ID: 1172106770

View in Genome Browser
Species Human (GRCh38)
Location 20:32521805-32521827
Sequence CAGTCTCAGCCCAGGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172106770_1172106779 16 Left 1172106770 20:32521805-32521827 CCAGGTTCCCTGGGCTGAGACTG 0: 1
1: 0
2: 3
3: 29
4: 281
Right 1172106779 20:32521844-32521866 CCATGTGCTTCCTGGAGCCTGGG 0: 1
1: 0
2: 4
3: 31
4: 329
1172106770_1172106776 8 Left 1172106770 20:32521805-32521827 CCAGGTTCCCTGGGCTGAGACTG 0: 1
1: 0
2: 3
3: 29
4: 281
Right 1172106776 20:32521836-32521858 CTGGTTTTCCATGTGCTTCCTGG 0: 1
1: 0
2: 2
3: 22
4: 285
1172106770_1172106777 15 Left 1172106770 20:32521805-32521827 CCAGGTTCCCTGGGCTGAGACTG 0: 1
1: 0
2: 3
3: 29
4: 281
Right 1172106777 20:32521843-32521865 TCCATGTGCTTCCTGGAGCCTGG 0: 1
1: 1
2: 7
3: 36
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172106770 Original CRISPR CAGTCTCAGCCCAGGGAACC TGG (reversed) Intronic
900641910 1:3691598-3691620 CAGCCTGAGCCCTGGGGACCTGG + Intronic
901080437 1:6580864-6580886 CGCTCTCACCTCAGGGAACCGGG + Exonic
901510969 1:9717889-9717911 CAGGTTCAGCCCAGGGATCCGGG + Intronic
902917311 1:19646440-19646462 CAGAGTGAGCCCAGGAAACCCGG + Intronic
903364297 1:22796376-22796398 CAGTCTCTTCCCATGGGACCTGG + Intronic
903806044 1:26006243-26006265 CAGTCTGAGTTCTGGGAACCAGG + Intergenic
904310350 1:29625317-29625339 CAGTCTCACCCCATGGAGCTGGG - Intergenic
904964813 1:34363523-34363545 CAGTCACACCCCAGGGAATAAGG + Intergenic
906205455 1:43984138-43984160 CAGTCACAGCCCAGCAAGCCTGG - Intronic
907414732 1:54306377-54306399 CAGTTTCAGTCCAGGACACCAGG + Intronic
912879124 1:113390950-113390972 CCGTCTCAGCCCGGGGGCCCTGG - Exonic
913325711 1:117626652-117626674 CAGTATAAGCTCAGGGTACCTGG - Exonic
915137590 1:153744282-153744304 CAGACTCAGGACAGGGAAGCAGG - Intronic
915949804 1:160181583-160181605 CTGACTCAGCCCAGGGGTCCTGG + Intronic
916179943 1:162074573-162074595 CAGTTTGAAGCCAGGGAACCAGG - Intronic
916700815 1:167292817-167292839 AGGTCTCATCCCAGGGATCCAGG + Intronic
916919602 1:169450098-169450120 AAGTCACAGCCCAGGGACACAGG - Intronic
917132352 1:171755603-171755625 CTGCCTGAGCCCAGGGCACCAGG - Intergenic
919797897 1:201332286-201332308 CAGCCCCTGCCCTGGGAACCAGG + Exonic
920106416 1:203556445-203556467 CAGGCGCAGCTCAGGGAGCCAGG + Intergenic
920705605 1:208248411-208248433 GGGTCTCAGCCCAGGCAACGGGG + Intergenic
920732838 1:208504047-208504069 CACTTTCAGCCGAGGCAACCTGG + Intergenic
921215938 1:212936817-212936839 CTGGGCCAGCCCAGGGAACCAGG + Intergenic
922795382 1:228337149-228337171 CAGACACACCCCAGGGACCCTGG - Intronic
922820227 1:228479487-228479509 CAGTGTGAGCCCTGGGAGCCTGG - Intergenic
1066657379 10:37708735-37708757 TATTCTCAGCCCACTGAACCTGG - Intergenic
1066705767 10:38175905-38175927 CAGCCTCAGCCTAGGGCAACGGG + Intergenic
1068787203 10:60989630-60989652 CTGTCTCAGCACAGGAAACAAGG - Intronic
