ID: 1172113259

View in Genome Browser
Species Human (GRCh38)
Location 20:32559855-32559877
Sequence CGGCCAGCCCAGGCCTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 733
Summary {0: 1, 1: 0, 2: 7, 3: 65, 4: 660}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172113253_1172113259 -2 Left 1172113253 20:32559834-32559856 CCAAGCTGTCCCAAGGGACCACG 0: 1
1: 0
2: 1
3: 9
4: 89
Right 1172113259 20:32559855-32559877 CGGCCAGCCCAGGCCTGCCCAGG 0: 1
1: 0
2: 7
3: 65
4: 660
1172113248_1172113259 16 Left 1172113248 20:32559816-32559838 CCCTCTCGCCTGAGTGGGCCAAG No data
Right 1172113259 20:32559855-32559877 CGGCCAGCCCAGGCCTGCCCAGG 0: 1
1: 0
2: 7
3: 65
4: 660
1172113250_1172113259 8 Left 1172113250 20:32559824-32559846 CCTGAGTGGGCCAAGCTGTCCCA 0: 1
1: 0
2: 5
3: 23
4: 192
Right 1172113259 20:32559855-32559877 CGGCCAGCCCAGGCCTGCCCAGG 0: 1
1: 0
2: 7
3: 65
4: 660
1172113245_1172113259 30 Left 1172113245 20:32559802-32559824 CCAGGCGTGGGCATCCCTCTCGC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1172113259 20:32559855-32559877 CGGCCAGCCCAGGCCTGCCCAGG 0: 1
1: 0
2: 7
3: 65
4: 660
1172113249_1172113259 15 Left 1172113249 20:32559817-32559839 CCTCTCGCCTGAGTGGGCCAAGC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1172113259 20:32559855-32559877 CGGCCAGCCCAGGCCTGCCCAGG 0: 1
1: 0
2: 7
3: 65
4: 660

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172113259 Original CRISPR CGGCCAGCCCAGGCCTGCCC AGG Intronic
900127369 1:1074476-1074498 ACCCCAGCCCAGACCTGCCCAGG - Intergenic
900186273 1:1334683-1334705 TGCCCAGACCAGGCCTGCCCAGG + Exonic
900251840 1:1675019-1675041 CCGCCACCACAGGCCTGTCCTGG - Intronic
900262247 1:1737875-1737897 CCGCCACCACAGGCCTGTCCTGG - Intronic
900289664 1:1918618-1918640 AGGCCACCCCTGGCCAGCCCAGG - Intronic
900325897 1:2108498-2108520 CAGCCAGCCCAGGACAGACCTGG - Intronic
900343438 1:2199400-2199422 AGCCCAGCCCAGCCCAGCCCAGG + Intronic
900363249 1:2300070-2300092 AGCCCAGCCCTGCCCTGCCCTGG + Intronic
900380558 1:2381901-2381923 GGGGCAGCCCAGCCCTGTCCCGG - Intronic
900404491 1:2486440-2486462 GGCCCAGCCCAGGCCACCCCAGG - Intronic
900425386 1:2576014-2576036 CTCCCGGCCCAGCCCTGCCCTGG + Intergenic
900641675 1:3690596-3690618 GGGCAAGCTGAGGCCTGCCCCGG + Intronic
900680309 1:3912776-3912798 CGTGCAACCCTGGCCTGCCCTGG + Intergenic
900680313 1:3912784-3912806 CAGCCAGCCCAGGGCAGGCCAGG - Intergenic
900780104 1:4612374-4612396 CTGGCAGCCCAGGAATGCCCAGG - Intergenic
901008141 1:6181463-6181485 CGGCCAGCACTGGGCTGACCCGG - Intronic
901081751 1:6587670-6587692 CTGCCAGCCCAGGCTTGCACCGG + Intronic
901207721 1:7506309-7506331 AGCCCAGCCCAGCCCTGCCCTGG + Intronic
901316437 1:8312941-8312963 CGGCATGCCCAGGGCAGCCCAGG + Intergenic
