ID: 1172101568

View in Genome Browser
Species Human (GRCh38)
Location 20:32486876-32486898
Sequence CTCTTTCTGGATTTCTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 450}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172101568_1172101570 2 Left 1172101568 20:32486876-32486898 CCAGACAAGAAATCCAGAAAGAG 0: 1
1: 1
2: 2
3: 24
4: 450
Right 1172101570 20:32486901-32486923 ACTCCACAACACAACAGTCTTGG 0: 1
1: 1
2: 1
3: 26
4: 585

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172101568 Original CRISPR CTCTTTCTGGATTTCTTGTC TGG (reversed) Intronic
901863291 1:12088343-12088365 TCCTCTCTGGATTTCTTATCAGG - Intronic
902525737 1:17056121-17056143 CTGTTTCTGGAGTCCTTGACTGG + Intergenic
906299845 1:44674066-44674088 CTTTTTCTGTCTTTCCTGTCCGG - Intronic
906952431 1:50345662-50345684 CTCTTTCTCCATTTCCTGGCTGG - Intergenic
907139961 1:52177458-52177480 TTCTTTGTTGATTTTTTGTCTGG + Intronic
908042885 1:60134115-60134137 CTCCTTCTGGACTTATTTTCTGG + Intergenic
908908368 1:69042596-69042618 CTTTGTCTGGTTTTCATGTCAGG - Intergenic
909092945 1:71249356-71249378 CTCCTTTTTGATTTCTTGTTTGG - Intergenic
909397221 1:75183603-75183625 TTCTTTCAAGATCTCTTGTCAGG - Intergenic
909637232 1:77829912-77829934 CTCTTTCTGTGTGTCTTTTCTGG + Intronic
910374945 1:86558367-86558389 TTCTTTCAAGATCTCTTGTCAGG + Intronic
910465514 1:87494990-87495012 CTCTTTCTTCCTTTCTTTTCTGG + Intergenic
911012094 1:93290939-93290961 TTCTTTGTTGATTTCATGTCTGG - Intergenic
912071007 1:105809735-105809757 TTCTTTGTTGATTTTTTGTCTGG - Intergenic
913486822 1:119339542-119339564 ATCTTTCTGGATTTCATGCAGGG - Intergenic
915639004 1:157207232-157207254 CTCTCTCTCGACTTCTTGTGGGG + Intergenic
915857139 1:159400712-159400734 TTCTTTATGGATTTTCTGTCTGG - Intergenic
916917299 1:169422089-169422111 GTCTTTCTGGCTTTCTAGTTTGG + Exonic
917290471 1:173467395-173467417 CTTTTTCTGGAAATCATGTCTGG - Intergenic
917364274 1:174212071-174212093 CTCTTTGTTGATTTTTTGACTGG - Intronic
917599094 1:176557336-176557358 CCCTTTCTGGCTTTCCTGTTGGG - Intronic
918018371 1:180659840-180659862 CTTTTTCTGGTTTTGGTGTCAGG + Intronic
918384638 1:183993452-183993474 CTCTTGCTGGATTTCTAATTTGG - Intronic
918888013 1:190222010-190222032 TTCTTTCTTGATTTTCTGTCTGG - Intronic
919529974 1:198705058-198705080 CTCTTTCTGTCTTGCTTGTTAGG + Intronic
919567167 1:199202831-199202853 CTCTTTCTGGCATTCCTGACCGG + Intergenic
920055224 1:203186345-203186367 CTCATCCTGGATTTCTCTTCAGG - Exonic
920549918 1:206850469-206850491 TTCTTTGTGGATTTTCTGTCTGG - Intergenic
920672839 1:208017530-208017552 CACTTTGATGATTTCTTGTCTGG - Intergenic
920739219 1:208564409-208564431 CTGTGTCTGGATTTCCTCTCTGG - Intergenic
920929956 1:210378169-210378191 CTCCTTTTGTGTTTCTTGTCTGG + Intronic
922994987 1:229949318-229949340 CTTTTGCTAGATTTATTGTCAGG - Intergenic
923168830 1:231394280-231394302 CAATTTCTGTATTTCTGGTCAGG + Intronic
923795498 1:237150769-237150791 ATCCTTCTGGAGTTCATGTCTGG + Intronic
1063692212 10:8297452-8297474 CTCTTTCTTTCTTTCTTGACAGG + Intergenic
1064521346 10:16205750-16205772 TTCTTTGTTGATTTTTTGTCTGG + Intergenic
1066153727 10:32651973-32651995 TTCTTTGTTGATTTTTTGTCTGG + Intronic
1066951747 10:42125585-42125607 GTCTTTCTGGGGTTCTGGTCAGG + Intergenic
1067141363 10:43659770-43659792 CTTTTTCTGGATTTCTGGATGGG + Intergenic
1067330426 10:45310890-45310912 CTCTTTCTGGATACCTTGTAAGG - Intronic
1068502468 10:57857474-57857496 CTCTTTCTGGTTTTGCTATCAGG + Intergenic
1068543024 10:58316821-58316843 CTCCATCTGCATTTCTTTTCTGG - Intergenic
1068809473 10:61239681-61239703 CTTTTTCTGTATTTCTTTTTAGG + Intergenic
1068968646 10:62939342-62939364 CTCTGTCTGGATTTTTGGTTAGG + Intergenic
1069229558 10:65992210-65992232 TTCTTTCTTGTGTTCTTGTCTGG + Intronic
1069656097 10:70089918-70089940 CGCTTCCTGGATTTCTTTCCAGG + Intronic
1072115235 10:92364469-92364491 CTATTTCTTCATTTTTTGTCTGG + Intergenic
1072863026 10:99026566-99026588 TTCTTTATGGATTTTCTGTCTGG - Intronic
1073687337 10:105769756-105769778 CTCCTACTGGATTTTCTGTCGGG - Intergenic
1074564487 10:114564816-114564838 TTCTTTTTTGATTTCTTTTCTGG + Intronic
1074636004 10:115318364-115318386 CTCTTCCTGGTTTTGGTGTCAGG + Intronic
1077611356 11:3645011-3645033 CTATTTCTGGATGTCTCCTCAGG - Intergenic
1078088646 11:8250169-8250191 CACTGTCAGGATTTCTTTTCTGG + Intronic
