ID: 1172105172

View in Genome Browser
Species Human (GRCh38)
Location 20:32512755-32512777
Sequence CTTTGTAAGTAGAATTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 439}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172105171_1172105172 0 Left 1172105171 20:32512732-32512754 CCAACATCAAGAATCTTATTTTG 0: 1
1: 0
2: 2
3: 29
4: 330
Right 1172105172 20:32512755-32512777 CTTTGTAAGTAGAATTTTTATGG 0: 1
1: 0
2: 6
3: 41
4: 439
1172105169_1172105172 2 Left 1172105169 20:32512730-32512752 CCCCAACATCAAGAATCTTATTT 0: 1
1: 0
2: 2
3: 37
4: 313
Right 1172105172 20:32512755-32512777 CTTTGTAAGTAGAATTTTTATGG 0: 1
1: 0
2: 6
3: 41
4: 439
1172105170_1172105172 1 Left 1172105170 20:32512731-32512753 CCCAACATCAAGAATCTTATTTT 0: 1
1: 0
2: 1
3: 51
4: 491
Right 1172105172 20:32512755-32512777 CTTTGTAAGTAGAATTTTTATGG 0: 1
1: 0
2: 6
3: 41
4: 439
1172105168_1172105172 28 Left 1172105168 20:32512704-32512726 CCTTAACATTTTGTCATAGGTAT 0: 1
1: 0
2: 4
3: 19
4: 227
Right 1172105172 20:32512755-32512777 CTTTGTAAGTAGAATTTTTATGG 0: 1
1: 0
2: 6
3: 41
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172105172 Original CRISPR CTTTGTAAGTAGAATTTTTA TGG Intronic
900583505 1:3421103-3421125 CTTTTTTAGTTGTATTTTTACGG + Intronic
900894166 1:5471490-5471512 TCTTTTAAGTATAATTTTTATGG + Intergenic
902264714 1:15254771-15254793 CTTTGTGAATAGACTTTTAATGG + Intronic
903581763 1:24376350-24376372 CTTGGGAAGTAGAATTATAAGGG + Intronic
904544227 1:31255868-31255890 TTTTGTGGGTTGAATTTTTAGGG - Intergenic
906754266 1:48293711-48293733 CTTAGTAAGTGGAATTTCTAAGG + Intergenic
906863317 1:49386355-49386377 CTTTGCAATTACAATTTTAATGG - Intronic
907171326 1:52468344-52468366 AACTGTAAGTAAAATTTTTAGGG - Intronic
907882766 1:58566444-58566466 CTTTGTAAGCTGATTTTTCAGGG - Intergenic
908103928 1:60820877-60820899 CTTTGTATGTAGAATAATTTTGG - Intergenic
908478233 1:64510075-64510097 CTTTTTAAGGAAAATTTTAATGG + Intronic
909819294 1:80040452-80040474 CTTAGAAACTAGAATTTTGAGGG - Intergenic
911022103 1:93399424-93399446 TTTTTTAAGGAGAATTTCTAAGG + Intergenic
911583631 1:99664345-99664367 ACTGGTAAGTAGAATTTATATGG + Intronic
915873084 1:159582641-159582663 CTTTGTATTTTGAAGTTTTAGGG + Intergenic
916906941 1:169296248-169296270 CTTTGTAAGGTGAATGTTGATGG - Intronic
917249484 1:173042286-173042308 CTTTGAATGTAAAATTTTTTAGG + Intronic
918946209 1:191069078-191069100 CTTTGTAGGTACAGTTTTTATGG - Intergenic
919032288 1:192258159-192258181 CTTTTTAAGAATAATTTTGAGGG - Intergenic
919388577 1:196953356-196953378 CTTTGAAGGTAGAATTTGCAGGG - Intronic
919417384 1:197328468-197328490 CTTTGCATGTAGAATTGTTTTGG - Exonic
919496696 1:198281112-198281134 TCTTCTAAGTAGGATTTTTATGG - Intronic
921020519 1:211230788-211230810 TTTTTTAAATAAAATTTTTATGG - Intergenic
921534670 1:216331281-216331303 TTTTCAAAGAAGAATTTTTATGG - Intronic
922425845 1:225491974-225491996 ATTTGTATATAGAACTTTTACGG + Exonic
923303206 1:232662730-232662752 CTTTGTAAGTAAAATTTCACAGG - Intergenic
924046896 1:240041082-240041104 CTTTCTCAGAAGAATTTTTAGGG + Intronic
924166176 1:241285543-241285565 CTTTTAAAGTAGTATTATTAAGG + Intronic
924377190 1:243424098-243424120 CTTTTTAATTGGAATTTTGATGG + Intronic
1062871612 10:909463-909485 TTTTGTAAGTAACAATTTTAGGG - Intronic
1063693587 10:8311136-8311158 GTTGGTGAGTAGAATTTCTATGG - Intergenic
1063839893 10:10059084-10059106 GTTTGGAATTAGACTTTTTAAGG - Intergenic
1064546837 10:16459033-16459055 CTCTGGGGGTAGAATTTTTAAGG - Intronic
1064847797 10:19675352-19675374 CTTTGTAAGTAGTAAATTCACGG - Intronic
1064955683 10:20906097-20906119 CTTTGGAAGAAAAATATTTAAGG + Intronic
1065451232 10:25859943-25859965 CTTTTTTGGTGGAATTTTTATGG - Intergenic
1067275314 10:44828555-44828577 CTCTGTAAGTAGGATATTAAGGG + Intergenic
1067281617 10:44877570-44877592 CTTTGTTACTATAATTATTATGG + Intergenic
1067733052 10:48827368-48827390 CTTTTTAACTAGCATTTTTATGG - Intronic
1068496973 10:57795222-57795244 CTTGGCAAGTAAAATTTTGATGG + Intergenic
1068663608 10:59648958-59648980 CTTTGTAAATTGAATTGCTATGG - Intergenic
1069585384 10:69597333-69597355 TTTTGTTATTAGAATTTTTCTGG + Intergenic
1070042924 10:72799631-72799653 TTTTGTAAACAGAATTTTTGGGG + Intronic
1070273449 10:74981118-74981140 CTTATTAAGTTGATTTTTTAGGG + Intronic
1071056353 10:81514078-81514100 CTTTTTAAATATAGTTTTTAGGG - Intergenic
1071057765 10:81530806-81530828 TTTTGTAAGCATAATTTTAAAGG - Intergenic