901373270 1:8818057-8818079 CCGCCAGCCCGGCCCAGCCCGGG - Intergenic
901657974 1:10781449-10781471 CAGGCAGTCCAGGCCAGCCCAGG + Intronic
902326335 1:15703194-15703216 CTGCCAGGCCAGGCCGGGCCGGG + Intronic
902817163 1:18922937-18922959 AGGCCACCCCATCCCTGCCCAGG + Intronic
903181456 1:21607023-21607045 CCGGCTGCCCAGGCCTGCCCAGG - Intronic
903277968 1:22233585-22233607 GGGCTAGCCCAGAGCTGCCCTGG - Intergenic
903344796 1:22677262-22677284 CGGCAAACACAGGCCTGGCCGGG + Intergenic
903554628 1:24184472-24184494 CGGCCTGGCCAGGCCAGGCCAGG - Intronic
903741455 1:25560835-25560857 GGGACTGCTCAGGCCTGCCCAGG - Intronic
903745208 1:25582023-25582045 TGGGAAGCCCAGGCCTGCGCTGG - Intergenic
904465355 1:30704449-30704471 AGCCCAACCCAGGCCAGCCCAGG + Intergenic
905028377 1:34866054-34866076 CGGCCCGCCCAGCCCGGCCCGGG - Exonic
905233389 1:36529504-36529526 GGGACAGCACAGCCCTGCCCTGG - Intergenic
905434422 1:37946920-37946942 CCTCCTGCCCAGCCCTGCCCTGG + Intronic
905872446 1:41412860-41412882 GGGCAAGCCCAGACCGGCCCTGG - Intergenic
905883559 1:41479664-41479686 CAACCAGCGCAGGCCAGCCCAGG + Intronic
905884086 1:41482407-41482429 CTGCAAGCCCGGGCATGCCCTGG - Intronic
906308724 1:44738285-44738307 CTGCCAGCCCTGGCCTCCCGAGG + Intergenic
906477713 1:46181039-46181061 GGGCCAGCCCAGGTGGGCCCAGG + Intronic
906559916 1:46748830-46748852 AGGCCAGCCCAGGTCATCCCTGG - Intergenic
906609144 1:47190137-47190159 CTGCCAGACCTGGCCTCCCCTGG + Intronic
906956702 1:50381256-50381278 CCGCCAGCCCCGGCCTCCCGAGG + Intergenic
910213070 1:84813808-84813830 CGGCCCACCCAGGCCTCCTCTGG - Exonic
911188547 1:94926784-94926806 AGGCCAGCCCAAGGGTGCCCCGG + Intronic
912384818 1:109266007-109266029 AGGCCTCCCCAGGCCTCCCCAGG - Intronic
912554773 1:110508142-110508164 CGGCCTCCCCAGCCCCGCCCAGG - Intergenic
912564946 1:110580746-110580768 TGGCCAGCCCAGGCCTGACTTGG + Intergenic
912687094 1:111776135-111776157 CGGCCACCCCCTGCCAGCCCAGG - Exonic
912775130 1:112502088-112502110 CGCTCAGGCCAGGCCTGGCCAGG - Intronic
912942975 1:114061235-114061257 GGGCCTGCCCATGGCTGCCCAGG + Intergenic
914449810 1:147781119-147781141 TGGCCAGCTCAGCCCTTCCCTGG + Intergenic
914893964 1:151651954-151651976 CCGCCAGCCTCGGCCTCCCCAGG - Intronic
914901578 1:151714017-151714039 CCTCCAGCCCAGACCTGCCCAGG + Intronic
914901582 1:151714027-151714049 AGACCTGCCCAGGCCTGCCCAGG + Intronic
915299886 1:154945905-154945927 CGGGCACCCCAGGGCTGCTCAGG - Exonic
915502224 1:156327534-156327556 CCGCCAGCCCCGGCCTCCCGAGG + Intronic
915530778 1:156500947-156500969 CGGCCTGGCCCGGCCAGCCCTGG - Intergenic
915588987 1:156860125-156860147 CGGCCAGCCAGCGCCGGCCCCGG - Intronic
915954095 1:160208644-160208666 TGGCCAGGCCAGACCAGCCCAGG + Intronic