1074920936 10:118010556-118010578 GCCTCTCAGCCCAAGGAACCAGG + Intronic
1075234558 10:120714998-120715020 CTGTCACAGCACAGTGAACCAGG - Intergenic
1075711333 10:124532267-124532289 GAATCTCAGCCCAGGGCCCCAGG + Intronic
1076037286 10:127210488-127210510 CAGGCTGAGCCCGGGAAACCAGG + Intronic
1076243480 10:128928044-128928066 CAAACTCAGCCCAGGGAGCGCGG + Intergenic
1076792467 10:132784680-132784702 CAGCCTCCGCACCGGGAACCCGG + Intergenic
1076861887 10:133141665-133141687 CAGACCCAGCCCAGGTCACCGGG - Intergenic
1077181401 11:1218810-1218832 CAGGGGCAGCCCAGGGCACCGGG + Intergenic
1077362313 11:2146132-2146154 CAGACTCACCCCATGGAGCCTGG + Intronic
1077416654 11:2427125-2427147 CCTTCACAGCCCAGGGAAGCGGG + Intergenic
1078420290 11:11206283-11206305 CAGTCTCAGGGCAGGGAGCAGGG - Intergenic
1079095192 11:17505414-17505436 CAGGCTCTGCCTGGGGAACCTGG + Intronic
1081775661 11:45674523-45674545 CAGTTTCACCCCAGGGAATCTGG - Intergenic
1084561966 11:69910372-69910394 CAGTCCCAGCCGAGGGGTCCTGG + Intergenic
1084712386 11:70852057-70852079 CACTCTGTGCCCAGGGAAGCAGG + Intronic
1085521647 11:77142672-77142694 GAGTCTCAGCCCAGGTGAGCAGG - Intronic
1087088647 11:94245481-94245503 CAGACTCAGCCCCAGGAGCCAGG + Intergenic
1087986942 11:104694381-104694403 GAGTCTCAGGCCAGGCCACCAGG + Intergenic
1089406709 11:118203476-118203498 CAGTATCCACCTAGGGAACCTGG - Exonic
1090039941 11:123281904-123281926 CAGTCTCAGCCCATGGACTTTGG - Intergenic
1090306264 11:125693720-125693742 CTGTCTCAGCCCAGGGCCACAGG - Intergenic
1090439860 11:126716505-126716527 CAGCCACATCCCAGGGAAACAGG + Intronic
1091241240 11:134053815-134053837 CAGACACTGCCGAGGGAACCAGG + Intergenic
1092229012 12:6766650-6766672 CCGTCTCGGCCCCGGGACCCCGG + Exonic
1092868900 12:12787981-12788003 CAGTCTCAGGCCAAGCCACCAGG - Exonic
1093186305 12:16023088-16023110 CAGTTACAGCCCAGGGACACAGG + Intronic
1095593018 12:43925787-43925809 CAAGCTCAGCCCATGGATCCTGG - Intronic
1096478906 12:51924933-51924955 CAGTCCCAGCCCTGGGAGACTGG - Intergenic
1101997555 12:109535747-109535769 CTTCCTCAGCACAGGGAACCCGG + Exonic
1102227108 12:111236570-111236592 CTGTCTCACCCCAGGGCACGGGG - Intronic
1103905859 12:124326916-124326938 CTGTCTCAGCCCTGGGAGTCAGG - Intronic
1104569102 12:129909459-129909481 CAGGCCCAGCCCAGGGAGGCCGG + Intergenic
1104714718 12:131008759-131008781 CAGTCTCAGCCCCGTCCACCTGG - Intronic
1104990349 12:132620913-132620935 CAGTCCCAGGCCAGGGAAGGGGG - Intronic
1105202241 13:18190642-18190664 GAGACTCAGCCCAGAGAACATGG - Intergenic
1105278114 13:18948064-18948086 CACTGTCATCCCAGAGAACCAGG + Intergenic
1105292428 13:19061482-19061504 CAGCCTCAGCCCACAGAACAGGG + Intergenic
1106235044 13:27854183-27854205 TAGGCTCAGCCCAGGGAATGAGG - Intergenic
1108260077 13:48647157-48647179 CAGTCTCAACCCAGGGTAGGTGG + Intergenic
1110333590 13:74300834-74300856 CAATCTCATCCCAGGAACCCAGG - Intergenic
