGG - Intergenic
957225199 3:77434187-77434209 CAATGTATTCAAAGGCAAGAAGG - Intronic
958702804 3:97615530-97615552 CAATGTCACCAGGGGCTGGCTGG - Intronic
961633992 3:128321544-128321566 CACTGTCCTGACAGGCTGGAGGG + Intronic
962321412 3:134393699-134393721 CTATGTCTTCATATGGTGGAAGG + Intergenic
962987148 3:140546238-140546260 CACTGTCTTAGGAGACTGGAGGG - Intronic
963918476 3:150882998-150883020 CAATGTCTTCAATGGCTGTGAGG - Exonic
964088514 3:152846825-152846847 CCATGGCTTCAGAGGGTGCAAGG + Intergenic
964979140 3:162657502-162657524 CAATTTCTCCAGAATCTGGAAGG - Intergenic
966282888 3:178255221-178255243 CCATGTCCTCACAAGCTGGAAGG - Intergenic
967124842 3:186414124-186414146 TTAGGTCTCCAGAGGCTGGATGG - Intergenic
967501578 3:190203966-190203988 CCATGGCTTCAGAGGGTGCAAGG + Intergenic
967758101 3:193193206-193193228 CAAGGTCTTCTGAGTCTGGATGG + Intergenic
971176604 4:24288294-24288316 CCATGTGTTCAAAGCCTGGAAGG - Intergenic
971192107 4:24437524-24437546 CAAAGTCTTCAGAGCCCCGAGGG - Intergenic
972118246 4:35665735-35665757 CAGTCTCTTCAGAGGCTGAGAGG - Intergenic
972645547 4:40964659-40964681 CATTGTTTCCAGTGGCTGGATGG - Intronic
976007760 4:80450990-80451012 GAATGTGATCATAGGCTGGATGG - Intronic
976846214 4:89490967-89490989 CAAAGTTTTCAAAGGGTGGAAGG - Intergenic
977411866 4:96676105-96676127 CAATGTGCTCAGAGGGTGCAGGG - Intergenic
977973053 4:103233072-103233094 CCATGGCTTCAGAGGATGTAAGG + Intergenic
979141901 4:117186216-117186238 CTATGTCTTCACATGGTGGAAGG - Intergenic
979519746 4:121652693-121652715 CCATGTCTTCAGATAGTGGAAGG + Intergenic
980023816 4:127740630-127740652 CAATGTCTGCACAGGAAGGATGG + Intronic
981207370 4:142059225-142059247 CAATGTCTCCTGTGGGTGGAGGG + Intronic
982923207 4:161303195-161303217 CAGTTTCTTCTGAGGCTGGAGGG - Intergenic
983720002 4:170839106-170839128 CACTGTCTTCTGATTCTGGAGGG - Intergenic
984545457 4:181096189-181096211 CAGTGTCTACAGTGGCTGGAGGG + Intergenic
985617076 5:929477-929499 CCATGGCTTCAGAGGGTGCAAGG + Intergenic
985617776 5:934446-934468 CCATGGCTTCAGAGGGTGCAAGG - Intergenic
985992556 5:3575399-3575421 CACTGTCTTCGGAGGCTCGAGGG - Intergenic
986033259 5:3913148-3913170 GAGTGTCTTCAGAGTCTCGAAGG - Intergenic
987778071 5:22395343-22395365 CAATGCCTCCAGACGCTGAATGG - Intronic
988406607 5:30831995-30832017 AAAAGTCTTCAGAGGCTAAAAGG + Intergenic
988802553 5:34710205-34710227 CAGAGACTTCAGAGGCAGGATGG - Intronic
989450131 5:41577222-41577244 CCATGTCTTCACATGGTGGAAGG + Intergenic
989609483 5:43277529-43277551 CAATGTCTGCAGAAGCTAGGAGG - Intronic
995835212 5:116394086-116394108 GAATGTCTGCAGAGTCTGGGGGG + Intronic
996039229 5:118792003-118792025 CAATGAATTCAAAGGCCGGAAGG - Intergenic
997865060 5:137454497-137454519 CAAAATCTGCTGAGGCTGGAGGG + Intronic
998371767 5:141666451-141666473 CCATGTCCTCAGGGGCTGGGGGG + Exonic
998569299 5:143243185-143243207 CAGTGTCCTCTGGGGCTGGAAGG - Intergenic