918310729 1:183283481-183283503 GGGCCTGCCCTGGCCTGCTCTGG + Intronic
920001998 1:202807241-202807263 AGCACAGCCCAGGCCTCCCCGGG + Intronic
920033101 1:203048992-203049014 CGGCCAGCCCCGCCCAGCCTGGG + Intronic
920674461 1:208029539-208029561 CAGCCAGGCCAGGCCAGCCCTGG - Intronic
921766937 1:218983412-218983434 CGGGCTGCCCATGGCTGCCCAGG - Intergenic
921995968 1:221418735-221418757 TGGCCCGCCCAGGCTTGGCCAGG - Intergenic
922882460 1:228991046-228991068 CTCCCAGGCCAGGGCTGCCCAGG + Intergenic
924502742 1:244652751-244652773 CTACCAGACCAGGCCTCCCCGGG - Intergenic
1063143443 10:3275633-3275655 CATCCAGACCATGCCTGCCCTGG + Intergenic
1063676040 10:8141275-8141297 CTGTCAGCCCCGCCCTGCCCCGG - Intergenic
1064230687 10:13528167-13528189 CGGCCGCCCCAGCCCTGCCCCGG + Intronic
1064714932 10:18167020-18167042 GGGCCAGCCCAGGGCTTTCCAGG - Intronic
1065343002 10:24723747-24723769 CGACCTGCCCCGGCCGGCCCCGG + Intergenic
1066693565 10:38057834-38057856 CATACAGCCCAGGGCTGCCCAGG + Exonic
1067068327 10:43115896-43115918 GGGCCAGACCAGGACAGCCCAGG + Intronic
1067155603 10:43779027-43779049 CAGCTTCCCCAGGCCTGCCCGGG - Intergenic
1067416448 10:46106555-46106577 TGGGCAGCCCAGTCCTCCCCGGG - Intergenic
1067436582 10:46283033-46283055 TGGGCAGCCCAGCCCTCCCCGGG - Intergenic
1069581886 10:69572244-69572266 TGGCCGGCCCAGGCCTCCACGGG - Exonic
1069949406 10:72008704-72008726 GGGCCTGCCTAGGCCTGCTCAGG - Exonic
1069993312 10:72328246-72328268 CGGCCGCCCCAGTGCTGCCCTGG - Intergenic
1070473341 10:76806936-76806958 CTACCAGCCCAGGACTGCCATGG - Intergenic
1070834351 10:79438539-79438561 TGGCCAGCCCAGCACTGTCCTGG - Intronic
1071337192 10:84610460-84610482 CTGCCAGCTCAGGCATGCCTGGG + Intergenic
1072139127 10:92574204-92574226 CGGACAGCCGAGGCCTGAGCAGG + Intergenic
1073176284 10:101559565-101559587 CAGCCAGCCCAACCCTCCCCTGG + Intergenic
1073181471 10:101586043-101586065 CGGCCAGCTATGCCCTGCCCAGG - Exonic
1075003888 10:118817048-118817070 CTGCCAGCCTAGCCCTGCTCAGG - Intergenic
1075060264 10:119252274-119252296 TGGGCAGCCCAGGCCTGCGACGG + Intronic
1075188487 10:120284658-120284680 CGGCCAGGCCATGTCAGCCCTGG - Intergenic
1075686018 10:124365692-124365714 AGGCCAGCACAGGTGTGCCCAGG + Intergenic
1076168374 10:128300437-128300459 CGCACAGCCCAGGCCTGGACCGG - Intergenic
1076402584 10:130193640-130193662 AGGCCTTCCCAGGCCTTCCCAGG + Intergenic
1076496616 10:130901596-130901618 AGGCCAGCCCAGGGATGCACTGG - Intergenic
1076501304 10:130938287-130938309 CGGCCAGCCCTCACCTGCACTGG + Intergenic
1076563372 10:131381817-131381839 CCTCCACCCCAGGCCTCCCCAGG + Intergenic
1076676947 10:132152049-132152071 TGGCCTGCCCAGCCCTGCCATGG + Intronic
1076752093 10:132548364-132548386 CGGGCAGCAGAGGCCTGGCCTGG - Intronic
