ID: 1172112107

View in Genome Browser
Species Human (GRCh38)
Location 20:32553106-32553128
Sequence ATTTGCTGGTGGAAATGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 327}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172112107_1172112115 2 Left 1172112107 20:32553106-32553128 CCGCCCCATTTCCACCAGCAAAT 0: 1
1: 0
2: 3
3: 32
4: 327
Right 1172112115 20:32553131-32553153 TGTGGCGCGCCCTTCAAAACAGG 0: 1
1: 0
2: 0
3: 1
4: 17
1172112107_1172112118 13 Left 1172112107 20:32553106-32553128 CCGCCCCATTTCCACCAGCAAAT 0: 1
1: 0
2: 3
3: 32
4: 327
Right 1172112118 20:32553142-32553164 CTTCAAAACAGGCCTAGAATCGG 0: 1
1: 0
2: 0
3: 20
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172112107 Original CRISPR ATTTGCTGGTGGAAATGGGG CGG (reversed) Intronic
900405259 1:2490189-2490211 AGGTGCTGGTGGGAATGGGGTGG - Intronic
901804882 1:11732150-11732172 AATTGCTGCTGGAACTGCGGTGG - Intergenic
903213448 1:21830902-21830924 AGATGGTGGTGGATATGGGGAGG + Intronic
903567856 1:24282454-24282476 ATTTTTTTGTGGAGATGGGGGGG + Intergenic
903896249 1:26607214-26607236 ATTTGCTGATGGATATGATGAGG + Intergenic
903975281 1:27145739-27145761 ATTTGCTGGGGTAATTTGGGGGG + Intronic
904111203 1:28127957-28127979 TTGGGCTGGTGGAGATGGGGAGG + Intergenic
905013770 1:34763398-34763420 ACTTGCAGGTAGAAAAGGGGAGG - Exonic
905140958 1:35844018-35844040 AATTGCTGGGGGAAAAGTGGTGG + Intronic
905876638 1:41435810-41435832 ATAAGCTGCTGGGAATGGGGAGG - Intergenic
907171261 1:52467440-52467462 ATTTGCTGATGGAAAATGTGAGG - Intronic
907283158 1:53363672-53363694 ATTTCTTGGTGGGAATGGGGTGG - Intergenic
907334545 1:53691626-53691648 AGTGGCTGGTGGAAAAGGTGTGG - Intronic
907363717 1:53943586-53943608 ATTTGGCGGTGGAAATGTGAGGG + Intronic
907732339 1:57079380-57079402 ATCTGCTGGTGGAGATGGAGAGG - Intronic
908064929 1:60392517-60392539 ATTTTCTGGAGGTAAGGGGGAGG + Intergenic
908796007 1:67832644-67832666 ATTTGCAAGTGGTAAGGGGGAGG - Intronic
911509266 1:98791372-98791394 AATTGGAGATGGAAATGGGGGGG - Intergenic
911698612 1:100924406-100924428 ATATGCTGGTGGGAAGGGGTGGG - Intronic
913353451 1:117889471-117889493 AAATGCTGGTGGTATTGGGGTGG - Intronic
915461161 1:156071301-156071323 ATCTGGTGGGGTAAATGGGGAGG + Intergenic
915572074 1:156750340-156750362 AGTTGCTGGAGGAAAGGAGGGGG - Intronic
915675547 1:157526702-157526724 ATTTGGTGGTGGGAGTGGAGGGG + Intronic
915944480 1:160139992-160140014 CTTTGCTGGGGGGAATGTGGAGG - Intronic
916178561 1:162064038-162064060 ATTTTTTGGTGGTAATGGGGAGG + Intergenic
916910914 1:169345402-169345424 ATTTTCTAGTAGAGATGGGGGGG + Intronic
917536585 1:175878575-175878597 CTTGGCTGGTGCAAGTGGGGAGG + Intergenic
919144289 1:193613838-193613860 ATTTGGTGGTAGGAAAGGGGAGG - Intergenic
919702374 1:200643908-200643930 ATGTGCTTGTGGAACTGTGGGGG + Intronic
920043753 1:203120549-203120571 ATTTGCTGGCTGGGATGGGGTGG + Intronic
920244272 1:204576222-204576244 TTTTGCTGGTGGGAAGGGGTAGG - Intergenic
921352439 1:214249983-214250005 TATTACTGGTGGAAAAGGGGGGG - Intergenic
921359079 1:214313808-214313830 ATTTGCTGCTGGAAGGGTGGAGG - Intronic
921898749 1:220428387-220428409 CTTTTCAGGTGGAAATTGGGGGG + Intergenic
922896205 1:229102490-229102512 TTTTCCTGGGGGAATTGGGGTGG - Intergenic
1066332183 10:34436261-34436283 ATTTGTTGGAGGAAAGGGGAAGG + Intronic
1066447241 10:35494239-35494261 ATTTTTTTGTAGAAATGGGGGGG - Intronic