1111447114 13:88361103-88361125 CATTCACAGCCCAGGGAAGAAGG - Intergenic
1112402844 13:99090386-99090408 CAGCCTCATCCCAGGTAGCCAGG - Intergenic
1112850232 13:103696991-103697013 GAATTTCAGCCCAGGGAACAAGG + Intergenic
1113335725 13:109374048-109374070 CCCTCTCAGCCCAGGTCACCTGG + Intergenic
1113412824 13:110105321-110105343 CAGTCTGTGCCCTGGGAACAGGG - Intergenic
1113628229 13:111862274-111862296 CAATACCAGCCCAGGCAACCTGG + Intergenic
1114567621 14:23644271-23644293 CAAGCTCAGCCCAGGGCAGCAGG - Intronic
1114647130 14:24262093-24262115 GAGTCTGAGCCCCGGGAGCCAGG + Exonic
1117262535 14:54050956-54050978 CCTTCTTTGCCCAGGGAACCCGG + Intergenic
1117786608 14:59292245-59292267 CACTCTCGACCCAGGGAAACAGG + Intronic
1119383642 14:74243917-74243939 GAGTCTGATCCCAGGGGACCAGG + Intronic
1120979617 14:90278580-90278602 AAGTCTCAGCCAAGGGGAGCAGG - Intronic
1121225753 14:92320752-92320774 CAGTCTCAGCCCAGGGGAGGTGG - Intergenic
1121958819 14:98239986-98240008 TAGACTCAGCACATGGAACCAGG + Intergenic
1122251866 14:100445611-100445633 CCGTCTCAGCCCTGGCAACAAGG - Intronic
1124346810 15:28928529-28928551 CAGTCACAGCCCAGGGAAATGGG - Intronic
1124492171 15:30164723-30164745 CAGCCTCAGCCGAGGGAAGGGGG - Intergenic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1124751365 15:32373594-32373616 CAGCCTCAGCCGAGGGAAGGGGG + Intergenic
1125747673 15:42008233-42008255 TTGTCTTAGCCCAGGGGACCAGG + Intronic
1125826312 15:42679494-42679516 CAGTCTCTTCCCAGGGAAGAAGG - Intronic
1127897255 15:63312341-63312363 AACTCTCAGCCCAGGGATTCAGG - Intergenic
1128333426 15:66771051-66771073 CTGTCTGGGCCCAGGGAACCTGG + Intronic
1129247147 15:74286508-74286530 CAAGGTCAGCCCAGGAAACCTGG - Intronic
1129427059 15:75471402-75471424 AAGTCCCAGCCCAGGCAACATGG + Intronic
1130649883 15:85756503-85756525 CAGGCCCTGCCCAGGGAGCCAGG - Intergenic
1131177961 15:90221568-90221590 CAGAGTCAGCCCAGGAACCCTGG - Intronic
1131681069 15:94724039-94724061 CATTCTCAGCCAAGAGCACCTGG - Intergenic
1132350818 15:101138783-101138805 CAGTCCCACCCCAAGGGACCAGG - Intergenic
1133270291 16:4608064-4608086 CAGTCACATCCCTGGGAGCCAGG + Intergenic
1133367003 16:5217936-5217958 CAACCCCAGCCCAGGAAACCAGG - Intergenic
1133499998 16:6356994-6357016 CAGTCTTGGCCCAGGGCACGGGG - Intronic
1133667163 16:7979752-7979774 CAGTGGCAGCCCTGGGAATCCGG + Intergenic
1134134291 16:11668999-11669021 CAGCCGCTGCCCACGGAACCGGG - Intronic
1134217688 16:12328911-12328933 GAAACTGAGCCCAGGGAACCAGG - Intronic
1136556000 16:31008257-31008279 TAGTCACAGCTCAGGGAAACTGG - Intronic
1136624427 16:31453326-31453348 CAGGCTCAGAGCTGGGAACCTGG + Intergenic
1137231269 16:46569674-46569696 CAGTCTCAACCAAGGAAGCCAGG - Intergenic
1137250889 16:46740062-46740084 CAGTCTGATGCCAGGGAGCCTGG - Exonic
1138002757 16:53299034-53299056 CAGCCTCAGCACCTGGAACCAGG + Intronic
1138184811 16:54968300-54968322 CTGTCTAAGCCCAGAAAACCAGG + Intergenic