1076765679 10:132631650-132631672 CAGGCAGCACAGGCCTGCCCAGG - Intronic
1076824399 10:132959865-132959887 TGGCCAGCCCAAGTCTCCCCTGG - Intergenic
1076845895 10:133069436-133069458 CTGCCCTCCCACGCCTGCCCTGG - Intergenic
1076904621 10:133355863-133355885 GGGCCAGCCCTGGACTCCCCAGG + Intronic
1076905111 10:133357599-133357621 CGGCCACCCAACCCCTGCCCCGG + Intronic
1076919932 10:133446173-133446195 CGTCCGGGCCAGCCCTGCCCTGG + Intergenic
1077103528 11:832476-832498 CTGGGACCCCAGGCCTGCCCGGG + Intergenic
1077111521 11:864186-864208 AGGGGAGCCCAGGCCAGCCCAGG + Intronic
1077174330 11:1181746-1181768 CTGGCAGCCCAGGCTGGCCCCGG + Intronic
1077278895 11:1733085-1733107 CTTCCAGCCCAGGCTTGTCCAGG + Exonic
1077298864 11:1838167-1838189 GGGCAATGCCAGGCCTGCCCGGG + Intergenic
1077356832 11:2122645-2122667 CAGCCAGCCCAGGCCTCAGCCGG - Intergenic
1077361862 11:2144392-2144414 TGGCCACCTCCGGCCTGCCCCGG + Intronic
1077491329 11:2862324-2862346 CGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1077500862 11:2909279-2909301 CCTCCAGCCCGGCCCTGCCCGGG + Exonic
1077507905 11:2940644-2940666 GGCCCAGCCCAGCCCAGCCCAGG - Intergenic
1077539035 11:3138114-3138136 CGGCCAGGCCAGCCCGTCCCCGG + Intronic
1077545650 11:3168460-3168482 TGGCCACCCCAGCCCTTCCCAGG - Intergenic
1077615148 11:3668994-3669016 AGGCTATCCCAGGCCAGCCCAGG - Intronic
1077900318 11:6482110-6482132 CGTGCAGCTCATGCCTGCCCTGG + Exonic
1078083303 11:8219059-8219081 CAGCCAGCACAGGCCAGGCCCGG + Intergenic
1078335068 11:10456764-10456786 CTGCCAGGCCAGGCCTGACAAGG - Intronic
1078451085 11:11441444-11441466 TGCCCTGCCCAGCCCTGCCCAGG - Intronic
1079367051 11:19818648-19818670 GAGCCAGTCCATGCCTGCCCTGG + Intronic
1082786988 11:57322705-57322727 CTCCCAGCCCAGGCCTGGGCCGG - Intronic
1083332935 11:61907357-61907379 CCGCCTGCCCAGGCCAGCCCAGG - Intronic
1083435266 11:62638739-62638761 CATCCAGCCCAGGCCTGTCAGGG + Intronic
1083664822 11:64268682-64268704 CTGCGAGCCCAGCCCCGCCCTGG - Exonic
1083775641 11:64893281-64893303 CGGCCACCCCATGGCTGTCCAGG + Intergenic
1083812631 11:65114283-65114305 CGCCCAGCACAGGCTTGCTCCGG + Intronic
1084128810 11:67118561-67118583 CTCCCGGCTCAGGCCTGCCCAGG - Intergenic
1084204730 11:67584794-67584816 AGGCTTGCCCATGCCTGCCCTGG - Intronic
1084212880 11:67631942-67631964 CCCTCATCCCAGGCCTGCCCTGG + Intronic
1084398932 11:68932462-68932484 CTGCCAGCCCACAGCTGCCCGGG - Intronic
1084526340 11:69700767-69700789 CGGCCTGGCCTGGCCTGGCCTGG - Intronic
1084531216 11:69728947-69728969 CGGCCAGCCCAGGCCTGGGAGGG + Intergenic
1084547321 11:69820905-69820927 ATCCCAGCCCAGGCCTGCACAGG - Intergenic
1084554919 11:69869778-69869800 CAGGCAGCCCAGGCCAGCCAGGG - Intergenic