1068779050 10:60899887-60899909 AATTGCTGTTGAAAATGAGGTGG + Intronic
1069696018 10:70386091-70386113 TTTTTCTGGTGGATGTGGGGTGG - Intergenic
1070319794 10:75345944-75345966 ACTTGCTGGTGGATATGGAGGGG + Intergenic
1070406761 10:76104419-76104441 AGTTGCAGGTGGCAATGGGAGGG - Intronic
1071640280 10:87300325-87300347 GCTTGCTGGAGGAAATGGAGAGG - Intergenic
1071975245 10:90948788-90948810 ATTTTCTGATGGAAAAGTGGTGG + Intergenic
1072430526 10:95367016-95367038 ATTTGCTGGTTCTTATGGGGAGG - Intronic
1072522334 10:96239511-96239533 ATTTTCTGGTGGAAGTTGAGAGG + Intronic
1074295100 10:112179266-112179288 ATTTGGTGGTGGTAATGGTTTGG - Intronic
1075340543 10:121644138-121644160 ATTTCCTGTAGGATATGGGGTGG - Intergenic
1075716614 10:124559352-124559374 ATCTGCTGGTGGAACATGGGTGG + Intronic
1075929356 10:126282345-126282367 ATTTGCTGGGGGGAAGGGAGAGG + Intronic
1076638519 10:131899156-131899178 ATTTGCTGATGGAAAAGATGCGG - Intergenic
1077597635 11:3547625-3547647 CTTTGCTGGTGGCAGTGGGCTGG - Intergenic
1078849570 11:15151484-15151506 ATTTACTGGTGGAAGTGAAGGGG + Intronic
1082225967 11:49707205-49707227 ATGTGTTGGTGGGAGTGGGGAGG - Intergenic
1082547914 11:54356409-54356431 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1082548070 11:54358456-54358478 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1082548224 11:54360503-54360525 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1082548537 11:54364596-54364618 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1082548854 11:54368692-54368714 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1082548932 11:54369717-54369739 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1082549244 11:54373810-54373832 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1082551370 11:54402478-54402500 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1082551831 11:54408621-54408643 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1082552451 11:54416811-54416833 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1082552918 11:54422952-54422974 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1082553265 11:54527616-54527638 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1082553421 11:54529664-54529686 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1082553576 11:54531711-54531733 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1082553729 11:54533758-54533780 ATCTGCAGGTGGACATTGGGAGG + Intergenic
1084253734 11:67923531-67923553 CTTTGCTGGTGGCAGTGGGCTGG - Intergenic
1084475981 11:69390108-69390130 ATTCGCTGGTGGAAGTCGGTGGG - Intergenic
1084819143 11:71672395-71672417 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
1086320340 11:85640041-85640063 AAAGGCTGGGGGAAATGGGGAGG + Intergenic
1086412855 11:86559468-86559490 ATGTCCTGGGGGAAATGGGAAGG - Intronic
1086869800 11:92023779-92023801 GTTTGCTGGTGATAATGGGTGGG - Intergenic
1087642897 11:100774607-100774629 AGTTGGTGGTGGGAATGGGTAGG + Intronic
1088588701 11:111381777-111381799 ATTTGCTGGAAGAAATGAGCTGG - Intronic
1089459080 11:118642233-118642255 ATCTGGAGGTGGGAATGGGGAGG - Exonic
1089650105 11:119907429-119907451 ATGGGCTGGAGGAAATGGAGGGG + Intergenic
1089747560 11:120627812-120627834 ATTTCATGCTGGAAAAGGGGAGG - Intronic
1092423808 12:8356918-8356940 CTTTGCTGGTGGCAGTGGGCTGG - Intergenic