1078482816 11:11693517-11693539 CTCCTTCAGGAGTTCTTGTGAGG - Intergenic
1078874127 11:15376891-15376913 CTCCTTCTGGAATTCTTCTCTGG - Intergenic
1079041020 11:17059567-17059589 TTCTTTCTTGATTTTCTGTCTGG - Intergenic
1079356997 11:19738124-19738146 CTCTTTCTGCATGCCATGTCAGG - Intronic
1079668051 11:23132991-23133013 TTCTTTCAGGAATTCTTGTAAGG + Intergenic
1079705337 11:23609345-23609367 CATTTTCTGGATTTCTAGTGAGG - Intergenic
1080125320 11:28727104-28727126 CTCTTTTTGTATCTCTTGTTAGG + Intergenic
1080857003 11:36121169-36121191 CTCTGTCTGGATTACTCCTCTGG - Intronic
1081454669 11:43209810-43209832 CTCTTTCTAGCTTTCTGATCTGG + Intergenic
1082113415 11:48301739-48301761 CTCTTCCTGGCTTTGTTATCAGG + Intergenic
1082225384 11:49700213-49700235 TTCTTTATTGATTTCCTGTCTGG + Intergenic
1085880974 11:80465511-80465533 CCCTTTCAAGATTTCTTGTAAGG - Intergenic
1086623708 11:88919492-88919514 TTCTTTATTGATTTCCTGTCTGG - Intronic
1087031496 11:93709916-93709938 TACTTTCTTGATTTCTTTTCAGG + Intronic
1087626920 11:100605740-100605762 TTCTTTCAGGATCTCTTGTAAGG - Intergenic
1088999727 11:115041812-115041834 CTCTTTCGGGCTTTCGTCTCTGG - Intergenic
1089671406 11:120059535-120059557 GTCTTTCTGCATTTCTTTTTAGG - Intergenic
1090814037 11:130274832-130274854 CTTTGTCTGGCTTTATTGTCAGG + Intronic
1091894918 12:4094241-4094263 CTCTTTCTGGTTTTAATATCAGG - Intergenic
1091952159 12:4603079-4603101 GTCTTTCTGGCTTTCTAGTTTGG + Intronic
1092085420 12:5754392-5754414 CTCTGTCTGGATTTGGTATCAGG + Intronic
1092953641 12:13530132-13530154 CCCCTTCTGGCTTTCTTGTCTGG - Intergenic
1093593516 12:20935271-20935293 CTTTTTCTGGTTTTGTTCTCAGG + Intergenic
1093991809 12:25597590-25597612 TTCTTTGTTGATTTCATGTCTGG - Intronic
1095217079 12:39561782-39561804 TTCTTTCTTGATTTTCTGTCTGG - Intronic
1096163254 12:49398537-49398559 CACTTCCTGGGTTTCTTGTTTGG + Intronic
1096381819 12:51165035-51165057 CTTTTTCTGGCTTTGGTGTCAGG - Intronic
1096651766 12:53065380-53065402 CTCTTTCTTGTTTTCTTTCCTGG - Exonic
1098142614 12:67466223-67466245 TTCTTTGTTGATTTTTTGTCTGG + Intergenic
1099125060 12:78744316-78744338 ATCTTTCTTTATTCCTTGTCTGG - Intergenic
1099703104 12:86114651-86114673 CTATTTCTGCATTTCTTATATGG - Intronic
1101948905 12:109159231-109159253 TTCTTTCTTGCTTTCTTGTTTGG + Intronic
1105759727 13:23502984-23503006 CTCTGTCTGGCTGTCTTGTGGGG + Intergenic
1106040349 13:26084359-26084381 CTCTTTCTGCACTTATTTTCAGG - Intergenic
1106472443 13:30069272-30069294 CTCTATTTGGATTTTTAGTCTGG - Intergenic
1106633308 13:31500251-31500273 CTCTTTCTGCACTTTTTGTAGGG - Intergenic
1109469788 13:62790271-62790293 CTCTTTCTGCATTGTGTGTCGGG - Intergenic
1109666747 13:65549978-65550000 CTCTGTCAGGTTTTCTTATCAGG + Intergenic
1109740261 13:66544487-66544509 CTCTTTCTTGAATTCTTTCCTGG - Intronic
1109747916 13:66650569-66650591 CTCTTTGTTGATTTTCTGTCTGG - Intronic
1110486842 13:76055335-76055357 TTCTTTGTTGATTTCCTGTCTGG - Intergenic
1110560355 13:76905003-76905025 CTCTTTTTGGATGTGTTGTTTGG + Intergenic
1110795858 13:79637300-79637322 CTATTTCTGGTTCTCTTTTCTGG - Intergenic
1111110914 13:83708138-83708160 CTTTTTCTGGATATTCTGTCTGG + Intergenic
1111355553 13:87096716-87096738 ATCTTTGTGGATTTCTTCACAGG - Intergenic
1111456353 13:88488857-88488879 CTCTTTCTGGATCTATTTTGTGG + Intergenic
1111798624 13:92956003-92956025 CTCTGTCTGCATTTGTTTTCTGG + Intergenic
1112257921 13:97851630-97851652 CTCTCTCTGACTTTCTTCTCTGG - Intergenic
1114873889 14:26691400-26691422 TTCTTTCTGGCTTTCTTGTCAGG - Intergenic
1115448755 14:33521988-33522010 CTCTTGCTGCATTTCTGGACGGG + Intronic
1118117127 14:62791866-62791888 TTCTTTATTAATTTCTTGTCTGG - Intronic
1118250240 14:64153030-64153052 CTGTTTCTGTATATCTTGCCAGG - Intronic
1119564580 14:75617645-75617667 CTCTTTCTGGGGTTGTTGTGAGG + Intronic
1119569394 14:75656947-75656969 TTCTTTATGGCTTTCTTGTCAGG + Intronic
1119996688 14:79261405-79261427 CCCTTTCTGCATCTCTAGTCTGG - Intronic
1120100570 14:80440334-80440356 TTCTTTGTTGATTTCCTGTCTGG - Intergenic
1120276034 14:82373723-82373745 CTCTTTGTTGATTTTCTGTCTGG - Intergenic
1121352961 14:93188325-93188347 ATCTTTCTGATTTTCTTTTCTGG + Intronic
1122062997 14:99149135-99149157 CTCTTTCTCCCTCTCTTGTCAGG - Intergenic
1122126113 14:99579602-99579624 TTCCTTCTGGGTTTCTTGCCTGG - Intronic