1084933670 11:72575783-72575805 CTCCCAGCGCTGGCCTGCCCTGG - Intergenic
1084943145 11:72625108-72625130 CAGACAGGCCAGGCCTGCCAGGG - Intronic
1084961855 11:72721064-72721086 GGTCCAGCCCAGGCCTGGCCTGG + Intronic
1084961856 11:72721067-72721089 AGGCCAGGCCAGGCCTGGGCTGG - Intronic
1084961859 11:72721072-72721094 CTGCCAGGCCAGGCCAGGCCTGG - Intronic
1085337502 11:75707242-75707264 TGGCAAGGCCTGGCCTGCCCTGG - Intergenic
1085524850 11:77158160-77158182 CTGACAGGCCAGGCCAGCCCGGG - Intronic
1087791139 11:102407229-102407251 CTGCCAGCCCAGGCCTACTTCGG - Intronic
1087832361 11:102832842-102832864 CTGGCAGCTCAGGCCAGCCCTGG - Intergenic
1089299658 11:117490908-117490930 CCTCCAGCCCCAGCCTGCCCTGG - Intronic
1089620633 11:119720309-119720331 CTGCCTCCCCAGTCCTGCCCGGG + Intronic
1089635060 11:119806761-119806783 AGCCCCGCCCTGGCCTGCCCAGG - Intergenic
1090808322 11:130216762-130216784 CTGCCCGCCCAGACGTGCCCAGG - Intergenic
1090875453 11:130785054-130785076 GGGCCAGCCCAAGCCTGCCATGG - Intergenic
1090953707 11:131496472-131496494 GTGCCGGCCCTGGCCTGCCCAGG - Intronic
1091281581 11:134384568-134384590 CTGCTAGCCCAGCCCTGCACAGG - Intronic
1091544778 12:1494288-1494310 CTGCCAGCCCTGGGCTGCTCAGG + Exonic
1091778651 12:3200409-3200431 CCGCCGGCCCTGGGCTGCCCCGG - Intronic
1094048756 12:26196110-26196132 CGTCCAGCCCTGCCCCGCCCGGG - Intronic
1095894594 12:47267689-47267711 AGGCTAGAGCAGGCCTGCCCAGG + Intergenic
1096520187 12:52180656-52180678 CCCCCAGCCCACTCCTGCCCTGG - Intronic
1096789097 12:54034114-54034136 GGGCCAGCCCAGCCCAGCCCCGG - Intronic
1100404955 12:94264503-94264525 GGGCCAGGCCAGGCCCGGCCCGG - Intronic
1102179569 12:110902213-110902235 ATGCCAGCCCAAGCCTGACCTGG + Intronic
1102189995 12:110980457-110980479 CTGCCAGCTCAGGCATGCCAGGG - Intergenic
1102646170 12:114405363-114405385 CCGCCAGCCCAGAGCTCCCCGGG - Intronic
1103557481 12:121775223-121775245 CTGCCATCCCAGCCCTCCCCAGG - Intronic
1103557502 12:121775294-121775316 CTGCCAGCCCAGCCCGCCCCAGG - Intronic
1103927872 12:124433718-124433740 CGGGCAGCTCCGGCCTGGCCTGG + Intronic
1103944234 12:124517444-124517466 CCACCGGCCCAGGCTTGCCCAGG - Intronic
1104227761 12:126852521-126852543 AGGCAAGCCCAGGACTGCCAGGG + Intergenic
1104686372 12:130787604-130787626 TGGCCGGGCCAGACCTGCCCCGG + Intergenic
1104690116 12:130819159-130819181 CGCCGTGCCCAGCCCTGCCCCGG + Intronic
1104855563 12:131900873-131900895 CGGCCAGACCAGGCCAGGCCTGG - Intronic
1104965668 12:132507843-132507865 AGGCCAGCCCAGGGCTGCCCAGG - Intronic
1104985143 12:132592404-132592426 CGGCCACCCCAAGCCGGCGCAGG + Intergenic
1105281027 13:18962728-18962750 AGACCAGCACAGGCCTTCCCCGG + Intergenic
1105290229 13:19048740-19048762 AGACCAGCACAGGCCTTCCCCGG + Intergenic