1093184880 12:16008383-16008405 ATTTGCCAGTGTAGATGGGGTGG + Intronic
1093786099 12:23193641-23193663 ATGTTCTGGTGGCAATGTGGAGG - Intergenic
1094028127 12:25980631-25980653 GTTAGCTGGTGGGAGTGGGGTGG + Intronic
1094207113 12:27852227-27852249 ATTTTCTGGTTGTAATGTGGTGG + Intergenic
1096192021 12:49625614-49625636 CTTTGGTGGTGGGAAAGGGGTGG + Intronic
1096592275 12:52668211-52668233 AGCTGCTGATGGAAATGGGCTGG + Intergenic
1096631094 12:52927262-52927284 ATTTCCTGCTGGAGTTGGGGAGG - Intronic
1098138073 12:67423770-67423792 AGTTGGTGGAGGAAATAGGGAGG - Intergenic
1099210891 12:79787188-79787210 ATTTGTGGGTGGAAATGGAATGG - Intronic
1100753093 12:97720872-97720894 AATTGCAGGTGCAGATGGGGTGG + Intergenic
1100916010 12:99422786-99422808 AAATGCTGATGGAAATGAGGTGG + Intronic
1101508267 12:105368658-105368680 ATTTGCTGTTTGGGATGGGGTGG + Intronic
1103447575 12:121004180-121004202 CTTTGCTGGTGGGAATGGAGAGG + Exonic
1104410791 12:128556059-128556081 ATTTGCTGGAGGCATTGGGGTGG + Intronic
1104553664 12:129780325-129780347 ATTTGTTGGTGGGGAGGGGGGGG + Intronic
1105837788 13:24225673-24225695 TGGTGCTGGTGGAAATTGGGAGG + Intronic
1106404782 13:29464029-29464051 GTTGGCTGGTGGAGATGGCGTGG + Intronic
1106543112 13:30707481-30707503 ATTTTCTGGTGCAAGTGGGTGGG - Intergenic
1106836167 13:33637314-33637336 ATGTGGTGGTGGAAATGTAGAGG - Intergenic
1107305491 13:39014015-39014037 AAGAGCTGGTGGAAAAGGGGAGG + Exonic
1108477698 13:50837212-50837234 ATTTTCAGCTGGAAATGGTGTGG - Intronic
1109476628 13:62887358-62887380 ATGTGCTGGTGGGGAAGGGGAGG + Intergenic
1110281479 13:73698893-73698915 ATTGGGTGTTGGAAATGGGTGGG + Intronic
1113596753 13:111539285-111539307 CTTTACTGGTGGAAATGGTGTGG - Intergenic
1114350030 14:21839996-21840018 AGTTGTTGGTGGGAATGGGAAGG + Intergenic
1115984515 14:39090042-39090064 ATTTGCAGGTTTAAATGGGGAGG - Intronic
1117637953 14:57766356-57766378 CTTTGCTGTAGGAAATGGAGGGG + Intronic
1120655137 14:87180160-87180182 AATTGCTGTTGTAAATGTGGAGG - Intergenic
1120889195 14:89476695-89476717 ATCTCCTGGTGGAAATGTGGCGG - Intronic
1121406440 14:93722014-93722036 TGATGCTGGTGGTAATGGGGTGG + Intronic
1121406457 14:93722084-93722106 TGATGCTGGTGGTAATGGGGTGG + Intronic
1121406474 14:93722154-93722176 TGATGCTGGTGGTAATGGGGTGG + Intronic
1121406483 14:93722189-93722211 TGATGCTGGTGGTAATGGGGTGG + Intronic
1121406492 14:93722224-93722246 TGATGCTGGTGGTAATGGGGTGG + Intronic
1121406501 14:93722259-93722281 TGATGCTGGTGGTAATGGGGTGG + Intronic
1121406510 14:93722294-93722316 TGATGCTGGTGGTAATGGGGTGG + Intronic
1122878902 14:104681176-104681198 ATATGCAGGAGGAAATGGGGCGG + Intergenic
1202834763 14_GL000009v2_random:69436-69458 AGTGGGTGGTGGATATGGGGAGG + Intergenic
1124940646 15:34214325-34214347 AGTTGCTGGTGGAGGTGGTGGGG + Intergenic
1128293652 15:66498322-66498344 ATTTGGCCCTGGAAATGGGGAGG + Exonic
1128455314 15:67828392-67828414 TTTTGTTGATGGGAATGGGGAGG + Intronic
1128817022 15:70617856-70617878 ATTAGGTGGTGGGAGTGGGGTGG - Intergenic
1130109603 15:80953711-80953733 AGTTGCTGGAGGAAAGGGGGTGG + Intronic
1130883504 15:88074716-88074738 GTTTGATGGTAGAAATGGGATGG - Intronic
1131436724 15:92428666-92428688 ATTTCCAAGGGGAAATGGGGAGG + Intronic
1132227624 15:100154765-100154787 ATTTGCTGGGGGATGAGGGGTGG - Intronic
1133374469 16:5273022-5273044 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