1001142575 5:169157177-169157199 CAATGTCAGCAGAGACTGTAAGG + Intronic
1001454265 5:171848648-171848670 CACTGTGGTCAGAGGCTGGCGGG + Intergenic
1002099328 5:176849654-176849676 CAGTGCCTTCAGGGGCTGGGTGG - Intronic
1002556973 5:180049827-180049849 CAATATATTCAGAGGCAGAAAGG - Intronic
1005216440 6:23533678-23533700 AAATATGTTCAGGGGCTGGATGG + Intergenic
1005415022 6:25591138-25591160 CAATGTCTTCATTGGCTAGATGG - Intronic
1005622964 6:27636951-27636973 CAATGTTTTCACAGCCTGTAGGG - Intergenic
1007098545 6:39229176-39229198 AGCTGTTTTCAGAGGCTGGAGGG - Exonic
1008717386 6:54305554-54305576 CCTTATCTTCAGAGTCTGGAAGG + Intergenic
1009515210 6:64607472-64607494 CTATGTCCTCATAGGCTGGAAGG + Intronic
1011754737 6:90486919-90486941 CAATCTCTCCAGAAGCTGGAAGG - Intergenic
1012425903 6:99114189-99114211 CACTGTCTGCAGAGGCTCTAAGG + Intergenic
1013634939 6:112020272-112020294 CAGTGGCATCAGGGGCTGGAGGG + Intergenic
1013967076 6:115967630-115967652 CAATCGCTTCAGAAGCTGTATGG + Exonic
1014619494 6:123648094-123648116 CTATGTCTTCACATGGTGGAAGG + Intergenic
1015530786 6:134219383-134219405 CAATGCCTGCAGAGCCAGGAGGG - Intronic
1015920300 6:138259602-138259624 CAATTGCTTCAGAATCTGGAGGG - Intronic
1018679494 6:166252659-166252681 CAAAGTCCTGAGAGGCTGAAGGG + Intergenic
1018971999 6:168536387-168536409 CAGTGCCTTCAGAGGCTGACAGG + Intronic
1019293126 7:260061-260083 CAGTGAATTCAGAGGCAGGACGG + Exonic
1019479623 7:1260451-1260473 CCACGTGTTCTGAGGCTGGATGG + Intergenic
1021523271 7:21557484-21557506 CTATGTCTTCACATGGTGGAAGG + Intronic
1022013751 7:26330661-26330683 CAATGTCTGCCCAGGCTGAAGGG - Intronic
1023023365 7:36030388-36030410 CAATCTCTTCAGAGCCTCGGAGG - Intergenic
1023808331 7:43890915-43890937 CATTGTCTTCTGTGGCTAGATGG - Intronic
1024401791 7:48932314-48932336 CAATGTCCTCAGATGGTGGAAGG + Intergenic
1024858944 7:53815287-53815309 CAATCTCTCCATAGGCAGGAAGG - Intergenic
1025014554 7:55428284-55428306 CAATGTCTTCACAGGCATCAGGG - Intronic
1026879778 7:73901111-73901133 CCACGCCTTCAGAGGCTGGGAGG - Intergenic
1026899112 7:74027536-74027558 CGATGTCTACAGAGGCCGGGGGG - Intergenic
1027440065 7:78209801-78209823 CAATTTCTTCAGAGCCTTGTAGG - Intronic
1028462163 7:91106276-91106298 TAATGTCTTCAGAGGGTTAAGGG + Intronic
1029133522 7:98351548-98351570 CATTGTCTCCAAAGGCAGGAAGG - Intronic
1029700214 7:102241596-102241618 CAATTTGTTCAGAGCCTGGGTGG - Intronic
1029871683 7:103700514-103700536 CAATATCATCACAGACTGGAAGG + Intronic
1030218200 7:107068252-107068274 CATCGTCTAAAGAGGCTGGAGGG + Intronic
1030304737 7:108006205-108006227 CAATGTCTTCCTAGGAAGGAGGG + Intergenic
1033232634 7:139613525-139613547 GAATGTCTTCAAAGGCTAGAAGG + Intronic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1035831952 8:2705228-2705250 CAATGTCTTCATCCGCTGCATGG + Intergenic
1036677548 8:10847510-10847532 CCATGTCCTCACAGGGTGGAAGG - Intergenic
1037130599 8:15404117-15404139 CTATGTCTTCACATGGTGGAAGG + Intergenic