1123862695 15:24485142-24485164 TTCCTTCTGGATCTCTTTTCTGG + Intergenic
1125187539 15:36948954-36948976 TTCTTTCTGCCTTTCTTTTCAGG + Intronic
1126609707 15:50517010-50517032 ATGTTTCTGTATTTTTTGTCTGG - Intronic
1127321428 15:57850413-57850435 TTCTTTCTGCAGTGCTTGTCTGG + Intergenic
1127687489 15:61363273-61363295 CTCTTTCAGGAGTTCTTGCAGGG + Intergenic
1127740071 15:61894830-61894852 TTCTTTCTTGATTTTCTGTCTGG - Intronic
1129802614 15:78427481-78427503 CTCTTTCTTGATTTCTTCTAAGG + Intergenic
1129897905 15:79122313-79122335 CTATCTCTGGACTTCGTGTCAGG - Intergenic
1131410836 15:92207121-92207143 CTCTGTCTGGTTTTCATATCAGG - Intergenic
1131506037 15:93020176-93020198 CTCTTTCTGGACATGTTGTTGGG - Exonic
1131698202 15:94903178-94903200 CTCCCTCTGGATTTCAGGTCTGG - Intergenic
1132918459 16:2368513-2368535 CCCTATCTGCATTTCTAGTCTGG + Intergenic
1134483677 16:14639845-14639867 CTCTCTCTTGATTTCACGTCAGG - Intronic
1135048603 16:19174083-19174105 CTGTTTCTGAAGTTCTTGTTCGG - Intronic
1135464163 16:22670902-22670924 CTTTTTCTGGTTTGCTTCTCAGG - Intergenic
1136939989 16:34514792-34514814 GCCTTTCTGGGTTTCTGGTCAGG + Intergenic
1136945772 16:34648996-34649018 GCCTTTCTGGGTTTCTGGTCAGG - Intergenic
1136959831 16:34833774-34833796 GCCTTTCTGGGTTTCTGGTCAGG - Intergenic
1136968008 16:34938146-34938168 GCCTTTCTGGGTTTCTGGTCAGG - Intergenic
1137220176 16:46441470-46441492 GCCTTTCTGGGTTTCTGGTCAGG + Intergenic
1137529811 16:49271800-49271822 CTCTTTTTGGAGTTCATTTCAGG - Intergenic
1137541739 16:49367648-49367670 CTATTTCTGCAGTTCTTGTGGGG - Intergenic
1137649726 16:50109662-50109684 CTCCTTCTGTGTTTCTTTTCAGG - Intergenic
1140943731 16:79748075-79748097 CTATCTCTGTATTTCTTGACTGG + Intergenic
1144351218 17:14398710-14398732 ATCTATCTGGATTTTGTGTCTGG - Intergenic
1144376748 17:14650574-14650596 CTCTGTCTGGGGTTCTGGTCTGG + Intergenic
1146323784 17:31868014-31868036 CTGTTTCAGCATTTCTTGTCTGG - Intronic
1148843103 17:50511740-50511762 CTCTTTCTGGTTCTTTGGTCTGG - Intronic
1148888623 17:50791664-50791686 CCCCATCTGGTTTTCTTGTCTGG - Intergenic
1149402730 17:56314927-56314949 CTAATTCTGGAGTTCTTGTTTGG + Intronic
1149571756 17:57677174-57677196 CTCTTTCTGGACCCCTTTTCAGG + Intronic
1149772603 17:59332642-59332664 GTTCTTCTGGACTTCTTGTCCGG + Intronic
1150458251 17:65325675-65325697 CTCTTTCTGCATTCCATCTCAGG - Intergenic
1155720477 18:29005151-29005173 GTCTGTCTGGTTTTGTTGTCAGG - Intergenic
1156181172 18:34606656-34606678 CTTCTTCTGGATGTCTTCTCTGG - Intronic
1156440812 18:37185847-37185869 CTTTTTCTTTATTTCTTGTGCGG + Intronic
1156554760 18:38054624-38054646 CTCATTCTGCATTTCTTGGGAGG + Intergenic
1156761361 18:40595608-40595630 CTCTTTTTGGAATTCTTCTATGG + Intergenic
1157071953 18:44418195-44418217 TTCCTTCTGGAGTTCTTGTAAGG - Intergenic
1157934398 18:51857355-51857377 CTATTTTTGGATGTCTTCTCAGG + Intergenic
1158136876 18:54217508-54217530 CTCTTCCTGGATTTAGTGTTTGG - Intronic
1158140449 18:54250068-54250090 CTATTTCAGGAATTCTTGTGAGG - Intergenic
1158441779 18:57481297-57481319 CTCTTTCTGGATTTCTCCAGAGG - Exonic
1158535106 18:58301441-58301463 CTCTCTCTGGTTTTCTTTCCAGG + Intronic
1159160616 18:64639625-64639647 CTCTTTCTGGAATTTATTTCTGG + Intergenic
1159642446 18:70879277-70879299 CTCCTTCTGGCTGTCTTCTCTGG + Intergenic
1160434917 18:78842653-78842675 CTCTTTCTTGCTTTTGTGTCAGG + Intergenic
1161007610 19:1944348-1944370 CTCATTCTGGAGTTCTCGTGGGG + Intronic
1162160888 19:8715296-8715318 CTCTTTCAGCATTTCTTGTAAGG + Intergenic
1162555630 19:11383980-11384002 CTGTTTCTGGACTTCCTGACCGG - Intronic
1162802753 19:13120033-13120055 CTCGTTCTGGATTCCCTGGCGGG + Intronic
1164334137 19:24293381-24293403 GTCTTTCTGGATTTTATCTCAGG - Intergenic
1164339242 19:24371126-24371148 ATCTTTCTGGTTTTCTTCTGAGG - Intergenic
1165337825 19:35184629-35184651 CTCCTTGAGGATTTCTTGTAAGG - Intergenic
1166842475 19:45706578-45706600 CTATTTCAGGATTTGTAGTCAGG - Intergenic
1168232460 19:55041889-55041911 GTCTTTCTGGCTTCCTAGTCAGG - Intronic
925219084 2:2123272-2123294 CGCTTTAGGGATTTCTTTTCTGG - Intronic
925647135 2:6046887-6046909 TTCTTTCAGGATCTCTTGTAAGG - Intergenic
926496419 2:13593800-13593822 CTCTTTTTGTATTTCATTTCAGG + Intergenic
927267311 2:21164338-21164360 CTTTGTCTGGATTTCGTATCAGG + Intergenic