1106308288 13:28532470-28532492 CGGCCAGCCCAGCCCGAGCCTGG - Intergenic
1106590762 13:31096790-31096812 TGCCCAGCCCACGCCTGCTCTGG + Intergenic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1107907242 13:45072548-45072570 CTCCCAGCCCAGCCCTGCCCCGG + Intergenic
1110681767 13:78322154-78322176 TAGCCAGCCAAGGCCTTCCCTGG - Intergenic
1110808237 13:79783042-79783064 TGGCCTGCCCACGCCTGCCTGGG - Intergenic
1111932266 13:94524439-94524461 GGGCCAGCCCAGACCCTCCCTGG + Intergenic
1112077398 13:95928947-95928969 CTGCCAGCCCCGGCCTCCCGAGG - Intronic
1112349624 13:98622046-98622068 GGGCCAGGCCAGGCCTATCCTGG + Intergenic
1112475859 13:99730372-99730394 GGGGCAGCCCAGCACTGCCCAGG + Intronic
1113451681 13:110414444-110414466 CGGCCAGCCCAGGCCAGTCCTGG + Intronic
1113670266 13:112171245-112171267 CCGCCTGCCCTGGCCTGGCCTGG - Intergenic
1113695926 13:112345363-112345385 AGGCCACATCAGGCCTGCCCGGG + Intergenic
1113884834 13:113653089-113653111 CTGCCAGCCCTGTCCTGCCCTGG + Intronic
1113894495 13:113755085-113755107 CGCCAAGCCCAGCCCTGCTCTGG + Intergenic
1113927673 13:113950645-113950667 CTCCCAGCCCAGACCAGCCCAGG + Intergenic
1115138649 14:30142399-30142421 CTGCAAGCCAAGGCCTGCCAAGG + Intronic
1117010742 14:51468043-51468065 CTGCCAGCCTAGGCCTCCCGAGG - Intergenic
1117299845 14:54414012-54414034 CTGCAAGCCAAGGCCTGCCATGG - Intronic
1118517859 14:66546523-66546545 CGGCCAGCCTCGGCCTCCCGAGG - Intronic
1119261015 14:73238003-73238025 CGGCCACCCCGGGCCTCCCGTGG + Intronic
1119432105 14:74575204-74575226 AGGCCAGCCGTGGCCTGCTCAGG + Intronic
1121022392 14:90588225-90588247 AGGCCAGGCCAGGCCAGGCCAGG + Intronic
1121341304 14:93106746-93106768 CACCCAGCACAGGCCTGGCCAGG + Intronic
1121710726 14:96037893-96037915 CAGCCTGCCCAGAACTGCCCAGG - Intergenic
1121803917 14:96797680-96797702 TGGCCAGTCCAGGCATCCCCGGG - Intronic
1122122022 14:99559846-99559868 CAGCCAGCACACCCCTGCCCGGG + Intronic
1122261843 14:100528062-100528084 GGGACAGCCCAGCCCAGCCCAGG - Intronic
1122276616 14:100593996-100594018 CTGCCTGCCCACGACTGCCCTGG + Intergenic
1122478478 14:102029104-102029126 CGTCCAGCCCTGGCTTCCCCTGG + Intronic
1122551902 14:102555034-102555056 GCGCCAGCCCAGGCTTGCCATGG + Intergenic
1122601241 14:102922969-102922991 CGGCCAGCCCCGGCCTCCGGCGG + Intronic
1122703468 14:103605730-103605752 GGGCCAGACCAGGGCTGCACTGG - Intronic
1122716088 14:103697941-103697963 CGTCCAGCTCAGCCCTGGCCTGG - Exonic
1122780413 14:104141074-104141096 GGGACAGCCCAGGCCCGCACAGG - Intronic
1122797102 14:104211494-104211516 GGGTCAGCCCAGGCCTCACCAGG + Intergenic
1122823016 14:104356482-104356504 CAGCCAGCCCAGCCCAGCCCAGG - Intergenic
1123037295 14:105476721-105476743 CAGCCAGCCCCTGCCTGCCCTGG + Intronic