1135328340 16:21542057-21542079 CTTTGCTGGCGGAAGTGGGTTGG + Intergenic
1136174232 16:28506535-28506557 CTTGGCTAGTGGGAATGGGGAGG - Intronic
1136338687 16:29628030-29628052 CTTTGCTGGCGGAAGTGGGTTGG + Intergenic
1137746027 16:50820728-50820750 ATGGGCTGGTGGAAATGGGAAGG + Intergenic
1138140555 16:54564799-54564821 ATGAGCTGGTGGAAATGTGAAGG - Intergenic
1138459164 16:57137908-57137930 AGGTCATGGTGGAAATGGGGAGG - Intronic
1138729754 16:59182180-59182202 ACATGCTGGTGGCAACGGGGTGG + Intergenic
1139802290 16:69533021-69533043 GTTTCATGGTGGGAATGGGGAGG - Intergenic
1140579937 16:76218171-76218193 GTTTAGAGGTGGAAATGGGGTGG - Intergenic
1140620306 16:76721858-76721880 ATTTGCTACGGGAAATGGAGTGG - Intergenic
1141049491 16:80747572-80747594 AGTAGCTGGTGGGAATGGGGTGG + Intronic
1141126922 16:81407576-81407598 ATTTGGTGGTGGCAGTGGGCAGG - Intergenic
1141722032 16:85761734-85761756 ATTTAATGGTGTAAATGGGTGGG + Intergenic
1141757681 16:86003218-86003240 TTTTGGTGGTGGTAGTGGGGCGG + Intergenic
1142010703 16:87712370-87712392 ATGTGCTGGTGGGAATGAGGCGG - Intronic
1142041374 16:87896596-87896618 CTTTGCTGGTGGAAGTGGGTTGG + Intronic
1142120930 16:88386382-88386404 AGTCGCCGGTGGAGATGGGGCGG - Intergenic
1143654859 17:8288270-8288292 AATTACTTGTAGAAATGGGGCGG - Exonic
1145423911 17:22869881-22869903 ATTTGCAAGTGGACATTGGGAGG + Intergenic
1145431846 17:22979325-22979347 ATTTGCAAGTGGACATTGGGAGG + Intergenic
1145432197 17:22984084-22984106 ATTTGCAAGTGGACATTGGGAGG + Intergenic
1145446756 17:23185153-23185175 ATTTGCAAGTGGACATTGGGAGG + Intergenic
1145911471 17:28545970-28545992 CCTTGCTGGGGGAAGTGGGGTGG - Intronic
1146590236 17:34122452-34122474 AGTGGCAGGTGGAACTGGGGAGG - Intronic
1147977852 17:44258261-44258283 ATTGTCTGATGGGAATGGGGCGG + Intronic
1148699113 17:49577354-49577376 ATTTGGTGGTGACACTGGGGTGG - Intronic
1149304731 17:55336377-55336399 TTTTGCAGGTGGAAATATGGAGG + Intergenic
1149342444 17:55700568-55700590 ATCCACAGGTGGAAATGGGGCGG + Intergenic
1150210987 17:63441407-63441429 ATTTGCTGATGGGAATTTGGGGG - Intronic
1150256052 17:63745678-63745700 GTTTTCTGGTGGGAGTGGGGTGG - Exonic
1150570571 17:66382840-66382862 TCTTGTTGGTGGTAATGGGGGGG - Intronic
1150856733 17:68760290-68760312 ATTGGCTGGTGCAAATGTAGGGG + Intergenic
1151521938 17:74636457-74636479 GTTTCCTGGTGGAAATGTAGAGG - Intergenic
1153750786 18:8228142-8228164 ATTTGCAGGTGGATATTGGAGGG + Intronic
1154496101 18:14962695-14962717 CTCTGCGGGTGGAGATGGGGAGG + Intergenic
1155082084 18:22420348-22420370 CTTTGCTGGTAGAGATGGAGTGG - Intergenic
1160288870 18:77572168-77572190 ATTTGCTAGTGGCAGTGGGGAGG + Intergenic
1161883836 19:6977498-6977520 TTTGGCTGGTAGAAATGGAGTGG + Intergenic
1163208212 19:15819773-15819795 AATTGTTGGTAGAGATGGGGGGG - Intergenic
1163506318 19:17709129-17709151 TTTGGCTGGTGGTAGTGGGGAGG + Intergenic
1164514626 19:28923206-28923228 CTAGGCTGGTGGAAATTGGGAGG + Intergenic
1165598763 19:37034948-37034970 CTTTGCTGAGGGAAATAGGGTGG + Intronic
1165881356 19:39046273-39046295 ACTTCCTGGTAGAAAAGGGGCGG - Intergenic
1166882184 19:45936297-45936319 CTTGGCTGGTGGAATTTGGGGGG + Exonic
1168097122 19:54122238-54122260 CCTTGCTGGTGGGAATGCGGAGG - Intronic
1202637940 1_KI270706v1_random:58257-58279 AGTGGGTGGTGGATATGGGGAGG - Intergenic
925586573 2:5470512-5470534 ATTTGGTGGTGGAACTCAGGCGG + Intergenic