1138198041 16:55068646-55068668 CAGTCTCTGGTCAGGAAACCAGG + Intergenic
1139128570 16:64112734-64112756 CTGTCACGGCCCAGGGAAACAGG - Intergenic
1139513762 16:67441506-67441528 CTGTCTCAGGGCAGGCAACCCGG + Intronic
1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG + Intronic
1141395205 16:83698472-83698494 GAGCCTCAGCACTGGGAACCAGG - Intronic
1141741003 16:85892955-85892977 AAGTCACAGCCCATGAAACCTGG + Intergenic
1142201010 16:88761175-88761197 CTGTCTCTGCCCAGGGAGCGGGG + Intronic
1143527669 17:7481933-7481955 CAGCCGCAGCCCAGGCGACCTGG - Intronic
1145208004 17:20994882-20994904 CAGCCTCAGCCCAGGGGAGGAGG - Intergenic
1145888038 17:28396359-28396381 TTGTCTCAGCCCAGGGAGACTGG - Exonic
1145933093 17:28699958-28699980 TAGTCCCAGCCTAGGGGACCAGG + Intronic
1146268999 17:31472299-31472321 CATACCCAGCGCAGGGAACCTGG + Intronic
1146885232 17:36465786-36465808 CAGTCTCAGTGCAGGGGACCGGG + Intergenic
1148447252 17:47745112-47745134 CGGACTCTGCCCATGGAACCCGG + Exonic
1152065741 17:78111838-78111860 CTGTCACAGCCCAGGGCTCCAGG - Exonic
1152069535 17:78128035-78128057 CCTTCTAAGCTCAGGGAACCCGG + Intronic
1152259546 17:79259674-79259696 CAGGCTCAGCAAAGGGAGCCCGG - Intronic
1152534283 17:80941412-80941434 CAGCCCCATCCCAGGGACCCTGG + Intronic
1152763310 17:82121258-82121280 CTGTCTCAGCCTAGGGAGGCAGG + Intronic
1154012358 18:10586489-10586511 CTGTCACAGCCCTGGAAACCAGG - Intergenic
1154305527 18:13228034-13228056 CAGTCTCAACCCAGGGAGATGGG - Intronic
1157153319 18:45240984-45241006 AAGCTTCAACCCAGGGAACCTGG + Intronic
1159852373 18:73539874-73539896 AAATCTCAACCCAGGGAACAAGG + Intergenic
1160837364 19:1131232-1131254 CAGTGCCTCCCCAGGGAACCGGG + Intronic
1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG + Intronic
1161293317 19:3507020-3507042 CAGTCCCAGCCCGGGACACCCGG + Intronic
1161487390 19:4543554-4543576 CAGTGCCAGCCACGGGAACCAGG - Exonic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1162402370 19:10453958-10453980 CAGACTCTGTCCAGGGAAGCAGG - Intronic
1162834601 19:13308071-13308093 GAGCCTGACCCCAGGGAACCAGG + Intronic
1163300487 19:16442651-16442673 CAGACCCAGGCCAGGGAAACTGG - Intronic
1163349865 19:16769651-16769673 GAGTCCCAGCCCAGGGCCCCCGG - Intronic
1163700649 19:18785130-18785152 CAGCCCCAGCCCCCGGAACCTGG + Intronic
1164389579 19:27806086-27806108 CAGTCGCAGCCAAGGCAGCCTGG - Intergenic
1164807155 19:31125873-31125895 CAGTCACAAGCCAGGGAACATGG - Intergenic
1164814186 19:31181726-31181748 CAGTCCCAGGCCAGGGGACTTGG + Intergenic
1165003682 19:32787230-32787252 CAGCCTCTGCCCAGGGAAACAGG - Intronic
1165455480 19:35908118-35908140 CAAGCTGAGCCCAGGGACCCGGG + Intronic
1167514376 19:49914543-49914565 CCTTCACAGCCCTGGGAACCCGG + Intronic
925131561 2:1497350-1497372 GGGTGTCAGCCCAGGGCACCTGG + Intronic
927022569 2:19032605-19032627 TAGTCCCAGCCCAGCAAACCCGG - Intergenic