1123039219 14:105483557-105483579 CGCCCAGCTCAGGCCTCCCCAGG - Intergenic
1123049499 14:105534027-105534049 CGGCTTACCCAGGGCTGCCCTGG + Intergenic
1123059754 14:105589191-105589213 CATCCAGCCCAGCCCAGCCCAGG + Intergenic
1123060000 14:105590294-105590316 AGCCCAGCCCAGGCCAGCCCAGG + Intergenic
1123109611 14:105859749-105859771 AGCCCAGCTCAGCCCTGCCCAGG + Intergenic
1123783072 15:23645843-23645865 CTGGCAGCCCCTGCCTGCCCAGG - Exonic
1124008098 15:25810705-25810727 CGAGGAGCCCAGGGCTGCCCAGG + Intronic
1124574461 15:30895773-30895795 CCGCCAGCCTCGGCCTCCCCGGG - Intergenic
1124577600 15:30923609-30923631 CAGCCAGCCCCGGCCTGGCCAGG + Intronic
1125500935 15:40240030-40240052 CTGCCAGCCCCGGCAGGCCCAGG + Intronic
1125502836 15:40250156-40250178 TGCCCAGCTCAGCCCTGCCCAGG - Intronic
1125541299 15:40471302-40471324 CGGCCCACCCAGCCCCGCCCGGG - Exonic
1125677738 15:41511696-41511718 AGGCCAGCCCAGCCCAGCGCAGG + Intronic
1125753810 15:42048950-42048972 TGGCCTGCCCTTGCCTGCCCTGG - Intronic
1127766918 15:62195395-62195417 TAGCCAGCCCAGCCCTGCCCCGG + Intergenic
1128156636 15:65395702-65395724 CGCCCCGCCCGGGCCTGCGCTGG + Intronic
1128758764 15:70200587-70200609 CAGCCTGGCCAGGCCTGCCCAGG - Intergenic
1128995140 15:72289770-72289792 CGGCCTCCCCTGCCCTGCCCAGG - Exonic
1129045122 15:72727119-72727141 TGGTCAGCTCAGGCCTCCCCTGG + Intronic
1129125002 15:73431832-73431854 CGGCCTGCCTCGGCCTGCCAAGG + Intergenic
1129157677 15:73728901-73728923 CTGCCAGCCTTGGCCTGCCATGG + Intergenic
1129351204 15:74956843-74956865 CGGCCCGGCCGGGCCCGCCCGGG + Exonic
1129450516 15:75648644-75648666 GGGACAGCCGAGCCCTGCCCGGG + Exonic
1129854041 15:78811545-78811567 CGCCCCGCCCCGGCCGGCCCCGG + Intronic
1130071026 15:80647197-80647219 CGGCCAGCCTCGGCCTCCCGAGG + Intergenic
1131256263 15:90864660-90864682 CAGCCTTCCCAGGCCTGCGCAGG + Intergenic
1132464841 16:72614-72636 CGGCCCGCCCGGGAATGCCCTGG + Exonic
1132643356 16:987952-987974 CGTCCAGCCAAGGGCTGTCCAGG + Intergenic
1132698563 16:1212589-1212611 CGGGCATCCCAGGCCTGCTGGGG + Intronic
1132828481 16:1916522-1916544 AGGCCAGTCCAGGCCCGCCCTGG - Intronic
1132848125 16:2009972-2009994 CGGCCAGCCCCGGGCTCCTCTGG + Intronic
1132866274 16:2094126-2094148 CACCCAGCCCAGGCCTGAACTGG - Exonic
1132892505 16:2211113-2211135 AGGGCAGCCCAGGCCCGGCCAGG + Exonic
1133026921 16:2992562-2992584 TGGCCAGCCGAGGCCTGGCTTGG - Intergenic
1134062233 16:11206138-11206160 GGGCCAGGCCAGGCCAGCTCAGG - Intergenic
1135647408 16:24175217-24175239 AAACCAGCCCAAGCCTGCCCTGG - Intronic
1136344383 16:29665446-29665468 GTGCCAGCCCTGCCCTGCCCAGG - Exonic
1136479911 16:30534684-30534706 CCGCATGCCCAGGCCTGGCCAGG - Exonic
1136514373 16:30759142-30759164 GGCCCAGCCCAGCCCTGCCCTGG + Exonic