927416626 2:22887027-22887049 CTCTTTGTGGTTTGCTTTTCTGG + Intergenic
928733677 2:34261384-34261406 CCCTTTCTAGAGTTCTGGTCAGG - Intergenic
930001337 2:46863729-46863751 CTCTTTCTGGATTTGAGTTCTGG - Intergenic
930251363 2:49037817-49037839 CTCTTTCTGGATTTCCTGTTAGG - Intronic
930383612 2:50662951-50662973 GGCTTTCTGGATGTCTTGCCAGG - Intronic
931437932 2:62265253-62265275 CTGTTTCTGGATTTCTTTGCCGG + Intergenic
931601103 2:64003958-64003980 TTCTTTCTGTATTCCATGTCTGG - Intronic
932029308 2:68166961-68166983 CTCTTTCATGATTTCTTGTTTGG + Intronic
933121653 2:78545754-78545776 CTTTTTCTGGATTTTTTATCAGG - Intergenic
935248359 2:101238826-101238848 CTCTTTTTGGGTTTTTTGACCGG + Intronic
935752019 2:106244042-106244064 CTTTTTCTGGTTTTGGTGTCAGG - Intergenic
935912429 2:107911589-107911611 CTTTTTCTGGTTTTGGTGTCAGG - Intergenic
935978472 2:108603109-108603131 CTTTTTCTGGTTTTGTTATCAGG + Intronic
936448121 2:112613152-112613174 CTCTTTCAGGAGCTCTTGTAAGG + Intergenic
936807786 2:116358238-116358260 CTCTGTCTAGATTTATTTTCTGG - Intergenic
937213181 2:120291402-120291424 ATATTTCTGGATTTCCTGTGTGG - Intronic
937487013 2:122325766-122325788 CTCTTTCTGGGTTGTTTGTAAGG + Intergenic
937722269 2:125115268-125115290 ATCTTTCAGCATTTCTTGTAGGG - Intergenic
937953203 2:127404136-127404158 CTCTTTCTGTATTTATTGATTGG - Intergenic
938602642 2:132858032-132858054 TTCTTTCTGTATTTCTTTTCAGG + Intronic
939256895 2:139756137-139756159 TTCTTTGTTGATTTTTTGTCTGG + Intergenic
939800778 2:146704765-146704787 CTTTTTCTGGTTTTCATATCAGG - Intergenic
940708100 2:157128643-157128665 CTCTTTCAGGACCTCTTGTAAGG - Intergenic
941767300 2:169312367-169312389 TTCCTTCAGGATTTCTTGTAAGG + Intronic
942655325 2:178208905-178208927 CTCATTCTTGATTTATAGTCTGG + Intronic
942675708 2:178424314-178424336 TTCTTTGTGGATTTTCTGTCTGG + Intergenic
942752087 2:179299635-179299657 CTCTATCTGGAACACTTGTCAGG + Intergenic
945016111 2:205518743-205518765 TTCTTTCAAGATTTCTTGTAAGG + Intronic
945498664 2:210541269-210541291 CTCATTTTGAATTTCTTGCCTGG + Intronic
945569336 2:211445453-211445475 CTTTTTCTGGTATTCTTTTCTGG - Intronic
945776510 2:214112986-214113008 TTCTTTCTGGAGCTCTTGTAAGG + Intronic
946822659 2:223646368-223646390 GTCTGTATAGATTTCTTGTCTGG + Intergenic
947917171 2:233840186-233840208 CTATTTCTGGATTCCTGGTAGGG - Intronic
1170056687 20:12213042-12213064 CTCTTTGTGAATTTCTGCTCTGG - Intergenic
1172101568 20:32486876-32486898 CTCTTTCTGGATTTCTTGTCTGG - Intronic
1172803707 20:37596499-37596521 CTCTTTCTGTGTTCCTTCTCTGG - Intergenic
1173115165 20:40234986-40235008 CTCTCTCTCTATTTCTTTTCAGG - Intergenic
1176249417 20:64113196-64113218 CTATGTCTGGCTTTCTCGTCAGG + Intergenic
1177133948 21:17291011-17291033 TTCTCTCTAGCTTTCTTGTCAGG - Intergenic
1177400497 21:20597375-20597397 ATCATTCTGGATTTTTTGTCTGG - Intergenic
1177525021 21:22279509-22279531 CTCTTTCTGGACTTGATGCCTGG - Intergenic
1177771580 21:25522208-25522230 TTCTTTCTTGATTTTCTGTCTGG - Intergenic
1177943047 21:27434417-27434439 CTCTTTCAGGCTTTGGTGTCAGG + Intergenic
1178003348 21:28189431-28189453 CTTTGTCTGGATTTCATATCAGG + Intergenic
1183192022 22:36327724-36327746 CTATTTCTGGTTTTCTGGTGGGG - Intronic
1184305252 22:43594726-43594748 TTCTTTGTTGATTTCCTGTCTGG - Intronic
1185178732 22:49347300-49347322 GTCTTTCAGGATTTCTGTTCTGG - Intergenic
949428510 3:3946101-3946123 CTGTTTGTTGATTTCCTGTCTGG + Intronic
949469714 3:4381711-4381733 CTCTTTCTGCATTAATTATCTGG - Intronic
950040381 3:9916062-9916084 CTCTTTCTGGAGTTCTGGAGAGG - Exonic
950960620 3:17102208-17102230 TTCTTTGTTGATTTTTTGTCTGG - Intergenic
951929530 3:27949300-27949322 TTCTTTGTTGATTTTTTGTCTGG + Intergenic
953787329 3:45921104-45921126 CTCTTTCTGGCCCTTTTGTCTGG - Exonic
955657492 3:61260356-61260378 CTCTTTTTGTATTTATTGTTTGG + Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
955827149 3:62960152-62960174 CTCTGTCTGGATTTAGTATCAGG + Intergenic
956295226 3:67705004-67705026 CTTTTTCTGGATTTCCTGGGTGG + Intergenic
956693158 3:71896221-71896243 CTCTTTCTGTCTTTGTTATCTGG + Intergenic
956719198 3:72103074-72103096 CACTTTCTGATGTTCTTGTCTGG + Intergenic
956895715 3:73657853-73657875 CTCTTTCTGGTTTTGTTTTTTGG + Intergenic
958617796 3:96517687-96517709 TTCTTTGTTGATTTTTTGTCTGG - Intergenic
959189595 3:103094096-103094118 TTTCTTTTGGATTTCTTGTCAGG + Intergenic