926856501 2:17262217-17262239 ATTTTCTGGTGGAGGAGGGGAGG - Intergenic
929519802 2:42638089-42638111 ATTTGCTTGTTTTAATGGGGAGG - Intronic
930280762 2:49367157-49367179 AATTGATGGTGGCAATTGGGAGG - Intergenic
933691428 2:85182050-85182072 AGCAGCTGGTGGACATGGGGAGG + Intronic
933752818 2:85613937-85613959 ATTTTTTTGTGGAGATGGGGGGG + Intronic
934128162 2:88919533-88919555 CTCTGCTGGTGGGAATGGAGAGG + Intergenic
935417817 2:102837408-102837430 ATTTGCTGTTGTTAATAGGGTGG + Intronic
937014988 2:118596971-118596993 ATTTGATGGAGGAAATTGTGAGG - Intergenic
937108389 2:119341014-119341036 AAATGCTGATGGAATTGGGGAGG - Intronic
937295069 2:120805177-120805199 TTGTGCTTGGGGAAATGGGGCGG - Intronic
937821543 2:126316065-126316087 TTTTGCTGGGGGAAATGACGAGG - Intergenic
939516126 2:143170421-143170443 ATTTGTTGGTGGCAGTGGTGTGG - Intronic
939625965 2:144477816-144477838 CTTTGCTGATGGAGATGAGGAGG + Intronic
940020873 2:149154661-149154683 ATTTGGTGATGGGGATGGGGTGG + Intronic
940629189 2:156216129-156216151 AATTGCTGGGGGAAATGGTGAGG - Intergenic
943099673 2:183472284-183472306 CATTGCTGGTGGATATGGGAGGG + Intergenic
944405667 2:199380761-199380783 ATGTGCTGGTGGAAATGGCATGG + Intronic
945025309 2:205614980-205615002 ATATGGTGGTAGAAAAGGGGAGG + Intronic
946577628 2:221093474-221093496 CTTTTGTGCTGGAAATGGGGTGG + Intergenic
946889531 2:224260900-224260922 ATTTGCTGGTGGAAGTAGGGTGG - Intergenic
946902025 2:224382031-224382053 ATTTTCTGATAGAAATGGTGAGG + Intronic
948100362 2:235368003-235368025 ATTTGCAGGTGGAGTTGGCGTGG - Intergenic
948966370 2:241383726-241383748 ATTTGCTGGTGCTGATGTGGAGG + Intronic
1168778056 20:464571-464593 TTGTGGTGGTGGGAATGGGGTGG - Intergenic
1169245534 20:4021653-4021675 ATTGGCTGGGGGAAATTGGAGGG - Intergenic
1170997867 20:21382026-21382048 CTTTGCTGCTGGAAAAGGGGAGG - Exonic
1170998547 20:21391060-21391082 TTTTGCTGATTGAAATGGGCAGG - Intergenic
1171884511 20:30642349-30642371 AGTTGGTGGTGGATATGGGGTGG - Intergenic
1172112107 20:32553106-32553128 ATTTGCTGGTGGAAATGGGGCGG - Intronic
1172409645 20:34711632-34711654 ATTTACTGGAGGAGAAGGGGAGG - Exonic
1172714400 20:36951927-36951949 CAGTGCTGGTGGAAAGGGGGAGG + Intergenic
1173381747 20:42550882-42550904 ATTTACTTGTGGTAATGAGGAGG - Intronic
1173716054 20:45207289-45207311 ATTTGTTGGGGGAAAAGTGGGGG + Intronic
1175422794 20:58845882-58845904 ATTCCCGGGTAGAAATGGGGAGG + Intronic
1176844663 21:13867727-13867749 AGTGGGTGGTGGATATGGGGTGG - Intergenic
1176847404 21:13887291-13887313 AGTGGGTGGTGGATATGGGGTGG - Intergenic
1179310375 21:40190246-40190268 AGTGGCTTGTGGAATTGGGGTGG - Intronic
1182504733 22:30773599-30773621 ATTTGTTGGAGGAATGGGGGAGG + Intronic
1183201523 22:36388136-36388158 ATTGGCCTGTGGAAAGGGGGTGG + Intergenic
1184057211 22:42060564-42060586 ATTTGCTGGTGGAGAAGTGATGG - Intronic
1184357007 22:43988752-43988774 ATTTGCAGGTGGAAGTGAGTTGG + Intronic
1184367329 22:44060453-44060475 ACTTGCTGGTGGAAAGATGGTGG + Intronic
1185180439 22:49357493-49357515 ATTTACTGGAGGAAGTGTGGTGG - Intergenic
950426694 3:12928206-12928228 ATTTGCTGATGGATCTGGGTGGG + Intronic
950752809 3:15144260-15144282 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
950844711 3:16003311-16003333 AATTGCTGTGGAAAATGGGGTGG + Intergenic
952890657 3:38038049-38038071 ACTTGCTGGTGGATAATGGGAGG - Intergenic