1071132967 10:82417111-82417133 ATTTGTAAGTGGATTTTTTGTGG - Intronic
1071366249 10:84903376-84903398 TTGTGTGAGTGGAATTTTTAGGG + Intergenic
1071866034 10:89732796-89732818 ATTTGAAAATAAAATTTTTATGG + Intronic
1071960186 10:90802641-90802663 CTCTTTAAAGAGAATTTTTAAGG - Intronic
1072282494 10:93880063-93880085 TTTTGTTAGTAGTATGTTTATGG - Intergenic
1072477843 10:95780570-95780592 CATTGTAAATAGAATATCTATGG + Intronic
1072512551 10:96142284-96142306 CTTTGAAAGTAATATTCTTAGGG + Intronic
1073601882 10:104853905-104853927 TTTTATAAGTGGTATTTTTATGG - Intronic
1073937953 10:108657523-108657545 CTGTGTATGTAGAAATTTTATGG + Intergenic
1074292814 10:112153232-112153254 CATTTTAAGTACAACTTTTAAGG - Exonic
1074320366 10:112396461-112396483 CTTTGTAAGTAAACTTTTATCGG - Intronic
1074406882 10:113187513-113187535 CTTTGAAAGGAGCATTTGTATGG - Intergenic
1074937300 10:118194478-118194500 CTTTATAAATAGAATTTATATGG + Intergenic
1075637594 10:124040077-124040099 CATTGTGAGTAGAATTTTCAAGG - Intronic
1076895854 10:133311448-133311470 TTTTGAAAATAGTATTTTTATGG - Intronic
1077989927 11:7397158-7397180 CTTTGTATGAAGGATTTTAATGG - Intronic
1078505394 11:11937331-11937353 TTTTGTAAGTTCAACTTTTAGGG - Intronic
1079908228 11:26276284-26276306 CTTCCTAATCAGAATTTTTAAGG - Intergenic
1080219173 11:29880396-29880418 TTTAGTCAGGAGAATTTTTAAGG - Intergenic
1080520987 11:33067724-33067746 CTTTGTATGTAGAATTACTGGGG - Intronic
1081124285 11:39303532-39303554 CTCTGTAAATAGAATCTTTCTGG - Intergenic
1081486222 11:43531644-43531666 ATTTGGAAATAGGATTTTTACGG + Intergenic
1081548227 11:44087780-44087802 GTTTTTAAGTAGAATTTCCATGG + Intergenic
1082055612 11:47813443-47813465 TTTTGTCAGTAAAATTTTAAAGG + Intronic
1082986284 11:59173111-59173133 CTTTCTATGTAGAAATTCTAGGG + Intronic
1084724216 11:70930087-70930109 CTTTGTAAATAAAAATTTTCTGG - Intronic
1084995532 11:72973814-72973836 CTTTGTAAGTAAAGTTTTACTGG + Intronic
1086192009 11:84091177-84091199 CTTTTTAAATAGAACTTTTCGGG - Intronic
1087751151 11:102008673-102008695 CTTTGAAAATATAATTTTAATGG - Intergenic
1087805054 11:102546476-102546498 CTTTGTTGGTCTAATTTTTAGGG + Intergenic
1087842014 11:102930369-102930391 CTTTGGAATTAGGATCTTTAAGG - Intergenic
1088951691 11:114578082-114578104 CTTTGTAGTTAGAACTTTTGAGG + Intronic
1090549221 11:127801292-127801314 TTTTGTAAATACAATTTTTGTGG - Intergenic
1092584561 12:9884653-9884675 ATTTGTATGTATAATTTATATGG + Intronic
1092858483 12:12697399-12697421 CTTTTTAAAAAGTATTTTTATGG + Intergenic
1093568640 12:20639429-20639451 CTTGCTAAGTAGAACTTTTTGGG + Intronic
1093836105 12:23830745-23830767 CTTTTTAATTACTATTTTTATGG - Intronic
1094196464 12:27754863-27754885 CTTTGTAAGTACAGATTGTAAGG + Intronic
1094220587 12:27988567-27988589 CTTTGTAAATATATTTTCTAAGG + Intergenic
1094407500 12:30133303-30133325 CTTTGGAGGTTAAATTTTTAAGG + Intergenic
1095767435 12:45912489-45912511 CTTTGTAATTAGATTTTGTTTGG + Intergenic
1096664904 12:53157981-53158003 CTTTGTAAACAAAATTTTAATGG + Exonic
1096962504 12:55594218-55594240 CCTTGTAAGTTGGATTTCTAAGG - Intergenic
1097983935 12:65762992-65763014 CTTTGTAAATAGAATTTTAATGG + Intergenic
1098811753 12:75103298-75103320 TTTGTTAAGTAGAATTGTTAAGG + Intronic
1098996973 12:77131921-77131943 ATTTGTTGGTAGAATTTTTTTGG + Intergenic
1099482575 12:83187623-83187645 CTTGTTAGGTAGAATTTGTAAGG - Intergenic
1099688391 12:85919402-85919424 TGTTTTAAGTAGAATCTTTAGGG + Intergenic
1100685204 12:96979918-96979940 CTTTGTAATTAAAATTCTTCTGG + Intergenic
1100860629 12:98802298-98802320 TTTCTTAAGGAGAATTTTTAAGG + Intronic
1100902483 12:99258340-99258362 CTTTATAAATATACTTTTTAGGG - Intronic
1100902953 12:99264008-99264030 AATTGTATATAGAATTTTTAGGG - Intronic
1100918195 12:99452206-99452228 TTTTGTAAGTAAAATTTTCTTGG - Intronic
1100997183 12:100314344-100314366 TTTTATAATTAGAATTTCTAAGG + Intronic
1101106939 12:101449863-101449885 GTTTTTGACTAGAATTTTTATGG + Intergenic
1102971065 12:117167172-117167194 TATTGTAAGTAGAAATGTTATGG - Intronic
1103155504 12:118681088-118681110 CTTTGAAAGTAAAATATTTGGGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106352862 13:28951049-28951071 ATTTTTAAGTGGAGTTTTTAGGG - Intronic
1106879244 13:34111415-34111437 CTTTGTAATTAAAAATATTATGG + Intergenic
1107386208 13:39912413-39912435 CTATTGAAGTAGAAATTTTAGGG - Intergenic
1108267079 13:48722548-48722570 CTCTATCAGTGGAATTTTTAAGG + Intergenic
1108744258 13:53374831-53374853 TTTTGTAAGTAGATATTTTCTGG + Intergenic