959411292 3:106025615-106025637 CTCTTTCATGATTTCTTTTTAGG - Intergenic
960214363 3:115012660-115012682 TTCTTTATGGATTTTCTGTCTGG - Intronic
960239247 3:115320948-115320970 CACTTTCTGCATTTCCTTTCTGG - Intergenic
960242377 3:115360431-115360453 CCCTTTCTGGTTTTTTTGACCGG - Intergenic
960850541 3:122048400-122048422 CTTTTTCTGGCTTTGCTGTCAGG + Intergenic
962109650 3:132430863-132430885 CTGTTTCTGGATTTCATACCTGG - Intronic
962193856 3:133339545-133339567 CTCTTTGTTGATTTTCTGTCTGG - Intronic
963403787 3:144837154-144837176 TTCTTTGTTGATTTCATGTCTGG + Intergenic
963459444 3:145590068-145590090 ATCTTTCTGGTTTTTTTGTGTGG - Intergenic
963515574 3:146304154-146304176 TTCTTTGTTGATTTTTTGTCTGG - Intergenic
963768070 3:149358966-149358988 CTGTGTCTGGATTTCTTTTTTGG + Intergenic
964635719 3:158856674-158856696 TTATTTCTGCATTTCTTGTAGGG + Intergenic
964708777 3:159648844-159648866 CTCTCTCTGGATTTCCTGTATGG + Intronic
964788838 3:160431036-160431058 TTCTTTCTGGATCTCTGGTAAGG - Exonic
965257233 3:166429193-166429215 TTCTTTGTTGATTTTTTGTCTGG - Intergenic
965318343 3:167219224-167219246 TTTTTTGTGGATTTCCTGTCTGG - Intergenic
965707810 3:171526687-171526709 CGACTTCTGGATTTCTTGTCTGG - Intergenic
967083350 3:186071135-186071157 CTTTTTCTGCATTTCCTTTCTGG + Intronic
967430939 3:189384181-189384203 CTGTTTCTGGATTTCTGTTTGGG + Intergenic
968053729 3:195674798-195674820 CACTTGCTGGTTTTCTTTTCAGG + Intergenic
970101376 4:12526111-12526133 TTCTTTCAGGATATCTTGTAAGG - Intergenic
970160427 4:13183116-13183138 CACTTTCTCTATTTCTTGTTTGG - Intergenic
970879014 4:20906130-20906152 CTCTTTCTCTCTCTCTTGTCGGG + Intronic
971388197 4:26160898-26160920 CTCTTTCTGTTTCTCTTGCCCGG + Intergenic
971645646 4:29198028-29198050 CTTTTTCTGGATTTGGTGTCAGG + Intergenic
972422565 4:38903087-38903109 CTTTTTCTGAATTTTTTGTTAGG - Intronic
972696545 4:41452008-41452030 CTCTTTCTTCTTTTCTTCTCAGG + Intronic
972965393 4:44502620-44502642 TTCTTTCAGCATTTCTTGTAAGG - Intergenic
973243699 4:47987059-47987081 CTATCACTGGATTTCTTTTCCGG + Intronic
974195008 4:58562618-58562640 CTGTTACTGTAATTCTTGTCTGG - Intergenic
974228148 4:59075756-59075778 CTCTTTCATTATTTCTTGACTGG + Intergenic
974301260 4:60070253-60070275 TTCTTTGTTGATTTCTTGTCTGG - Intergenic
974353031 4:60774102-60774124 GTCTTTCTGGAAATGTTGTCTGG + Intergenic
974906232 4:68060824-68060846 GTCTTTTTGGATTTCTTTTAAGG + Intronic
975295463 4:72729404-72729426 TTCTTTGTTGATTTTTTGTCTGG - Intergenic
976151834 4:82100028-82100050 CTCTTCCTAGAATTCTTCTCTGG - Intergenic
978021064 4:103813295-103813317 CTCTTTCTGTTTTTCCTATCTGG + Intergenic
978225826 4:106334001-106334023 CTCTTTCTAGATGTCTTCTATGG + Intronic
978678270 4:111345621-111345643 CTATTTCTGGCTTTGTGGTCAGG - Intergenic
979076449 4:116276635-116276657 TTCTTTCAGGAGTTCTTGTTAGG - Intergenic
980252126 4:130331016-130331038 TACTTTCTGGAATTCTTGACCGG - Intergenic
981293081 4:143099361-143099383 CTCTTTCTGCTTTTCTTCTGAGG - Intergenic
981594430 4:146403253-146403275 TTCTTTCTGGAACTCTTGTCTGG + Intronic
981599346 4:146468316-146468338 CTGTTTCTGGATTTCTGATTTGG - Intronic
982127323 4:152195728-152195750 CTCTATCTGGATTTATTTTGAGG - Intergenic
982610544 4:157568897-157568919 TCCTTTCTGCATTTCCTGTCTGG + Intergenic
982898934 4:160972961-160972983 TTCTTTCTGGATTTTCTGTGTGG - Intergenic
984216136 4:176914692-176914714 CTCTTCCTGGTTTTGTTATCAGG - Intergenic
985934483 5:3085331-3085353 TTTTGTCTGGATTTGTTGTCAGG - Intergenic
986072832 5:4303844-4303866 CTTTCTCTGCCTTTCTTGTCTGG + Intergenic
986342248 5:6800717-6800739 CTTGTGCTGGATTTCTTTTCAGG + Intergenic
986654918 5:10001518-10001540 TCCTTTCAGGATTTCTTGTAAGG - Intergenic
987301534 5:16602010-16602032 CTTGCTGTGGATTTCTTGTCTGG - Intronic
987504813 5:18754258-18754280 CTGTATCTGGAGCTCTTGTCTGG + Intergenic
988066259 5:26230918-26230940 CTCTTTCTTTCTTTCTTTTCAGG + Intergenic
988607974 5:32697465-32697487 CTTTTTCTGGTTTTGGTGTCAGG + Intronic
988832548 5:35002244-35002266 CTCATTCTGGCTTTGTTGTTTGG + Intronic
988996817 5:36722977-36722999 CGCTTTCTGTATTTCTTCTAAGG - Intergenic
989358571 5:40573079-40573101 CACGTTCTGTTTTTCTTGTCTGG + Intergenic
989784810 5:45314339-45314361 TTCTTTCAGGATCTCTTGTAGGG - Intronic
990039427 5:51361603-51361625 CTGTTTCTTGAGTTCTTGGCGGG - Intergenic