954453235 3:50582963-50582985 ATATGCTGGTGGTGGTGGGGAGG - Exonic
955701226 3:61684224-61684246 ATATGCTGGTGGTGATGGTGGGG + Intronic
955742859 3:62110793-62110815 ACTTGCTGGTAGAAATTGCGAGG + Intronic
956358148 3:68416722-68416744 AATTGCTGGAGAAAATGGGTAGG - Intronic
956908881 3:73796130-73796152 GTTTGGGGGTGGAAATGTGGGGG + Intergenic
957067804 3:75540003-75540025 CTTTGCTGGTGGCAGTGGGCTGG - Intergenic
958900266 3:99877393-99877415 AGTTGTTAGTGGAAATGGTGTGG + Intronic
960284225 3:115809412-115809434 AGTTGCTGGGGGAGATGGCGGGG - Exonic
960387519 3:117037895-117037917 ATTTTTTGGTAGAGATGGGGGGG + Intronic
961060345 3:123823377-123823399 TTTAGCTGGAGGAAATGGAGAGG - Intronic
961285352 3:125797977-125797999 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
962250053 3:133830558-133830580 TTTTACAGGTGGAGATGGGGAGG - Intronic
962463820 3:135638805-135638827 ATTTGGTGGTGGGAGTGGGGAGG - Intergenic
964372255 3:156012585-156012607 ATTTTGTGGTGGCAATGGGAGGG + Intergenic
964900818 3:161656802-161656824 ATTTGTTGGTGAAAATTGGAAGG - Intergenic
967113317 3:186314969-186314991 AATTGCTGGTGGCCATTGGGGGG - Intronic
968032593 3:195513509-195513531 ATTTGATGGACAAAATGGGGTGG + Intergenic
968962029 4:3750550-3750572 GGTTGCTGGTGGAACTGGAGGGG - Intergenic
969741709 4:9033158-9033180 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
969801076 4:9566055-9566077 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
970299756 4:14668736-14668758 ATTTACTGGAGGAAATCGTGAGG - Intergenic
971148074 4:24001258-24001280 ATTAATTGGTGGAAGTGGGGAGG + Intergenic
971214324 4:24649463-24649485 ATGTGTTTGTGGAGATGGGGTGG + Intergenic
972491336 4:39590324-39590346 AATTGCTTGTGGAATTGAGGTGG + Intronic
972693638 4:41423498-41423520 ATTTGAGAGTGGAAATGGGAGGG + Intronic
973009561 4:45054377-45054399 ATATTTTGTTGGAAATGGGGGGG - Intergenic
973638199 4:52879109-52879131 ATTAGCAGGTGAAAGTGGGGTGG - Intronic
974016069 4:56650329-56650351 ATGTGCTGATGGAGATGGGATGG + Intronic
974657762 4:64847101-64847123 ATTTGCTGGTGGATTTTAGGTGG + Intergenic
974765609 4:66341736-66341758 ATTTGCTGGTAGTAGTGGGATGG - Intergenic
975341174 4:73242795-73242817 GTTTGTGGGTGGAAGTGGGGTGG - Intronic
977522196 4:98098960-98098982 AAATGCTGGTGGCAATGTGGAGG + Intronic
977820123 4:101461430-101461452 ATTAGCTGGGGGAAATGGGGAGG + Intronic
979712054 4:123791319-123791341 ATTTGCTGTTGGCCAGGGGGAGG + Intergenic
979990344 4:127367648-127367670 ATTTTCTGGTTGATCTGGGGAGG - Intergenic
981322710 4:143411135-143411157 ATTTAGGGGTGGAGATGGGGCGG + Intronic
982333754 4:154210952-154210974 CCTGGCTGGAGGAAATGGGGTGG + Intergenic
982457055 4:155622889-155622911 ATGTGTTGGTGGGGATGGGGTGG - Intergenic
982913773 4:161179278-161179300 ATGTTCTGGAGGAAATGGAGTGG - Intergenic
983747182 4:171216056-171216078 ATTTGTTGGTGGAAAGTGTGGGG + Intergenic
983760034 4:171394498-171394520 AATTGCTGGTGGAAATCCAGCGG + Intergenic
983800116 4:171917593-171917615 GTTTGTTGGTGGAAGTGGGGAGG - Intronic
984111468 4:175621644-175621666 ATTGGCTTGTGTAAATGAGGTGG - Intergenic
1202765262 4_GL000008v2_random:144114-144136 AGTGGGTGGTGGATATGGGGAGG - Intergenic
987885102 5:23802331-23802353 ATTTGCTAGTAGAAATGGAAGGG - Intergenic
989130293 5:38100439-38100461 GTTTGCTGATGGGAAAGGGGAGG + Intergenic
990456790 5:55995726-55995748 ATTTTCTGAGGGAAAGGGGGGGG - Intergenic