927206827 2:20616380-20616402 CAGCTTCAGCCCTGGGACCCAGG - Intronic
927516637 2:23675365-23675387 CCATCCCAGCCCAAGGAACCTGG - Intronic
927696439 2:25242634-25242656 CAGTCTCAACCCAGGGACCCTGG - Intronic
933021832 2:77204035-77204057 CAGTGTCAGGCCAGGAGACCTGG + Intronic
934153754 2:89175256-89175278 CAGGCTCAACCCATGGAGCCAGG + Intergenic
934206922 2:89938698-89938720 CAGGCTCCACCCAGGAAACCAGG - Intergenic
934213484 2:90006676-90006698 CAGGCTCAACCCATGGAGCCAGG - Intergenic
934564485 2:95330714-95330736 CAGTGCCAGCCCAGTGAACTGGG - Intronic
934567228 2:95347471-95347493 GACCCTCAGCCCAGGGCACCTGG + Intronic
934935724 2:98463953-98463975 CGGTCTCCACCCAGTGAACCTGG + Intronic
935202015 2:100865479-100865501 CAGTCACCGGTCAGGGAACCAGG - Intronic
936405503 2:112199033-112199055 CAGGCTCTGCCCTAGGAACCAGG + Intergenic
937116379 2:119407720-119407742 CAGTCTCCCCCCAGAGAACAGGG + Intergenic
940645497 2:156388597-156388619 GAATCTCTGCCCAGGCAACCTGG + Intergenic
941224443 2:162829086-162829108 CAGTCACAGCCATGAGAACCTGG + Intronic
944622679 2:201533069-201533091 GACTCTCAGCCCAAGGAAACAGG + Intronic
946013843 2:216588275-216588297 CACCCTCATTCCAGGGAACCTGG + Intergenic
948070324 2:235116195-235116217 GAGTCTCAGACCAGAGAACCAGG - Intergenic
948309011 2:236971276-236971298 CAGTCGGAGCCCAGGCAGCCAGG - Intergenic
949051238 2:241898697-241898719 CAGGCACAGCCCAGGGACCCAGG - Intronic
1168836601 20:881779-881801 CTTTCTCAGCCCAGAGAATCTGG - Intronic
1168941707 20:1718350-1718372 CAGGCTCAGCAAAGGGAACTGGG + Intergenic
1169171765 20:3471089-3471111 CCGTCTCAGCCCCGGGAAGATGG + Exonic
1169488968 20:6055620-6055642 CAGTCACCTCCCAGGGAGCCTGG + Intergenic
1170458804 20:16557669-16557691 CAGCCTCAGCCCCTGGCACCTGG + Intronic
1170634629 20:18093586-18093608 CACTCCCAGCCCAGGGGATCAGG + Intergenic
1171366384 20:24627626-24627648 CAGTTCCAGTCCCGGGAACCGGG - Intronic
1171487212 20:25493796-25493818 CAGGCTCAGGGCAGGGAACTCGG + Intronic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1172558412 20:35864101-35864123 CAGGCTCAGTCCAGAGAACCGGG - Intronic
1173865347 20:46309073-46309095 GAGACTCAGCCCTGGGCACCTGG - Intergenic
1175503386 20:59465772-59465794 CAGCCTCGGCCTCGGGAACCGGG - Intergenic
1175731747 20:61358883-61358905 CAGTTTCAGCCCAGGGTGACGGG + Intronic
1175963093 20:62646918-62646940 CAGTCTCCACCCACTGAACCTGG - Intronic
1178366200 21:31990965-31990987 CAGTCTCTGCCCAGGGCAGCAGG + Intronic
1178489633 21:33041087-33041109 CACTCTCATCTCAGGGGACCTGG - Intergenic
1178829522 21:36044233-36044255 CACTCACAGCCCAGGGAAGGAGG + Intronic
1179819824 21:43930293-43930315 CAGGCCCAGGACAGGGAACCGGG - Intronic
1180602636 22:17032587-17032609 GAGACTCAGCCCAGAGAACATGG - Intergenic
1180839067 22:18950317-18950339 GAGTGCCAGCCCAGGGAACCAGG - Intergenic
1181035091 22:20166110-20166132 CAGTCTCAGCCCAGTCGACATGG - Intergenic