1037586914 8:20283344-20283366 CTATGTCTTCAGATGGTGGAAGG - Intronic
1037918791 8:22789545-22789567 ATAGGTCTTCAGAGGCTGGGAGG - Intronic
1040868562 8:52076605-52076627 TGATGTCTTCTGAGACTGGAAGG + Intergenic
1041113682 8:54512488-54512510 CTGTGTCTTCACATGCTGGAAGG - Intergenic
1042510223 8:69603384-69603406 CCATGTCTTCAGCTGCTGGCTGG - Intronic
1045714115 8:105021578-105021600 CCATGTCTTCACATGGTGGAAGG - Intronic
1046699751 8:117386842-117386864 AAATGTCTTCAGAAGGTGAAAGG - Intergenic
1047087569 8:121535733-121535755 AAATGCCTTCAGAGGCTGTCAGG - Intergenic
1047568106 8:126068507-126068529 CAATGTGTTCTGAGTCAGGAGGG + Intergenic
1050832261 9:10029062-10029084 CCATGGCTTCAGAGGGTGCAAGG + Intronic
1051480086 9:17550230-17550252 CAATGTCCTCACAGGGTGGAAGG + Intergenic
1051500144 9:17767890-17767912 TAATGTATTGAAAGGCTGGAGGG + Intronic
1053132189 9:35622218-35622240 CAAAGGCTTCAGAGTCAGGAGGG + Intronic
1053345976 9:37378517-37378539 AAATGACTTCATAGGCTGAAGGG - Intergenic
1054885581 9:70194449-70194471 CTATGTCTTCACATGGTGGATGG - Intronic
1055528939 9:77164033-77164055 CAATGTCTTCAGACATTCGACGG - Intergenic
1058546779 9:106069071-106069093 TAATGTAGTCAGAGGCTGGTCGG - Intergenic
1058714988 9:107715557-107715579 CAAATTCTCCAGAGGCTGCAAGG + Intergenic
1060556542 9:124510870-124510892 TAATGTATTCAGTGGCTGGCTGG + Intergenic
1060820627 9:126659475-126659497 GAATGTGTGGAGAGGCTGGATGG - Intronic
1062511689 9:136909782-136909804 CACTGTCCTTCGAGGCTGGAGGG + Intronic
1203553842 Un_KI270743v1:189530-189552 CAAGGTCTACTGTGGCTGGATGG - Intergenic
1187244371 X:17540650-17540672 CAAGTTCTTCAGAGGGTTGACGG - Intronic
1188537848 X:31217267-31217289 CAATGTGTTGAGAGGCAGTAAGG + Intronic
1189321149 X:40088362-40088384 CAATGTCAGCAAAGGCTGTAAGG + Intronic
1189349181 X:40264201-40264223 CATGGTCTGCAGAGACTGGAAGG + Intergenic
1189928122 X:45978595-45978617 AAATGTTTGAAGAGGCTGGAAGG - Intergenic
1190176610 X:48155815-48155837 AAATGTAATCAGAGGTTGGAGGG + Intergenic
1190211070 X:48448420-48448442 AAATGTAGTCAGAGGTTGGAGGG + Intergenic
1190503550 X:51102794-51102816 CACAGTCTTCAGATGCTGGAAGG - Intergenic
1190661135 X:52655311-52655333 AAATGTAATCAGAGGTTGGAGGG - Intronic
1192253100 X:69429870-69429892 CAATGGCTTAAGATACTGGAGGG + Intergenic
1194524581 X:94963383-94963405 CAATGTCTTCAGCAATTGGAGGG + Intergenic
1194624982 X:96216575-96216597 CAGTTTCTTCAGAGTGTGGATGG - Intergenic
1194876956 X:99201183-99201205 CTGTGGCTTCAGAGGGTGGAAGG + Intergenic
1195928498 X:110049980-110050002 CAAAGTCCTTAGAGGCTGGTTGG + Intronic
1195951920 X:110284173-110284195 AAATGGCTCCAGAGGCAGGAGGG + Intronic
1196441112 X:115721064-115721086 CAAGGTCTACAGAGGCTAAATGG - Intergenic
1196444639 X:115839051-115839073 CAAGGTCTACAGAGGCTAAATGG - Intergenic
1198548537 X:137719812-137719834 AAATGTCTGCAGTGGCTGGTGGG + Intergenic
1199750131 X:150807859-150807881 CAATGGCTTCAGAGTATGAATGG + Intronic