1108764888 13:53615237-53615259 ATTTCTAAGAAGAATTTTAATGG - Intergenic
1108943455 13:55988599-55988621 TTTTGTAAATGGTATTTTTAAGG - Intergenic
1109338170 13:61019317-61019339 CTTTTTAAGCAGAATTATTTAGG - Intergenic
1109578322 13:64291656-64291678 CTTTGTAAGAAGGAATTTTTAGG + Intergenic
1109669074 13:65581697-65581719 CTTTAATAGTTGAATTTTTAAGG - Intergenic
1110055366 13:70963387-70963409 CATTGTAAGGAGAATCTTCAGGG - Intergenic
1110239320 13:73249297-73249319 CTTTGAAAGTAGAATAGTCAGGG + Intergenic
1110580575 13:77119045-77119067 CTTTTAAAGTAGAATTTCTTTGG - Intronic
1110685615 13:78370009-78370031 CTCTGTAACCTGAATTTTTAGGG + Intergenic
1110717891 13:78728699-78728721 CACTGAAATTAGAATTTTTAGGG - Intergenic
1111334103 13:86799354-86799376 CTTTTTAAGTCGAATTCTTCAGG - Intergenic
1111358097 13:87137616-87137638 GTGGGTAAATAGAATTTTTAAGG + Intergenic
1111660947 13:91210910-91210932 CTTTGTAATTGGAATTTTCAGGG - Intergenic
1111774214 13:92638980-92639002 ATTTATATGTAGAATTTATATGG - Intronic
1112059344 13:95721945-95721967 CTTTAGGAGTAGAACTTTTAGGG + Intronic
1112084370 13:96014945-96014967 CTTTGAAGGAAGAATTTTTCAGG - Intronic
1112276062 13:98020949-98020971 CTTAGTAAGTGAAATTTATAAGG - Intronic
1112380962 13:98889661-98889683 CTTGGTGAGTAGAAGTTTCAGGG - Intronic
1112527189 13:100161344-100161366 CTTTGTAAGTGAGATTCTTAAGG - Intronic
1112662532 13:101527991-101528013 CTTTGAAGGTAAAATGTTTATGG + Intronic
1112773329 13:102816311-102816333 CTTTCTCAGCAGAATTATTAAGG + Intronic
1113139513 13:107131423-107131445 GTTTGATAGTAGAATGTTTAGGG + Intergenic
1114797124 14:25728808-25728830 CCTTGTAAGTTGAATTCATAGGG + Intergenic
1115155838 14:30337834-30337856 CTTTGAAAGTAAATTTTTGAAGG - Intergenic
1116014548 14:39390541-39390563 CATTGTCACTAGAATTTTTCTGG - Intergenic
1116154248 14:41183737-41183759 CTTTGGAAGTGGAATTTTCTCGG - Intergenic
1116282824 14:42930115-42930137 CTTTGCAAGGAAGATTTTTAAGG - Intergenic
1116355929 14:43930007-43930029 CTTTGGAAAGATAATTTTTATGG - Intergenic
1116588815 14:46744983-46745005 CTTTTTAAGTAAGCTTTTTAAGG - Intergenic
1119694490 14:76701809-76701831 CTTTGTAAAAAGAATATTTAAGG - Intergenic
1121082406 14:91118943-91118965 CTTTTTAGGTAGACTTTTTAGGG - Intronic
1122183971 14:99975340-99975362 ATTTATAATTAGAGTTTTTAGGG + Intronic
1123124207 14:105933584-105933606 CTGTTTAAGTAGAATTTCTCAGG + Intergenic
1124322063 15:28721465-28721487 CTTTCTAAGTAAAAGTTTAATGG + Intronic
1124492417 15:30166231-30166253 TTTTGTAAGTAAAATTTTGTTGG + Intergenic
1124523163 15:30423307-30423329 CTTTCTAAGTAAAAGTTTAATGG + Intergenic
1124535503 15:30542909-30542931 CTTTCTAAGTAAAAGTTTAATGG - Intergenic
1124751118 15:32372086-32372108 TTTTGTAAGTAAAATTTTGTTGG - Intergenic
1124763151 15:32464687-32464709 CTTTCTAAGTAAAAGTTTAATGG + Intergenic
1124775476 15:32584372-32584394 CTTTCTAAGTAAAAGTTTAATGG - Intergenic
1126059340 15:44764641-44764663 CTTTGTAAGTAAAGTTTTATTGG - Intronic
1126138572 15:45416920-45416942 CTTTTTAAGTAGCCTGTTTAAGG + Intronic
1126228423 15:46297527-46297549 CTTTGTTCTTAGAAGTTTTAGGG + Intergenic
1126256950 15:46638908-46638930 CTTTATAATTATAATTTTAATGG + Intergenic
1127253498 15:57267650-57267672 TTTTGTAAGTAAAATTTTATTGG - Intronic
1127356844 15:58208754-58208776 CTATGTCAGTAAAATTTCTACGG + Intronic
1127940627 15:63691933-63691955 CTATGTAAGCAGACATTTTAGGG + Intronic
1129204829 15:74030803-74030825 TTTTTTAACTATAATTTTTATGG + Intronic
1130785649 15:87093014-87093036 CTTTGTAATTTGAAGTTTAATGG + Intergenic
1132031359 15:98440851-98440873 CTTTGTAATTAGATTTTTTATGG - Intronic
1132060541 15:98688784-98688806 CTTTGTAAGTGTATTTTTTTTGG + Intronic
1132758754 16:1498896-1498918 TTTTGTAAATAAAATTTTTTTGG + Intronic
1134163214 16:11909207-11909229 CTTTGAAAGTAGAATTATGATGG + Intronic
1134353275 16:13457881-13457903 CTTTGGAAGAATTATTTTTAAGG - Intergenic
1135794469 16:25427903-25427925 TTTTATAAGTAGCATTTTTTGGG + Intergenic
1137051064 16:35713492-35713514 CTCTGTAATTAGAATTATTTGGG + Intergenic
1138425142 16:56926774-56926796 CTTTATACGCAGAATTTGTATGG - Intergenic
1138760864 16:59542622-59542644 CTGTCTAAATGGAATTTTTAGGG + Intergenic
1138986780 16:62338588-62338610 CTTCATAAGTAGAATGTGTAGGG - Intergenic
1139451634 16:67032017-67032039 CTTTGAAAGCTGAATTTTTTTGG + Intronic
1140788567 16:78367584-78367606 TTTTGTAAGTAAAGTATTTACGG + Intronic
1140938610 16:79699595-79699617 ATTTCTAAGTAAAATGTTTAGGG + Intergenic