992262768 5:74987458-74987480 CTTTGCTGCAGGGAATGGGGTGG - Intergenic
992551585 5:77865335-77865357 ATTTGCTGTTGGAAGGGTGGAGG + Intronic
992861609 5:80916566-80916588 GTTTGGTGGTAGAGATGGGGAGG - Intergenic
994217800 5:97158847-97158869 CTTTGCTTGTGGAAAAGGGAGGG - Intronic
994363411 5:98882403-98882425 TTTAGCTGGGGAAAATGGGGGGG + Intronic
994509973 5:100690164-100690186 ATATGGTGGTGGAGGTGGGGCGG + Intergenic
995862709 5:116659234-116659256 ATGTACTGGTGAAAATGGGGTGG - Intergenic
996182961 5:120442470-120442492 ATTTGCTGGTGGCATTGGGAAGG - Intergenic
996549403 5:124713762-124713784 ATCTGTTGGTGGAGAGGGGGAGG + Intronic
998248166 5:140528945-140528967 ACTTGCAGGTAGAAATGTGGTGG - Exonic
998566904 5:143223809-143223831 ATTTGCTGGTGAAAAGAGGCTGG + Exonic
998657771 5:144201309-144201331 ATTTGGTGAGGGAGATGGGGTGG - Intronic
999385575 5:151151745-151151767 ATTGGCGGGTGGAGATGGGGAGG - Intronic
999602005 5:153277241-153277263 ATCTGGTGGTGGAAATGCTGTGG + Intergenic
1000989034 5:167893033-167893055 TTTTGCTGGCGGCAATGTGGAGG + Intronic
1001453614 5:171844704-171844726 ATTTTTTGGGGGAGATGGGGTGG + Intergenic
1002192274 5:177484510-177484532 ATTTCCTGGTGGACCTGGTGTGG - Intronic
1004101866 6:12620816-12620838 TTTGGCTGGGGGAAATGGGCAGG + Intergenic
1005434294 6:25791856-25791878 ATTTGCAGGTGCAAAGGTGGCGG + Intronic
1007591667 6:43024968-43024990 ATGTGCCTGTGGAAGTGGGGAGG - Exonic
1008754036 6:54772211-54772233 ATTGGTTGGTCAAAATGGGGAGG + Intergenic
1011256980 6:85432420-85432442 GTTTTCTGGTGGAAAAAGGGGGG + Intergenic
1015771406 6:136772083-136772105 ATTTTTTAGTAGAAATGGGGGGG + Intronic
1017034352 6:150253520-150253542 ATTTGCCTGTGAAAATGGAGTGG + Intergenic
1018524907 6:164699123-164699145 AGTTGCTGGTTGAAATTGGAGGG - Intergenic
1019622738 7:2000529-2000551 TGTTGGTGGTGGAAATGGTGGGG - Intronic
1020193354 7:6017586-6017608 ATTTGTTGGGGGTAAGGGGGTGG + Intronic
1020456630 7:8381011-8381033 ATGTGCAGGTGGACATGTGGAGG + Intergenic
1020837779 7:13176005-13176027 CTTTCCTGTTGGTAATGGGGTGG + Intergenic
1026273108 7:68853400-68853422 TTTTCTTGGTGGAAATGTGGGGG - Intergenic
1027529738 7:79315506-79315528 ATCTACTGGTGGAAATTTGGTGG - Intronic
1027800545 7:82744586-82744608 AAGTGCTGGAGGACATGGGGTGG - Intergenic
1028248323 7:88509711-88509733 AATTGCTGGTAGAAAAGGGAAGG + Intergenic
1028261187 7:88668336-88668358 ATTTACTGGGTGTAATGGGGGGG + Intergenic
1028266520 7:88733247-88733269 CTCTGCTTGTGGAAATGGGAGGG - Intergenic
1030092464 7:105869592-105869614 AGATGCTGGTGGAATTGGGCTGG - Intronic
1030431543 7:109455283-109455305 TTCTGCTTGTGGAAATGGGAGGG - Intergenic
1032965624 7:137093804-137093826 ATGTGCTGGTGGCAGTGGGGTGG - Intergenic
1035168387 7:157004788-157004810 ATTTGCTTGTAGAAATGATGGGG - Intronic
1036017179 8:4798154-4798176 ATTGGGTGGGGGAAGTGGGGAGG - Intronic
1036253898 8:7188655-7188677 CTTTGCTGGTGGTAGTGGGCTGG - Intergenic
1036363595 8:8098824-8098846 CTTTGCTGGTGGTAGTGGGCTGG + Intergenic
1036887360 8:12568245-12568267 GTTTGCTGGTGGCAGTGGGCTGG - Intergenic
1036894953 8:12626346-12626368 ATTTGCTGGTGGTAGTGGGCTGG - Intergenic
1037261080 8:17009048-17009070 ACTTGAGGGTGGAGATGGGGAGG + Intergenic
1037566991 8:20126418-20126440 TTTGGCTGCTGGAAATGTGGAGG + Intergenic
1037625572 8:20603492-20603514 TTTTGCTGGAGGAAATTGTGTGG + Intergenic
1037988683 8:23305530-23305552 ATTTCCTGGGGGGAATGGGTGGG - Intronic