1181062826 22:20290169-20290191 GAGTGCCGGCCCAGGGAACCAGG + Intergenic
1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG + Intergenic
1183080880 22:35455588-35455610 CAGTCTGAGCCCTGGGATGCTGG + Intergenic
1183387842 22:37525310-37525332 CAGTCTCAGCGATGGGAGCCAGG - Intergenic
1183417144 22:37689001-37689023 CAGTCTCAGCCCTGGGAGGAAGG + Intronic
1183585456 22:38750711-38750733 CAGTCACAGCCCAGGGCACCAGG + Intronic
1183673588 22:39287546-39287568 CGGTCACAGGCCAAGGAACCCGG - Intergenic
1184099395 22:42334103-42334125 CAGGCTCTGGACAGGGAACCAGG - Intronic
1184238770 22:43200623-43200645 CAGTCTCACACCAGGGAACTTGG - Exonic
1184386976 22:44182007-44182029 CAGTCCCAGCCCAGGCCACCCGG + Intronic
1184784038 22:46663213-46663235 CAGCCTCAGCCCAGGGACCGGGG - Intronic
950379516 3:12599618-12599640 AAGTTTCAGCCCAGGGGGCCAGG - Intronic
950476810 3:13220001-13220023 CAGCCCCAGTCCTGGGAACCGGG + Intergenic
952493428 3:33894299-33894321 CAGTTTCACCCCAGGGATGCAGG - Intergenic
952882986 3:37997190-37997212 CAGTGTCTGCCCAAGGAACTGGG + Intronic
953912072 3:46898333-46898355 CAGTCAGAGCCCTGGGACCCAGG - Intronic
954624899 3:52016994-52017016 CATTTTCAGCCCAGGAAATCAGG + Intergenic
954671078 3:52291691-52291713 CTATCCCAACCCAGGGAACCAGG - Intronic
956956959 3:74352297-74352319 CTGTCTCAGCCTTGGGAAGCAGG - Intronic
957544816 3:81623747-81623769 CTGCCTGAGCCCAGGCAACCTGG - Intronic
960586313 3:119323677-119323699 CAGCCACAGCCCAGGTAACGAGG - Intronic
961006514 3:123409347-123409369 CAGTCGCAGGCCATGAAACCAGG + Intronic
961360753 3:126365722-126365744 CAGTCACAGCTCAGGGAAACTGG - Intergenic
962736159 3:138327464-138327486 GAATCTCAGCCCTGGGAGCCAGG + Intronic
968430525 4:555810-555832 CAGTCTCAGCCTGGGCAACCTGG - Intergenic
968600887 4:1508845-1508867 CTGCCACAGCCCAGGGAAACAGG - Intergenic
968613604 4:1567769-1567791 CAGCCCCAGCCCAGGGCCCCCGG + Intergenic
969214187 4:5709423-5709445 AAGTCTCAGGCCAGCGAGCCTGG + Intronic
969664610 4:8549880-8549902 CAGGCTCAGCCCCAGGAACAGGG - Intergenic
972794370 4:42400547-42400569 CAGTCTAAGCAAAGGGAGCCAGG - Intronic
973613556 4:52658895-52658917 CCGTCTCAGCCCCGGGACCTCGG - Intronic
973847179 4:54924766-54924788 TAGTCTCAGGCCTGGAAACCTGG - Intergenic
976002071 4:80386105-80386127 CAGTCTGCCCCCAGGGAGCCTGG + Intronic
979277150 4:118827204-118827226 CAGTCTGACCCCAGCCAACCTGG - Intronic
980509111 4:133761312-133761334 AAGTCACAGCCCAGGGATGCAGG - Intergenic
985899376 5:2776743-2776765 CAGTCTCAGCGCAGAGAAGGCGG + Intergenic
986333686 5:6736915-6736937 CAGTCTCAGCAGAGAGAAACAGG - Intronic
988492744 5:31718354-31718376 CAGACTCAGACCATGCAACCTGG - Intronic
989824770 5:45839693-45839715 GAGTCTGAGGCCAGCGAACCAGG + Intergenic
990492384 5:56315144-56315166 CAATCTCAGCCCAGGGGTCGGGG - Intergenic
991450264 5:66743673-66743695 GAGACTCAGCCCAGGGAAACAGG + Intronic