1142792010 17:2274077-2274099 CTTTGTAAATAAAGTTTTAATGG + Intronic
1142845243 17:2669702-2669724 ATTTGTATGTAGAATATTTGAGG - Intronic
1143341471 17:6214643-6214665 CTTTTAAATTAAAATTTTTAGGG + Intergenic
1144186551 17:12801975-12801997 ATTTGTACTTAGACTTTTTAGGG - Intronic
1144243941 17:13344552-13344574 ATTTGTATGTAGAATGTTTATGG + Intergenic
1144277291 17:13685311-13685333 TTTTGTAATTAGTGTTTTTAGGG + Intergenic
1146359772 17:32164562-32164584 CTCAGTAAGTATTATTTTTAAGG - Intronic
1149707183 17:58705631-58705653 CCTTGTAAGAAGAAATATTAGGG - Intronic
1151125102 17:71836379-71836401 CATTGTCAGTAGAATTTATAAGG - Intergenic
1152035341 17:77868824-77868846 CTATTTAAGAAGAACTTTTAGGG - Intergenic
1152396091 17:80034545-80034567 TTTTGTAAGTGGCATGTTTATGG - Intronic
1153167123 18:2274664-2274686 CTTTGTAAATATAATTTTTCTGG - Intergenic
1154110218 18:11561445-11561467 CATTGTAACTGGAGTTTTTAGGG - Intergenic
1154936718 18:21066348-21066370 CTATGTAAGTTAATTTTTTAAGG - Intronic
1155314187 18:24555211-24555233 ATTTGTAATTGGAATTTTTTGGG + Intergenic
1156133069 18:34002192-34002214 ATTTATAAGTATAATTTATAAGG + Intronic
1158320794 18:56260717-56260739 TTTTGTCAGTATAATTTTTTTGG - Intergenic
1158745256 18:60192488-60192510 CAGTGTCAGTAGAAATTTTAGGG - Intergenic
1158752979 18:60287152-60287174 GTTTGTAAGTACAAATTTTTTGG + Intergenic
1159152271 18:64535480-64535502 CTATGTCAGTAAAATTTCTAGGG - Intergenic
1159524082 18:69565991-69566013 GTTTGTAAGTAAAATTTTGATGG + Intronic
1159527440 18:69611076-69611098 TTTTGTAATTTTAATTTTTATGG - Intronic
1159724596 18:71940514-71940536 CATTGCAAATAAAATTTTTATGG + Intergenic
1159773540 18:72577088-72577110 CTTTGTACATATAATTTTTAAGG - Intronic
1162240533 19:9349729-9349751 ATTTGTACCTAGAATTTATAGGG - Intronic
1162527791 19:11216713-11216735 CTTTGTGAATAGAATTTGGAAGG - Intronic
1166441589 19:42820024-42820046 ATTATTAAGTAGATTTTTTAAGG - Intronic
1166478311 19:43148296-43148318 ATTATTAAGTAGATTTTTTAAGG - Intronic
925486979 2:4346159-4346181 CTTTCCAAGTAGACTTATTAAGG + Intergenic
926550244 2:14292900-14292922 CCTTGTAAGCAGCATTTTTAAGG - Intergenic
926981259 2:18572331-18572353 CTTTTTATATAGAAATTTTATGG - Intronic
928250650 2:29675250-29675272 TTTTGTAATTAAATTTTTTATGG + Intronic
928406883 2:31021612-31021634 TTTTATAAATAGAAGTTTTATGG + Intronic
928893672 2:36236390-36236412 TCTTCTAAGTAGAATTTTTTAGG + Intergenic
929479535 2:42291306-42291328 CTTTATAAGTAGATTTCTTAAGG + Intronic
930312498 2:49758822-49758844 CTTTGCAAGTAGCACTTTCAGGG + Intergenic
930341096 2:50115886-50115908 CTTTTTAAGAAGACTTATTAAGG + Intronic
931412306 2:62044799-62044821 ATTTGTATGTAGAATCTTCAAGG + Intronic
932249273 2:70227315-70227337 CTTTTTAAGTTGAATTGTTAAGG + Intronic
933112239 2:78417569-78417591 CTTTGTAAGCAGACTTCATAAGG + Intergenic
935119721 2:100173761-100173783 GTTTTTAAGTAAAATTATTATGG - Intergenic
937315123 2:120927293-120927315 CTTTGAAAGTAGCTTTTTGAGGG + Intronic
937380363 2:121371168-121371190 CTTTCTAAGTATCATTTTTTGGG + Intronic
937411354 2:121679321-121679343 TTTTGGGAGCAGAATTTTTAAGG - Intergenic
937575857 2:123421254-123421276 GTTCATAAGTAGAATTTTTCAGG - Intergenic
937777300 2:125793636-125793658 CTGTGAATTTAGAATTTTTATGG - Intergenic
939055940 2:137364662-137364684 CCTTGTAAGTTGAATTCCTAGGG - Intronic
939115563 2:138056535-138056557 CTTTGTTAGAAAAATATTTAGGG + Intergenic
939449207 2:142350945-142350967 GTGTGTATGTAGAATCTTTAAGG - Intergenic
939764986 2:146236947-146236969 CTATGTAAAAAGTATTTTTATGG - Intergenic
940251947 2:151688156-151688178 CTTTGTAAGTGGAGCTTTTAAGG - Intronic
940682224 2:156801614-156801636 ACTTGTAAGAAGAATTTTAAGGG - Intergenic
940689449 2:156897013-156897035 CTTGATAAGCAGAATTTGTAAGG + Intergenic
940934831 2:159480095-159480117 CTTGGTAAAAATAATTTTTATGG - Intronic
942925138 2:181422877-181422899 GTTTTTAAGTAGATTTATTAAGG - Intergenic
943148089 2:184071573-184071595 CTTTGGAAGTAAAATTTCTGGGG - Intergenic
943284543 2:185981044-185981066 ATTTGTAAATAAAAATTTTACGG + Intergenic
943567120 2:189529209-189529231 CTTAAAAATTAGAATTTTTAAGG + Intergenic
943610529 2:190028345-190028367 CTTGGTTAGTAGAATTCTTAAGG + Intronic
943722254 2:191217419-191217441 CTTTTTAACTAAAAATTTTAAGG + Intergenic
944344233 2:198641295-198641317 CTTCATAAGTGGAATTTTTTTGG + Intergenic
946661543 2:222006255-222006277 CTATTTAAAGAGAATTTTTATGG + Intergenic
947802206 2:232936711-232936733 CTTCGTGAGTAGAACTTTTCTGG + Intronic