1038101797 8:24386462-24386484 AGTTTCTGGGGGAAATGGGAGGG + Intronic
1038166703 8:25092573-25092595 ATGTGGTGGGGGCAATGGGGAGG - Intergenic
1039425244 8:37479848-37479870 TTTTGGTGGTGGAAGTGGGGCGG - Intergenic
1039786814 8:40841382-40841404 ATTTGTTGGTGGCAGGGGGGCGG - Intronic
1040899456 8:52403112-52403134 CTTGGATGGGGGAAATGGGGTGG + Intronic
1042387394 8:68193196-68193218 ATTTCCTTGTGGCAATGGAGAGG - Intronic
1042560194 8:70068188-70068210 GTCTGCTGCTGAAAATGGGGCGG - Intronic
1043791490 8:84473070-84473092 ATCTGTTGGGGGAAATGGGCAGG + Intronic
1044440044 8:92212823-92212845 AATTGATGGTGGAAATACGGTGG + Intergenic
1046288264 8:112124840-112124862 ATTTGATTGTGAAAATGGGAGGG + Intergenic
1047095442 8:121620012-121620034 CTTTGCTATTGGAAATTGGGAGG - Intronic
1047513220 8:125531238-125531260 ATGCTCTGGTGGAGATGGGGTGG + Intergenic
1047873444 8:129110047-129110069 ATATGCTGGAGGCAATGGGAAGG - Intergenic
1048750610 8:137669765-137669787 ATTTGCTGGTACAAGTGTGGTGG - Intergenic
1049139232 8:140936641-140936663 ATTTGCTGGTGGAGGTGTGAAGG - Intronic
1049466742 8:142754505-142754527 AGTTCCTGGTGGAACTGAGGAGG - Intergenic
1051941700 9:22513866-22513888 GTTTGCTGATTGTAATGGGGAGG + Intergenic
1052199177 9:25757143-25757165 CTTTACTGGTGGGAATGGGGTGG + Intergenic
1053110271 9:35453681-35453703 CTTTGCCTGTGGAAATGGGAGGG + Intergenic
1054076315 9:60537782-60537804 ATCTGCAGGTGGATATGTGGAGG - Intergenic
1055367038 9:75555730-75555752 ACTTGTTGGTGGTAATGGTGGGG + Intergenic
1056744848 9:89291646-89291668 ATTTGCCGGTGGAAATGAGGAGG - Intergenic
1058513426 9:105744728-105744750 ATGGGGTGGGGGAAATGGGGAGG - Intronic
1059822770 9:117992362-117992384 ATTAGGAGGTGGAAATGGAGAGG + Intergenic
1060405914 9:123373055-123373077 ACTCGCTGGGGGAAGTGGGGAGG + Intronic
1060777734 9:126388670-126388692 AATTGCTGGTGAAGATGTGGAGG - Intronic
1061069273 9:128298959-128298981 GTTTGCTGGTGCAATTGTGGAGG - Intergenic
1061207707 9:129174255-129174277 ACTTGCAGGGGAAAATGGGGAGG + Intergenic
1203399089 Un_KI270519v1:64834-64856 ATTTGCAGGTGGATATTTGGAGG + Intergenic
1203546011 Un_KI270743v1:129003-129025 AGTGGGTGGTGGATATGGGGAGG - Intergenic
1186991267 X:15071100-15071122 ATGTGTTGGTGAGAATGGGGTGG + Intergenic
1188839304 X:34995648-34995670 AAATGCTGGTGAAAATGTGGAGG - Intergenic
1192214848 X:69150930-69150952 CTTTGATGGTGGGAATGGGAGGG - Intergenic
1192529867 X:71874737-71874759 ACTTGCTGGGGGAAAGGGGGAGG + Intergenic
1193851790 X:86546212-86546234 ATCTGCTGGTGGAATTTTGGTGG - Intronic
1193891333 X:87049794-87049816 GTTTCCTGGTGGCAGTGGGGTGG + Intergenic
1194038259 X:88907904-88907926 ACTAGCTGGTGGGAATAGGGAGG + Intergenic
1194546433 X:95240176-95240198 ATTTGCCTTTGGAAAAGGGGAGG + Intergenic
1194604943 X:95966740-95966762 ATTTAATGGTGAAAATAGGGAGG - Intergenic
1194939412 X:99991688-99991710 ATTTGGTGGTGGAGTTGAGGAGG + Intergenic
1195403978 X:104492624-104492646 GGTTGCTGGTGGCAATGGTGGGG - Intergenic
1195568902 X:106377578-106377600 ATTTGCTGTTGGCAATTGGCAGG - Intergenic
1197111878 X:122784765-122784787 ATTTCCTGGTGGAAAAGAGGTGG + Intergenic
1197494600 X:127161949-127161971 AATTGGGGGAGGAAATGGGGTGG + Intergenic
1197872113 X:131070469-131070491 ACTTGGTTGTGGAACTGGGGAGG - Intronic
1198107444 X:133474977-133474999 ATTAGATGGGGGAAAGGGGGAGG + Intergenic
1199728699 X:150609309-150609331 AGTTGCTGGTAGAATTGGAGTGG + Intronic