990499373 5:56380218-56380240 ATCTTTCTGGATTTTTGGTTTGG - Intergenic
990781903 5:59374004-59374026 TTCTTTCAGGAGTTCTTGTAAGG - Intronic
990910759 5:60850136-60850158 TTCTTTCTTCCTTTCTTGTCAGG + Intergenic
992038667 5:72807192-72807214 TTCTTTCAGGAGTTCTTGTAAGG + Intergenic
992139504 5:73781615-73781637 ATATTCCTGTATTTCTTGTCTGG + Intronic
992237761 5:74729535-74729557 CTCTTTCTGGACTGTTTATCTGG - Intronic
992511930 5:77445438-77445460 CTCTTCCTGGTTTTGGTGTCAGG - Intronic
993240922 5:85383624-85383646 TTCTTTTTTGATTTCTTGTCTGG + Intergenic
993246226 5:85456984-85457006 TCCTTTCAGGATTTCTTGTAAGG + Intergenic
993582551 5:89680575-89680597 TTCTTTGTGGATTTTCTGTCTGG - Intergenic
993833943 5:92793281-92793303 TTCTTTCAGGAACTCTTGTCAGG + Intergenic
993988923 5:94632217-94632239 CTATTTCTGGACTTCCTGTTTGG + Intronic
994963576 5:106637558-106637580 CTCCTTCTTAAATTCTTGTCTGG - Intergenic
995302394 5:110599147-110599169 CTCTTTCAGGAGCTCTTGTAAGG - Intronic
995614458 5:113945212-113945234 TTCTTTGTTGAATTCTTGTCTGG - Intergenic
996639817 5:125739023-125739045 TTCTTTCAGGAGTTCTTGTAAGG + Intergenic
996978856 5:129464729-129464751 ATCTTTCTGGATCTCATATCTGG + Intronic
998634322 5:143935690-143935712 TTCTTTGTTGATTTTTTGTCTGG - Intergenic
998802046 5:145879020-145879042 TTCCTTCTGGAGTTCTTGTAAGG - Intergenic
1001789030 5:174438775-174438797 TTCTTTCAGGATCTCTTGTAGGG - Intergenic
1002484135 5:179523246-179523268 CTTTTTCTGGTTTCCTTCTCTGG - Intergenic
1002500430 5:179644235-179644257 CTTTTTCTGGTTTCCTTCTCTGG + Intronic
1002970614 6:2014191-2014213 TTCTTTCAGCATTTCTTGCCAGG - Intronic
1003009413 6:2412483-2412505 CCCTATCTGGCTTTCATGTCTGG - Intergenic
1003927343 6:10888465-10888487 CACTTTCTGATTTTCCTGTCAGG + Intronic
1004461733 6:15842920-15842942 GCCTTTCTGGCTTTCTTGCCTGG + Intergenic
1006548920 6:34804208-34804230 CTCTTCCTGGATGTCTGGGCTGG + Intronic
1006991051 6:38215108-38215130 CTCTTTCTGATTCTATTGTCAGG + Intronic
1008250064 6:49228879-49228901 TTCTTTGTTGATTTTTTGTCTGG + Intergenic
1008458821 6:51743681-51743703 TTCTTTTTAGATTTCTTTTCTGG - Intronic
1009605686 6:65864424-65864446 CTCCTTCAGGAGTTCTTGTAAGG + Intergenic
1009727662 6:67556523-67556545 CTCCTTCTGGAGCTCTTGTACGG + Intergenic
1009781869 6:68281720-68281742 TTCTTTGTTGATTTTTTGTCTGG - Intergenic
1010481287 6:76357278-76357300 CCCTTCCTGGATTTCCTGTGGGG + Intergenic
1010975563 6:82309570-82309592 CTCTTTGTTGATTTTCTGTCTGG + Intergenic
1011487644 6:87859437-87859459 CTCTTTCTGGAATGGTTGTTTGG - Intergenic
1011518718 6:88180951-88180973 CTCTTCCTGGATTTCTCCTGAGG - Intergenic
1011871397 6:91898322-91898344 CTCTTTCTTGTTTTCTCTTCTGG - Intergenic
1013144573 6:107375702-107375724 CTCTTTCTGGTTTTAGTCTCAGG - Intronic
1013485570 6:110593332-110593354 CTATCTCTGGATTTCCTTTCTGG - Intergenic
1013565329 6:111353706-111353728 ATCTTTCTGGACTTCCTTTCTGG - Intronic
1013571626 6:111432644-111432666 TTCTTTCTTGATTTTCTGTCTGG - Intronic
1014583319 6:123164788-123164810 TTCTTTGTTGATTTCCTGTCTGG - Intergenic
1015538531 6:134291412-134291434 CTCTCTTTGGATTTCTCGTAAGG - Intronic
1015871927 6:137784482-137784504 CTCTCTCTCGATCTCTTTTCAGG - Intergenic
1016460698 6:144278073-144278095 CACTATGTGGATTTCTTCTCTGG - Intergenic
1016476038 6:144429598-144429620 ATAATTATGGATTTCTTGTCAGG - Exonic
1017050477 6:150388600-150388622 CTTTTTCTAGATTTATAGTCTGG + Intronic
1017397916 6:154025067-154025089 CTCTTTGTTGATTTTCTGTCTGG + Intronic
1017677522 6:156829076-156829098 GTCTTGCTGGATGTTTTGTCAGG + Intronic
1017829672 6:158115046-158115068 CTTTTTATGTATTTCTTGTTTGG - Intronic
1018458852 6:163978089-163978111 TTCTTGCTGGGTTTCTTGCCGGG + Intergenic
1020478358 7:8626091-8626113 TTCTTTCTGCATTTCTTCTAAGG + Intronic
1020565063 7:9785250-9785272 CTATTTTAGGTTTTCTTGTCAGG - Intergenic
1020771463 7:12400733-12400755 ATATTTCTGGCTTTCCTGTCGGG - Intronic
1020992046 7:15210450-15210472 CACTTTCTGGATTTGTTATTTGG + Intronic
1021130739 7:16910349-16910371 TTCTTTGTTGATTTTTTGTCTGG + Intergenic
1021398324 7:20178980-20179002 CTTTCTCTGGATTTTTTTTCTGG + Intronic
1021544102 7:21793719-21793741 TTCTTTGTTGATTTCATGTCTGG + Intronic
1021767584 7:23965148-23965170 TTCTTTTTTGATTTATTGTCTGG + Intergenic
1021769825 7:23987282-23987304 CTCTTTTTGTATTTCTTCTAGGG - Intergenic