948857675 2:240737644-240737666 CCTTGTAAGAAGAGGTTTTATGG - Intronic
948962172 2:241348053-241348075 ATTTTAAAGTAGAATTTTTTGGG + Intronic
1168809590 20:695965-695987 CTTTGTCAGTTAAATTGTTACGG + Intergenic
1169866907 20:10211397-10211419 CTTTGTGAGTTGTATTGTTAAGG + Intergenic
1170335575 20:15267131-15267153 CTTTGCAGGTAGATTTTTAAGGG - Intronic
1170815897 20:19714089-19714111 CTTTGTAAATAAAATTTTATTGG - Intronic
1170830363 20:19834187-19834209 CTTTATAGGTGGAATATTTAGGG - Intergenic
1170896056 20:20415376-20415398 ATTTGTTAGTAAACTTTTTAAGG - Intronic
1172105172 20:32512755-32512777 CTTTGTAAGTAGAATTTTTATGG + Intronic
1173519416 20:43688141-43688163 CTTAGAAAGTAAAATTTTTAGGG - Intronic
1174654235 20:52156959-52156981 TTTTGTAAGCAGAATTTAGAGGG + Intronic
1174907604 20:54568509-54568531 TTTTGTCAATAGAATTTTTTGGG - Intronic
1174936940 20:54881309-54881331 TTTTGTAAGTAAAATTTTAGTGG + Intergenic
1176670138 21:9726097-9726119 CTTTGTAAGCAGGATACTTATGG + Intergenic
1178886909 21:36491979-36492001 CTTTGGAAATAGAGTCTTTATGG + Intronic
1179140896 21:38724027-38724049 GTTTGTAAGCAGAATTTGGAGGG + Intergenic
1179408361 21:41143469-41143491 CTTTGGATGGAGAAGTTTTATGG - Intergenic
1180244149 21:46535159-46535181 ATATATAAGTAGAATCTTTATGG + Intronic
1180859186 22:19067389-19067411 CATTTTAAGAAAAATTTTTAAGG - Intronic
1182233657 22:28858698-28858720 CTTTTTAATTAGAATTTACATGG + Intergenic
1183541261 22:38430703-38430725 CTCTGTAAATAGAGTTTTCAGGG + Intronic
1184199724 22:42959732-42959754 CTTTGAAAGTAGAATTTTCACGG - Intronic
1185152773 22:49175493-49175515 ATTTCTAAGTAGAAATTTTGGGG - Intergenic
949115727 3:319920-319942 ATTTTTAAGTAGAATACTTATGG + Intronic
949521899 3:4864100-4864122 CTTTGTGAGTAGAAGTTTTGGGG - Intronic
949649568 3:6140663-6140685 CTTTGTAAATCAAATTCTTAAGG - Intergenic
951096830 3:18642192-18642214 CTTTGTAAATAAAGTTTTAATGG + Intergenic
951377399 3:21936967-21936989 TCTTGTAAGTAAAATATTTATGG + Intronic
952044297 3:29299394-29299416 TTTTGTAAGTTTCATTTTTAAGG + Intronic
952439029 3:33304654-33304676 CTCTGAAAGTAGAATTTCTGAGG + Intronic
953993722 3:47503574-47503596 TTTTGTAAGTAAAATTTTATTGG - Intronic
954494423 3:50941183-50941205 ATTTGTATCTAGAATATTTATGG + Intronic
958137530 3:89515187-89515209 CCTTGTGAGTGGAATTTTCAAGG + Intergenic
958170607 3:89934850-89934872 CTTTGTCTGCAGGATTTTTAGGG + Intergenic
958591589 3:96165455-96165477 TTTTGTAAGTCTAATTTCTATGG - Intergenic
958591732 3:96167915-96167937 ATTTGAAATTAGAATTTTTAGGG - Intergenic
959271527 3:104217410-104217432 ATTTGAAAGTAGAACTTTTGTGG - Intergenic
959287614 3:104436936-104436958 CTTTGTCAGAAGAATTTAAATGG + Intergenic
959360123 3:105378434-105378456 CTTTCTAAGAAGAATGTTTATGG + Intronic
959975209 3:112451036-112451058 ATTTTTAATTAGAAATTTTATGG - Intergenic
960456001 3:117872899-117872921 ATCTGTGAGTAGAATTTCTACGG + Intergenic
960884705 3:122382803-122382825 TTTTGTAAGTAGAGTTTTTGTGG - Intronic
962403176 3:135078739-135078761 CTTTGTCACTGGAATTTTTTAGG - Intronic
963025542 3:140915227-140915249 TATTTTAAGTAGAATTTTGAAGG + Intergenic
963550815 3:146720608-146720630 CTGTATATGTACAATTTTTATGG - Intergenic
963771363 3:149389451-149389473 CTTTGTAAATAGTATTTTGTGGG + Intergenic
963982500 3:151555338-151555360 CTTTGCAAGCAGAATTTAGAGGG + Intergenic
964054247 3:152433317-152433339 CTTTATGAGAACAATTTTTAGGG - Intronic
964080953 3:152756082-152756104 TTTTCTAAGAAGAAGTTTTATGG - Intergenic
964321498 3:155502450-155502472 CTTTCAAAGTAGATGTTTTAGGG - Intronic
964741196 3:159968107-159968129 CTTTGTAAGCTTAATTTTAATGG + Intergenic
964783930 3:160373002-160373024 CACTGTAAGTGAAATTTTTATGG + Intronic
965633366 3:170756081-170756103 TTTTGAAATTAAAATTTTTATGG + Intronic
965957854 3:174392498-174392520 CTTTGGAAGTAGAATTGTTAGGG + Intergenic
966274664 3:178150950-178150972 CTTTTCAAGGAGAATTTTCAAGG + Intergenic
966728930 3:183134197-183134219 TTTTGGAAGTGGAATTGTTAGGG + Intronic
967073602 3:185982957-185982979 CTTTGTAGCTTGAATTTCTAGGG - Intergenic
967735339 3:192945910-192945932 CTGTGTATATATAATTTTTATGG - Intergenic
969505179 4:7582009-7582031 CTTTGTAAGCATCATTTTAATGG + Intronic
970127085 4:12826782-12826804 CTTTGTAATTAGTATTTTGTTGG + Intergenic
970270212 4:14338586-14338608 TTTTGTAAGTAAAATTTTACTGG + Intergenic
971423787 4:26496948-26496970 ATTGGTAAGTAGAATAATTACGG - Intergenic
972026870 4:34390784-34390806 GTATGTAAATAGAATTTATAAGG + Intergenic
972237624 4:37152001-37152023 CATTGTAAATAGTGTTTTTATGG - Intergenic