991932292 5:71765658-71765680 CAGACTCAGGCCAGGGAGCTGGG + Intergenic
992986713 5:82238027-82238049 GAGTATCATCCCAGGGAACAAGG + Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994411473 5:99411605-99411627 CAGTACCAGCCCAGGAAACAAGG - Intergenic
994482355 5:100353642-100353664 CAGTACCAGCCCAGGAAACAAGG + Intergenic
996197279 5:120624515-120624537 GAGTCTCAAACCAGGCAACCTGG - Intronic
997596479 5:135110532-135110554 CTGTCAGAGCCTAGGGAACCAGG + Intronic
998132339 5:139657737-139657759 CAGTCCCAGCCCAGGCCAGCCGG - Intronic
1000074398 5:157771243-157771265 TAATTTCAGGCCAGGGAACCGGG - Intergenic
1001419024 5:171572929-171572951 CAATCCCAGCCCAGTGAGCCAGG - Intergenic
1001759093 5:174192823-174192845 CACTCACAGCCCAAGGAAGCTGG + Intronic
1002183267 5:177442279-177442301 CAGCCTGAGCCCAGGGCAGCAGG - Exonic
1002317308 5:178351433-178351455 CAGCCTCTGCCCAGGGAACTGGG + Intronic
1003260049 6:4508816-4508838 CAGGCTCAGCCCAGGCCATCTGG - Intergenic
1003600672 6:7514301-7514323 CAGTCTCAGCACAAGGCATCTGG - Intergenic
1004859227 6:19784198-19784220 CATCCCTAGCCCAGGGAACCAGG + Intergenic
1006021163 6:31118423-31118445 CTGGCCCAGCCCAGGGAACCAGG + Intronic
1006727629 6:36211265-36211287 CATCCTCATCCCAGAGAACCGGG + Exonic
1007269442 6:40624897-40624919 CAGCCCCAGCCCTGGGGACCAGG - Intergenic
1007273624 6:40657577-40657599 CAATTTCAGCCCAGAAAACCTGG + Intergenic
1014216605 6:118757789-118757811 GAGACTCAGCCTAGGCAACCTGG + Intergenic
1015568626 6:134599434-134599456 CAGTCTGAGCCCAGGGTAAAGGG - Intergenic
1016618526 6:146080584-146080606 CAGACTCTGACCAGGGAACTAGG - Intronic
1017664223 6:156703700-156703722 CAGTGTCTGCCCAGGGACACAGG - Intergenic
1018048038 6:159981801-159981823 ATGTCAGAGCCCAGGGAACCAGG - Intronic
1018131641 6:160737544-160737566 CAGTCCAATCCCAGGGAACCTGG + Intronic
1018784619 6:167098468-167098490 CAGCCTGAGGCCAGGGAACCAGG - Intergenic
1018841158 6:167518106-167518128 CAGCCTCAGCCCAGAGGACAGGG + Intergenic
1019316417 7:388990-389012 CTGTGTCCGCCCAGGGAGCCGGG + Intergenic
1019417872 7:935532-935554 GAGGCTCAGCCCAGGGACCCCGG + Intronic
1020074121 7:5246538-5246560 CAGTCATTTCCCAGGGAACCTGG + Intergenic
1020129114 7:5549482-5549504 CAGTTACAGCCCAGAGACCCAGG - Intronic
1020382966 7:7566723-7566745 CAGTCCCAGCCTAGGAACCCGGG + Intergenic
1024984456 7:55183097-55183119 CAGCCACAGCCCAGGGATGCTGG - Intronic
1025819394 7:64947905-64947927 CAGTCTCGGCTCGGGGAGCCCGG - Intergenic
1026538697 7:71261682-71261704 CTGTCACAGCCAAGGGCACCAGG - Intronic
1032848171 7:135769555-135769577 AAGCCTCAGCCCTAGGAACCAGG - Intergenic
1033165349 7:139035164-139035186 CAGTCTCACCCCAGGAAACAGGG - Intronic
1033314069 7:140283348-140283370 CAGTCCCAGCAAAGGGCACCTGG + Intergenic
1034545049 7:151784137-151784159 TTGTCTCAGCCCTGGGAACGAGG - Intronic
1034622010 7:152463849-152463871 CCGCCTCAGCCCAGAGGACCCGG - Intergenic
1034949043 7:155284699-155284721 CCGTGTCATCCCTGGGAACCTGG + Intergenic