1022045058 7:26616249-26616271 GTCTTTCTGGACTTCTTTTATGG - Intergenic
1022079559 7:27006605-27006627 TTCCTTCAGGAGTTCTTGTCGGG + Intergenic
1022869336 7:34459187-34459209 TTCTTTCTGGAGCTCTTGTAGGG - Intergenic
1022870943 7:34479002-34479024 CTCTTTCTGAATTTCCTTTTGGG - Intergenic
1023110402 7:36805336-36805358 TTCTTTCTGGATATTTTGCCTGG + Intergenic
1023369737 7:39501179-39501201 AAGTTTCTGGATTTCTTATCTGG - Intergenic
1023621405 7:42077097-42077119 CTCTTTCTTGCTTTCGTGTCTGG - Intronic
1024581137 7:50802040-50802062 CACTTTTTGGATATATTGTCTGG - Intergenic
1024733611 7:52278655-52278677 CTGTTTCTTGATTTCTTTCCAGG - Intergenic
1025533620 7:61920766-61920788 TTCTTTCTAGTTTTCCTGTCGGG - Intergenic
1025807611 7:64849946-64849968 CCCTTTCCGAATTTCTGGTCAGG + Intergenic
1026894777 7:74003638-74003660 CTCTCAATGGCTTTCTTGTCTGG - Intergenic
1028329859 7:89576717-89576739 CTCTTTCAGGAGCTCTTGTAAGG - Intergenic
1028393836 7:90346007-90346029 CTCTCTCTTGATTACTTTTCAGG - Intronic
1029122434 7:98277938-98277960 CTCTTGCTGGATTTTTTGTTTGG - Intronic
1029686828 7:102154292-102154314 CTCTTTCTGGAATTCCTATTAGG - Intronic
1030453047 7:109736830-109736852 CTCTTTCTGGTTTTCTCATGTGG - Intergenic
1030930026 7:115511286-115511308 CTCTTTCTATATTTCTTATTTGG - Intergenic
1031151666 7:118061160-118061182 CAGTTTTTGGATTTCTTGTTTGG - Intergenic
1032658164 7:133954445-133954467 CTTTTTATTGATTTCTTTTCTGG + Intronic
1033556131 7:142489793-142489815 ATCTGTCTGGATTTGTTGTGGGG - Intergenic
1033857249 7:145578381-145578403 CTATTGATGGATTTCTTGGCTGG + Intergenic
1034060949 7:148088825-148088847 CTTTTTCTGGCTTTGTTATCAGG - Intronic
1034325665 7:150229860-150229882 CTCTTTCTGTTTTTATTATCTGG + Intergenic
1034581398 7:152046349-152046371 ATCTTTGTTGATTTTTTGTCTGG + Intronic
1034752725 7:153586159-153586181 TTCTTTGTGGATTTCTGCTCAGG - Intergenic
1034767536 7:153739398-153739420 CTCTTTCTGTTTTTATTATCTGG - Intergenic
1037212164 8:16402947-16402969 CTCTTTTTCTATTTTTTGTCTGG - Intronic
1038310036 8:26439388-26439410 CTCTTCCTGGCTTTCTGATCTGG + Intronic
1038519219 8:28215497-28215519 CTCTTGCAGGATTTCTTGCCAGG - Intergenic
1039150629 8:34501171-34501193 CTATATCTGGTTTTCATGTCGGG + Intergenic
1042072497 8:64950996-64951018 CTATCTGTGGATTTCTTGGCAGG + Intergenic
1042778288 8:72460291-72460313 CTGCTTCTGGATTTCTGATCTGG + Intergenic
1043235981 8:77867528-77867550 CTCTTCCTGGTTTTGTTATCAGG - Intergenic
1043869962 8:85421321-85421343 CTCTGTCAGGATTTGATGTCAGG + Intronic
1043946089 8:86254289-86254311 CTCTTTCCTGATTTCTTGGAAGG - Intronic
1044127907 8:88481164-88481186 TTCTTTCTGGAACTCTTGTGAGG - Intergenic
1045015850 8:98001289-98001311 CTCTTTCTGTCTTTCTATTCTGG + Intronic
1045823587 8:106370873-106370895 CTCTTTCTGGGTTTGGTATCAGG + Intronic
1045841234 8:106584272-106584294 CTCTTTCTGGAGATCCTGTTTGG - Intronic
1046695932 8:117339598-117339620 ATCCTTTTGGATTTCCTGTCAGG + Intergenic
1047220121 8:122912012-122912034 CTCTTTCTCCTTTTCTTATCTGG - Intronic
1047831619 8:128637905-128637927 CTCTTTGAGTATTTCTTGTAGGG + Intergenic
1048666716 8:136670333-136670355 CTCTTTCCAGACTTCTTATCTGG - Intergenic
1048721580 8:137331655-137331677 CTCTTCCTGAGTTTCTTATCCGG - Intergenic
1050234168 9:3561026-3561048 TTCCTTCTGGATCTCTTGTAAGG + Intergenic
1050356585 9:4789310-4789332 CACTTTCTTGATTTCTTTTTTGG - Intergenic
1051073254 9:13199286-13199308 CACTTTCTTGATTTCTTTTTTGG + Intronic
1052132624 9:24867796-24867818 CAATTTCTGGAGTTCTTGACAGG + Intergenic
1052600311 9:30619415-30619437 CTTTTTCTGGCTTTGTTATCAGG + Intergenic
1053592340 9:39526854-39526876 CCCTCTCTGGATTTCTTTCCTGG + Intergenic
1053850188 9:42282192-42282214 CCCTCTCTGGATTTCTTTCCTGG + Intergenic
1054573961 9:66838425-66838447 CCCTCTCTGGATTTCTTTCCTGG - Intergenic
1054825834 9:69572602-69572624 ATCTTTCTAGACCTCTTGTCTGG + Intronic
1055886226 9:81066600-81066622 TTCTTTGTGGATTTCCTGTCTGG + Intergenic
1056148019 9:83754121-83754143 CTCTTTCTGGATTTCTTTTCTGG - Intronic
1056769877 9:89469442-89469464 CTTTTTCTGGATTTGCTATCAGG - Intronic
1057022007 9:91706715-91706737 CTCTTGCTGGATTCCTTGGTGGG + Intronic
1057074288 9:92127777-92127799 CTTTTTCTGGTTTTGTTATCAGG + Intergenic
1057085001 9:92201873-92201895 CTTTTTCTGGTTTTGTTATCAGG - Intergenic