972535916 4:39999876-39999898 CTTTGTAAGAAGGAATTTAAAGG + Intergenic
973085374 4:46052875-46052897 GTTTGTGAGTAGAATTTTTAGGG - Intronic
974606739 4:64161926-64161948 ATTTGTAATTAAAATATTTATGG + Intergenic
975010976 4:69351122-69351144 CTTTGTTTTTAGAACTTTTAAGG + Intronic
975068586 4:70101958-70101980 GTTTTTGAGTAGAATCTTTAGGG - Intergenic
975411218 4:74053114-74053136 TTTTGTAGGTATAAATTTTAGGG + Intergenic
976713175 4:88094952-88094974 CATTTTAATTAGAATGTTTATGG - Intronic
977238125 4:94533467-94533489 TTTAATATGTAGAATTTTTAAGG + Intronic
977458716 4:97297791-97297813 CATTGTAAATAGTATTTTAAAGG - Intronic
977744237 4:100526112-100526134 CTTTCTAAATAGAAATTTCATGG - Intronic
977972591 4:103228947-103228969 CTCTGTAAGTCCAAATTTTAAGG - Intergenic
979410946 4:120378927-120378949 CTTTTTAACCAGAAATTTTATGG - Intergenic
979882596 4:125980639-125980661 TTTTGTTAGTAGAATTTTTATGG + Intergenic
980474981 4:133301955-133301977 CTCTGTAACAAGAATTTATAAGG + Intergenic
982587190 4:157257659-157257681 CTTTATTAAAAGAATTTTTATGG + Intronic
982603443 4:157482866-157482888 CTTTGAAAGTATACTTTTGATGG - Intergenic
982681079 4:158431701-158431723 CTTTTTTGGTAGAATCTTTATGG - Intronic
983033376 4:162831700-162831722 ATTTGAAAGTATAATTTATAAGG - Intergenic
984406204 4:179333975-179333997 CTTTTTCAGTACAATTTTCAAGG - Intergenic
984656127 4:182320793-182320815 TTTTGTAAGTAAAGTTTTTCTGG - Intronic
984724325 4:183005687-183005709 TTTTGTATGTGGAATCTTTAGGG - Intergenic
985404642 4:189625443-189625465 CTTTGTAAGCAGGATACTTACGG - Intergenic
986283363 5:6341672-6341694 CTTCATAACTAGAATTTTAATGG + Intergenic
986691068 5:10314353-10314375 GCTTGACAGTAGAATTTTTAGGG - Intergenic
987046061 5:14109728-14109750 CCTTGTAAGAAGAATCTTCAAGG + Intergenic
988043904 5:25923938-25923960 TTTTGTAAATAGAGTTTTTCAGG - Intergenic
988709129 5:33755990-33756012 CTTTGTAAGAGGAATTTTTGGGG - Intronic
989507187 5:42240132-42240154 CTTTGTAACTAAAATTTTTTAGG - Intergenic
990413685 5:55565843-55565865 CTTTGTAAGTATCATTTTAATGG - Intergenic
990658426 5:57984440-57984462 CTTTCTATATAGAATTTCTATGG + Intergenic
991059498 5:62357989-62358011 CTTAGTGAGTTGCATTTTTATGG + Intronic
991562400 5:67967736-67967758 CTTTATAAGTACAAGTTTTAGGG - Intergenic
992035633 5:72772519-72772541 TTTTGTAAATAAAATTTTTTTGG - Intergenic
993088301 5:83392320-83392342 CTTTGAAAGTACAATTTCTATGG + Intergenic
993464440 5:88227823-88227845 CTATTTAAATAGAATTCTTAGGG - Intronic
994262240 5:97673525-97673547 TTTTGTAAGGAACATTTTTATGG + Intergenic
995084750 5:108095190-108095212 CTTTAAAAGTAGAATTCTGATGG - Intronic
995494748 5:112729471-112729493 ATTTGGAAGCAGAATTTTTGAGG + Intronic
995651156 5:114370092-114370114 TTTTATAAATAGAATTATTAAGG - Intronic
995755418 5:115498243-115498265 TTTTGTAAGTGGAATGTTTCTGG - Intergenic
995887476 5:116912302-116912324 CTGTGTAAGTATATTTTTCAGGG + Intergenic
995942839 5:117605739-117605761 CTTTTTAAGTGCACTTTTTAAGG - Intergenic
995994996 5:118287167-118287189 TTTTGTAATGAGAATTTTTTTGG + Intergenic
996578195 5:124999867-124999889 ATTTGTCAGTACAATTTGTAGGG + Intergenic
998729471 5:145058230-145058252 CTGTATAAGTAGTACTTTTAAGG - Intergenic
998879896 5:146635141-146635163 ATTTGAAAGTAGAAATATTAAGG - Intronic
999018856 5:148141008-148141030 CTTTGTAAATAGAGTTTTATTGG - Intergenic
999732594 5:154485927-154485949 TTTTTTAAGTAGACTTTTTTGGG - Intergenic
1000101310 5:158019671-158019693 TTTTTTAAGTATAATTTTTCTGG + Intergenic
1000440792 5:161260731-161260753 CTTTGTTTGTATAATATTTAGGG + Intergenic
1000477674 5:161731458-161731480 TTTTGCAATTAGAATTTTCAAGG - Intergenic
1000626150 5:163541317-163541339 CTTTGTAAATAGTATTTTGTGGG - Intergenic
1002817945 6:696311-696333 CATTGTAAGGCGAATTGTTAAGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003634491 6:7820230-7820252 TTTTGTAAGTAGATTTTTAAAGG + Intronic
1003769359 6:9280783-9280805 ATTTTTAAGTTGAATTATTAGGG - Intergenic
1004914206 6:20316692-20316714 TTTTGTGAGTAAAATTTTTTTGG - Intergenic
1005276398 6:24223797-24223819 CTTTGTAAGTACCATTTTGGTGG - Intronic
1006535221 6:34694239-34694261 CTTTATTAGTATAATTATTATGG - Intronic
1007979299 6:46134158-46134180 CTTTGTAACTAGAATGATAAAGG + Intronic
1008024732 6:46622299-46622321 CTTTGAAAGGATAAATTTTATGG + Intronic
1008185041 6:48378153-48378175 CTTGGTATGTAGCATTTTAATGG - Intergenic
1008939799 6:57034389-57034411 CTTGGAAATTAGAATTTTGATGG - Intergenic