1034983707 7:155494694-155494716 CAGTTCCAGGACAGGGAACCTGG - Intronic
1034983727 7:155494766-155494788 CAGTTCCAGGACAGGGAACCTGG - Intronic
1035682743 8:1500360-1500382 GAGGCTCTGCCCAGGAAACCAGG - Intergenic
1035682760 8:1500453-1500475 GAGGCTCTGCCCAGGAAACCAGG - Intergenic
1035867127 8:3096972-3096994 CATTCTCAGTCCAGGGTATCCGG - Exonic
1036001146 8:4606408-4606430 CACTGTGAGCCCAGGGAGCCAGG - Intronic
1036414033 8:8530125-8530147 CAGTCTCAGCACAAGAAACCTGG - Intergenic
1037048794 8:14342933-14342955 CACACACAGCCCAGGGACCCTGG - Intronic
1037689701 8:21171771-21171793 GAGTCTCACCCCAGGGTCCCCGG - Intergenic
1037719293 8:21429308-21429330 GAGCCTCAGCCCTGGGAAGCTGG - Intergenic
1038773000 8:30501380-30501402 CAGTTTCATGCCAGGGAGCCAGG - Intronic
1045056202 8:98370245-98370267 CATTCTCAGGCCAGTGGACCAGG + Intergenic
1045573405 8:103393311-103393333 CAGTCCCAGCCTAGGAAGCCTGG + Intergenic
1047523253 8:125611916-125611938 CAGTCCCAGCCCAGAGAAACAGG - Intergenic
1047985050 8:130224099-130224121 CAGGCTCAGCACTGGGAACTGGG - Intronic
1048865303 8:138756378-138756400 CCGTCATAGCCCAGGGGACCTGG - Intronic
1049560849 8:143309554-143309576 CAGCATCAGCCCAGGCAAGCAGG + Intronic
1049593913 8:143474826-143474848 CCCTCCCAGCCCAGGGAAACAGG - Intronic
1055282727 9:74693218-74693240 CACTCTCATCCCTGGGAACAGGG + Intergenic
1057491833 9:95526097-95526119 CAGTCTCCTCCAAGGGAACGAGG + Intergenic
1058434716 9:104951748-104951770 AAGTCTCAGCCCAGGGCACCTGG + Intergenic
1062030580 9:134360164-134360186 CAGGCCCTGCCCAGGGATCCTGG - Intronic
1062268202 9:135696935-135696957 CAGCCTCTGCCCAGGGGCCCTGG + Intronic
1062280866 9:135751072-135751094 AAGGCTCAGCCCTGGGACCCGGG - Intronic
1062646837 9:137552031-137552053 TAGTCGCGGCCCCGGGAACCCGG - Intronic
1187871947 X:23771824-23771846 TAGTCTCAGCCCAGGTACTCAGG + Intergenic
1189251019 X:39600766-39600788 CAGGCTGAGCCCCAGGAACCTGG + Intergenic
1189354960 X:40303697-40303719 CAGTCTCTGCCCAGGTAATATGG + Intergenic
1189725648 X:43965874-43965896 AAGTCTCAGCCCAGGGCTTCTGG - Intronic
1190043666 X:47094020-47094042 CAGTCTCAGCCCAGCTACTCGGG - Intergenic
1191942861 X:66499262-66499284 CATTCTCAGCCCAGGCCTCCGGG - Intergenic
1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG + Intergenic
1200011435 X:153123636-153123658 CTGTCCCTGCCCAGGGCACCTGG + Intergenic
1200012132 X:153127218-153127240 CTGTCTCCGCGCAGGGCACCTGG + Intergenic
1200027468 X:153272701-153272723 CTGTCTCCGCGCAGGGCACCTGG - Intergenic
1200028165 X:153276286-153276308 CTGTCCCTGCCCAGGGCACCTGG - Intergenic
1200045892 X:153400937-153400959 CCCTCTCCGCCCAGGGACCCAGG + Intergenic
1200226513 X:154420589-154420611 CAGCCCCAGCCCAAGCAACCCGG - Intronic
1201849025 Y:18456596-18456618 CAATCACAGTCCAGGGAACCAGG + Intergenic
1201884293 Y:18863779-18863801 CAATCACAGTCCAGGGAACCAGG - Intergenic