1057430280 9:94987738-94987760 CCCTTTCTGTTTTTCTTGTTGGG + Intronic
1057628186 9:96697310-96697332 CTCTGTCTGGATTTGGTATCAGG - Intergenic
1057909055 9:99004195-99004217 ATCTTTCTGGAATTCTAATCTGG - Intronic
1058792221 9:108460030-108460052 TTCCTTATGGATTTTTTGTCTGG - Intergenic
1059132684 9:111770583-111770605 CTCTTTGTTGATTTTCTGTCTGG + Intronic
1060192807 9:121603811-121603833 CTCTGTCTGCATTTCCTGTCTGG + Intronic
1061038375 9:128125903-128125925 CTCTTTCTTGTTTTTTTCTCTGG + Intronic
1061496638 9:130978576-130978598 CCCTGTCTGGATTCCTTGGCTGG + Intergenic
1062114371 9:134800044-134800066 CTCTTTCTGGAAGGCTTGTCTGG - Intronic
1185655722 X:1683809-1683831 TTCCTTCTCGATTTCTTTTCTGG + Intergenic
1186559921 X:10600538-10600560 CACTTTCTGGGTTTATTTTCAGG - Intronic
1186911364 X:14170923-14170945 TTCTTTGTTGATTTTTTGTCTGG + Intergenic
1187490443 X:19746427-19746449 CTCTTTCTTTATTTCCTGTGAGG + Exonic
1187623834 X:21088817-21088839 ATCTTTGTCGATTTTTTGTCTGG - Intergenic
1187836928 X:23441180-23441202 TTCTTTCTAGATTTTCTGTCTGG - Intergenic
1188668549 X:32854848-32854870 ATCTGTCTGGTTTTCGTGTCAGG - Intronic
1191050896 X:56190422-56190444 TTCTTTGTTGATTTCCTGTCTGG - Intergenic
1191138718 X:57093542-57093564 ATCTTTCTGAATTCCTTTTCAGG - Intergenic
1191198904 X:57756539-57756561 CTTTTTCTGGTTTTGGTGTCAGG - Intergenic
1191656467 X:63604181-63604203 ATCTTTCTGGTTTTCTTATAAGG - Intergenic
1191664792 X:63689590-63689612 TTCTTTGTTGATATCTTGTCTGG - Intronic
1192042861 X:67641612-67641634 CTCTTGCTGGCTTTCTAGTTAGG + Intronic
1192073703 X:67967942-67967964 TTCTTTGTTGATTTCCTGTCTGG - Intergenic
1192521550 X:71805606-71805628 TTCTTTGTTGATTTCCTGTCTGG - Intergenic
1192958604 X:76102482-76102504 CTCTTTGTTGATTTTCTGTCTGG + Intergenic
1193194525 X:78615743-78615765 CTTTTTCTGGTTTTGGTGTCAGG + Intergenic
1193571868 X:83153641-83153663 CTCCTTCTGGAGCTCTTGTAAGG - Intergenic
1193922028 X:87440431-87440453 CTCTTTGTTGATTTTCTGTCTGG + Intergenic
1193985051 X:88229851-88229873 TTCTTTATGGATTTTCTGTCTGG - Intergenic
1194356690 X:92894450-92894472 CTCTTTATTGATCTCTTGTAAGG + Intergenic
1194439123 X:93908131-93908153 TTCTTTATTGATTTCCTGTCCGG + Intergenic
1194492036 X:94563095-94563117 CTTTTTCTGGTTTTGGTGTCAGG + Intergenic
1194492122 X:94564967-94564989 CTTTTTCTGGTTTTGGTGTCAGG + Intergenic
1194559191 X:95399464-95399486 TTCTTTGTGGATTTTTTGCCTGG - Intergenic
1194713710 X:97265951-97265973 CTCTTTCTCGGTTTCTTGCAAGG + Intronic
1195341361 X:103909613-103909635 CTCTTTCTAGATTTCCTAACAGG + Intergenic
1195539860 X:106050959-106050981 TGCTTTCTTGATTTCTTTTCTGG - Intergenic
1195601513 X:106754043-106754065 TTCTTTGTGGATTTTCTGTCCGG - Intronic
1196004786 X:110824018-110824040 CTCTTTCACAATTTCTTGCCTGG + Intergenic
1196554691 X:117072499-117072521 TTCTTTCAGGATTTCTCGTAAGG - Intergenic
1197027927 X:121777868-121777890 CTCCTTTTGTATTTCTTGTAGGG + Intergenic
1197356929 X:125446441-125446463 TTCTTTCTGGAGTTCTTGCAAGG - Intergenic
1197487378 X:127070130-127070152 CTCTTTCTATAGTTTTTGTCTGG + Intergenic
1197672146 X:129289211-129289233 TTCTTTGTGGATTTTCTGTCTGG - Intergenic
1198027435 X:132721022-132721044 CTCTTTCTTGGTTTTCTGTCTGG - Intronic
1199032533 X:143017148-143017170 TTCTTTGTTGATTTTTTGTCTGG - Intergenic
1199113563 X:143962374-143962396 CTCTGTCAGGTTTTCATGTCAGG + Intergenic
1199921314 X:152406697-152406719 TTCTTTCTTGATTTTCTGTCTGG - Intronic
1200512262 Y:4094767-4094789 CTTTTTCTGGTTTTCATATCAGG - Intergenic
1200665022 Y:6011450-6011472 CTCTTTATTGATCTCTTGTAAGG + Intergenic
1201183865 Y:11378314-11378336 CTCTTTCTGTATTTTTTTTTGGG - Intergenic
1201752074 Y:17443953-17443975 CTCTTTCAGGAGCTCTTGTAAGG + Intergenic
1201889764 Y:18929419-18929441 CTCTTTGTAGAATTTTTGTCAGG - Intergenic
1202173390 Y:22074667-22074689 CTTTTTCTGTGTTTCGTGTCTGG - Intronic
1202217970 Y:22511707-22511729 CTTTTTCTGTGTTTCGTGTCTGG + Intronic
1202279508 Y:23166326-23166348 TTCTTTCTTGATTTTTTGTGTGG - Intronic
1202284924 Y:23230505-23230527 TTCTTTCTTGATTTTTTGTGTGG + Intronic
1202325215 Y:23684352-23684374 CTTTTTCTGTGTTTCGTGTCTGG - Intergenic
1202432640 Y:24802398-24802420 TTCTTTCTTGATTTTTTGTGTGG - Intronic
1202437327 Y:24855740-24855762 TTCTTTCTTGATTTTTTGTGTGG + Intronic
1202545556 Y:25985702-25985724 CTTTTTCTGTGTTTCGTGTCTGG + Intergenic