1009477609 6:64113903-64113925 TTTTGTAAGTAAAATTTTATTGG + Intronic
1009947383 6:70355715-70355737 TTCTGCAGGTAGAATTTTTATGG - Intergenic
1010065852 6:71681693-71681715 CTTTGTAAATAGAGTTTTATTGG - Intergenic
1010211764 6:73367825-73367847 TTCTGGAAGTAGAATTTTTGGGG - Intergenic
1010437348 6:75849160-75849182 TTTTGTAAGTAAAATTTTATTGG + Intronic
1010549529 6:77204090-77204112 CTTTGTAATGTGATTTTTTAAGG - Intergenic
1010790630 6:80060523-80060545 AATGGTAAGTAGAATTGTTAAGG + Intergenic
1010921769 6:81691099-81691121 ATTTTTAAGTAGAATTTTCTAGG - Intronic
1012033317 6:94100563-94100585 CTATGTCAGTAAAATTTCTAGGG + Intergenic
1012280634 6:97323796-97323818 TTTTGCAAGTATAATGTTTAAGG + Intergenic
1012411100 6:98958034-98958056 CTTTGAAGGTAGCATTTTGATGG + Intergenic
1013204289 6:107932860-107932882 CTTTGTAATTAGTATTTTGTGGG - Intronic
1013570248 6:111416127-111416149 CTTTTTAACATGAATTTTTATGG - Intronic
1014099875 6:117500254-117500276 CTATGGAAGTAGACTATTTATGG - Intronic
1014125677 6:117774524-117774546 CTTTGTAAGGAGAATGACTAAGG - Intergenic
1014227353 6:118862888-118862910 CTTTGAAAGGATAATTTTTCAGG - Intronic
1014634722 6:123830995-123831017 TTTTGTAAGTTGCATATTTAAGG + Intronic
1014647568 6:123993160-123993182 CTTTCTTAATAGAATTCTTAAGG + Intronic
1014925426 6:127265221-127265243 CTTTTTAAGTAGATTTATTTAGG + Intergenic
1014931214 6:127338673-127338695 ATGTGTAACCAGAATTTTTATGG + Intronic
1015564609 6:134555500-134555522 CATTTTAAGTAGAATTTTTGTGG - Intergenic
1015627533 6:135195999-135196021 TTCTGTAAGTAGAATTGTGAAGG + Exonic
1017293862 6:152772151-152772173 GTTTGCATGTAGAAGTTTTATGG + Intergenic
1018342023 6:162861094-162861116 GTTTGCAAGAAGAATATTTATGG + Intronic
1018802354 6:167233842-167233864 TTTGGTGAGCAGAATTTTTAAGG - Intergenic
1019638180 7:2088095-2088117 CTTTGTGTGTAGACTTTTAAAGG - Intronic
1021684766 7:23173375-23173397 CTTTTTAAATACAAGTTTTAAGG + Intronic
1021873229 7:25024442-25024464 GTTTGCCATTAGAATTTTTATGG + Intergenic
1022657622 7:32334646-32334668 CTTTGCAAATACAACTTTTATGG - Intergenic
1022773786 7:33503152-33503174 TTTTGTAAGTAAAATTGATAGGG - Intronic
1024529342 7:50378239-50378261 TTTTAGAAGTTGAATTTTTATGG - Intronic
1025861520 7:65334877-65334899 AGTTGTAAGTAGAATTTTCATGG + Intergenic
1026923935 7:74175769-74175791 CTGTTTAAGAAGAATTTTTCTGG - Intronic
1027177936 7:75916251-75916273 CCTTGTAAGCAGAACGTTTATGG + Intronic
1027403059 7:77828636-77828658 TTTTGTATTTTGAATTTTTAGGG - Intronic
1027479858 7:78682234-78682256 CCTTGTAAATAGAATTTTCTGGG + Intronic
1027992766 7:85384058-85384080 ATTTATCAGTAGAATTTGTATGG + Intergenic
1028378667 7:90174859-90174881 CTTTTTAAGTATAATTTATTTGG + Intronic
1028406161 7:90476598-90476620 CTTTTTCAGTAGCATTTGTAAGG - Intronic
1028710262 7:93899289-93899311 TTTTTTCAGTTGAATTTTTATGG - Intronic
1028844689 7:95466486-95466508 ATTTGTAAACATAATTTTTATGG + Intergenic
1028957527 7:96710393-96710415 CTTTTTAAATAGAATTTGTGTGG + Intergenic
1029068215 7:97873124-97873146 CTTTGTACTTAAAATGTTTAAGG - Intergenic
1029510243 7:100989991-100990013 ATTTGTAACTTGAATTTTTAGGG - Intronic
1029993755 7:104986323-104986345 CTTTGTTATTCGAATATTTAAGG + Intergenic
1030359974 7:108585435-108585457 CTTTTAAAGTAAAGTTTTTAGGG - Intergenic
1030549637 7:110942107-110942129 CTTTAGAAGTAGAATTTATTAGG - Intronic
1030793750 7:113761386-113761408 CATTGTAAATAAAATCTTTAAGG + Intergenic
1031100454 7:117473482-117473504 CTTTGTAAGTTAATTTTTTTGGG + Intronic
1031221913 7:118977336-118977358 TTTTTTAAGTGGAATTTTAACGG - Intergenic
1031356691 7:120796067-120796089 CTTTGTAAATACATTTTTTTTGG - Intronic
1031460140 7:122038626-122038648 CTTTGCAAGTTTATTTTTTATGG + Intronic
1032534664 7:132652838-132652860 CTTTGTAATTAGACTTTCTTTGG + Intronic
1032587223 7:133157878-133157900 CTTTGTAAATAGTAGGTTTATGG + Intergenic
1033263711 7:139866372-139866394 CTTTATAAATATCATTTTTATGG - Intronic
1033936007 7:146586309-146586331 CTTTGTAACTTTAATATTTAAGG + Intronic
1035706867 8:1682391-1682413 TTTTGTATGTAGTATTTTTATGG - Intronic
1036665834 8:10737439-10737461 ATTTGGAACTCGAATTTTTAGGG + Intronic
1036665851 8:10737636-10737658 CTGTGTAAATATAAGTTTTAAGG + Intronic
1037790598 8:21936799-21936821 CTTTATAGGTAGAATTTTCTGGG + Intronic
1038507824 8:28101028-28101050 CATTGTATGTAAAAATTTTAGGG - Intronic
1039283595 8:36013399-36013421 TTTTGAAAGTGGAATTTATAGGG + Intergenic
1040355957 8:46618327-46618349 CTTTGTACTTAAAATGTTTAAGG - Intergenic
1042017738 8:64335033-64335055 CTTTTAAAGTATAATTTTAAAGG - Intergenic
1042804733 8:72759003-72759025 TTTTATAAGAAGAACTTTTAGGG + Intronic
1042848930 8:73196375-73196397 CGTTGTAAGCAAAATTTTAATGG - Intergenic
1042975582 8:74465397-74465419 CTTTGTAGGTAAAATTTATAAGG - Intronic
1043238959 8:77906704-77906726 ATATGTAAGCAAAATTTTTAGGG + Intergenic
1043413481 8:80024510-80024532 CTTTGTAAGGATAATGTGTATGG + Intronic
1043649392 8:82570543-82570565 CTTTTTAATTAGTATGTTTAGGG - Intergenic
1043826298 8:84933076-84933098 CTTTCTAATTAAAATTTTAAAGG - Intergenic
1044021679 8:87112818-87112840 CTTAGGAAGTAGACTCTTTAAGG - Intronic
1044348926 8:91140380-91140402 TTTTGTAAGTAGCATTTTTCTGG + Intronic
1044941904 8:97352056-97352078 CTTTGTAATTAGCATGTTTTGGG - Intergenic
1045099964 8:98834248-98834270 AGTTATAAGTAGAATTTTAAAGG - Intronic
1046040731 8:108900653-108900675 ATTTTTAAGAAGGATTTTTATGG - Intergenic
1046180362 8:110637629-110637651 CTTTGTAAGTAGTAATTATATGG + Intergenic
1046321211 8:112578829-112578851 TTTTGTAAGTAAAATTTTATTGG - Intronic
1046892466 8:119437938-119437960 TTTTGTAAGTACAATTTTATTGG - Intergenic
1047567043 8:126056544-126056566 CTTTGTAATTTTAATGTTTAAGG + Intergenic
1047577876 8:126178221-126178243 CTTTCTAAATATAAATTTTATGG - Intergenic
1049173649 8:141177699-141177721 CTTTGTAAGTAAAGTTTTATTGG + Intronic
1049969521 9:809386-809408 CTTTCTAAGGAGAAAATTTATGG - Intergenic
1050159786 9:2706062-2706084 TTTTTTAACTAGAGTTTTTAGGG - Intergenic
1050975371 9:11930249-11930271 ATTTGTAATTATCATTTTTATGG + Intergenic
1052208859 9:25877248-25877270 CTTTGTAGATAAAATTTTAAGGG - Intergenic
1054974678 9:71128395-71128417 CTTTGTGAATGGAAATTTTAGGG - Intronic
1055380186 9:75698254-75698276 CTTTTTAAGGTGAGTTTTTATGG + Intergenic
1055694872 9:78872874-78872896 CTTTGTAAGGAGAGTTTCTTTGG - Intergenic
1055808988 9:80129329-80129351 CTTTATACCTACAATTTTTAAGG + Intergenic
1056186017 9:84135619-84135641 CTGAGTAAGGACAATTTTTATGG + Intergenic
1057318608 9:93990837-93990859 TTTAGTAAAGAGAATTTTTAAGG + Intergenic
1057364559 9:94406799-94406821 TTTTGTGTGTGGAATTTTTAGGG + Intronic
1057614360 9:96575456-96575478 CTTTGTAAGTTCTTTTTTTAAGG + Intronic
1057658776 9:96981269-96981291 TTTTGTGTGTGGAATTTTTAGGG - Intronic
1057933163 9:99213376-99213398 CTTTGGTAGTAGAAGTATTAAGG + Intergenic
1058299039 9:103346698-103346720 CTTTATAAGTACTATTATTAAGG - Intergenic
1058968253 9:110056840-110056862 CATTTTAAGTATTATTTTTATGG + Intronic
1059467884 9:114480728-114480750 CTTTGTAAATAGGATTTCAATGG - Intronic
1185931618 X:4209833-4209855 TTTTGAAATTAGTATTTTTATGG - Intergenic
1186188394 X:7043878-7043900 ATTATTAAGTAGATTTTTTAAGG - Intergenic
1186210750 X:7248072-7248094 ATTTTGAAGTAGAATTTTTTTGG - Intronic
1186265557 X:7829646-7829668 ATTTAAAACTAGAATTTTTATGG + Intergenic
1186284666 X:8030569-8030591 CTTGGTATTTGGAATTTTTATGG + Intergenic
1187298808 X:18028276-18028298 CTTTGAAATTAAAATATTTAGGG - Intergenic
1188187536 X:27133023-27133045 TTTTGTAAGTAAAATTTTATTGG - Intergenic
1188551763 X:31372578-31372600 TTTTGTAAATACATTTTTTAAGG - Intronic
1189175220 X:38949911-38949933 CTTACTAAGTAGAATTTCTAGGG + Intergenic
1189952843 X:46249932-46249954 TTTTGAAAATAAAATTTTTATGG + Intergenic
1191126944 X:56966623-56966645 CTTCATAAGTAGCATTATTATGG + Intergenic
1193480358 X:82019852-82019874 CTTGGTGAGTAAAATTTATATGG - Intergenic
1193534477 X:82695968-82695990 CTTTGAAAATATAATTTTGATGG - Intergenic
1194043168 X:88969189-88969211 ATTTGGAGGTAGAGTTTTTAAGG - Intergenic
1195125498 X:101805209-101805231 CATTGAAAGTAGCATTTTTGAGG + Intergenic
1196668675 X:118343515-118343537 TTTTCTAAGTATAATGTTTAAGG + Intergenic
1197022217 X:121705394-121705416 CTTTGTATGAAGAGATTTTAGGG + Intergenic
1197250508 X:124210984-124211006 ATTTTAAATTAGAATTTTTATGG - Intronic
1197638992 X:128947358-128947380 CTAAGTAAGAAGATTTTTTAGGG + Intergenic
1198600205 X:138275742-138275764 CTTTGTAAATAAAATTTTATTGG - Intergenic
1199044968 X:143159083-143159105 GTTGGTAAGTAGAACTTTTAAGG - Intergenic
1199303404 X:146239142-146239164 ATTTGGAAATAGAATCTTTATGG - Intergenic
1200823498 Y:7614183-7614205 CCTTGTAAGTTGTATTTGTAGGG + Intergenic
1201467483 Y:14299318-14299340 TTTTTTAAGTGGAATCTTTAGGG - Intergenic
1202236559 Y:22716912-22716934 CCTTGTAAGTTGTATTTGTAGGG - Intergenic
1202306606 Y:23479256-23479278 CCTTGTAAGTTGTATTTGTAGGG + Intergenic
1202564201 Y:26191333-26191355 CCTTGTAAGTTGTATTTGTAGGG - Intergenic