1136541565 16:30930286-30930308 CGGCCAGCCCGGGGCAGCTCTGG + Exonic
1136626857 16:31466703-31466725 CAGCCAGCCGGGGCCGGCCCAGG - Exonic
1137250636 16:46737999-46738021 GGCCCAGCCCAGGCATTCCCTGG - Exonic
1138526686 16:57612629-57612651 AGGCCAGCTCTGGCCCGCCCAGG + Intronic
1139409962 16:66751376-66751398 GGGCCATCCCAGCCCGGCCCGGG - Intronic
1139493912 16:67302283-67302305 CCGCCAGCCCAGGCTCGGCCGGG - Intronic
1139513561 16:67440703-67440725 CTGTGAGCCCAGGCCTGCCCTGG + Intronic
1139649720 16:68356250-68356272 CGGGCAGCCCTGTCCTGCTCCGG + Intronic
1139949160 16:70660869-70660891 AGCCCAGCCCAGCCCAGCCCAGG + Intergenic
1140134726 16:72195814-72195836 CCCCCAGCCCAGGACGGCCCTGG - Intergenic
1140507544 16:75483289-75483311 TGGCCAGCTCAGCCCTTCCCTGG + Intronic
1140514624 16:75533027-75533049 TGGCCAGCCCAGCCCTTCCCTGG + Intronic
1140523183 16:75599664-75599686 GAGCCAGCCCTGGACTGCCCTGG - Intronic
1141172080 16:81697850-81697872 CGGCCACCCCAGGCCTCTCAGGG + Intronic
1141744765 16:85918505-85918527 CGGGCAGCCCAGGCTGGCTCAGG - Exonic
1141908006 16:87040435-87040457 GGGCCAGGCCAGGTCTGCACAGG + Intergenic
1142367569 16:89658002-89658024 CGCCCAGCCCAGCCCCGCCCTGG - Intronic
1142373155 16:89694109-89694131 CCCCCAGCCCAGGCCTCCACAGG - Intronic
1142795379 17:2303425-2303447 CGGCCAGTCCTGGCCAGCTCCGG - Intronic
1142964541 17:3572442-3572464 CAGCCAGCCCAGACCTGTCCAGG + Intronic
1143001740 17:3799018-3799040 GGGCCAGGCCAGGCCAGTCCTGG + Intronic
1143012346 17:3872856-3872878 CGGCCAGGCCAGGCCAGGCTGGG + Intronic
1143023777 17:3929561-3929583 CGGCCTGCCAGGGCCTGTCCCGG + Intronic
1143078898 17:4366804-4366826 CTGCCAGCCCAAGCCTCCGCTGG + Intergenic
1143124599 17:4633437-4633459 AGACCAGCCCAGTCCTGGCCCGG + Exonic
1143178059 17:4967891-4967913 CGCCCAGGCCAGGCGGGCCCAGG - Intergenic
1143387333 17:6538997-6539019 CGGTCAGCCCAGGCCATCCAGGG + Intronic
1143503422 17:7351674-7351696 TGGCCAGCCCAGTCCTGCCGAGG + Intergenic
1143520168 17:7440225-7440247 CCCCCAGCCCCCGCCTGCCCCGG + Intronic
1143575655 17:7791641-7791663 TGGCCACAACAGGCCTGCCCTGG - Intronic
1143747228 17:9003452-9003474 CGGCGAGCCCCAGCCTGCTCCGG + Intergenic
1144143783 17:12377258-12377280 AGGCCAGGCCAGGCCAGGCCAGG + Intergenic
1144143785 17:12377263-12377285 AGGCCAGGCCAGGCCAGGCCAGG + Intergenic
1144498395 17:15764856-15764878 TGGCCAGCTAGGGCCTGCCCCGG - Intergenic
1144791155 17:17860141-17860163 TGGCCAACCCTGGCCTGCACTGG - Intronic
1145161777 17:20579897-20579919 TGGCCAGCTAGGGCCTGCCCCGG - Exonic
1145250696 17:21295503-21295525 CAGGCAGCCCAGGGCTGCCCAGG - Intronic
1145936005 17:28715263-28715285 CGGCCAGCCACTGCCTGCCATGG + Exonic
1145940909 17:28743153-28743175 TGGCCAGTCCAGGCAGGCCCTGG - Exonic
1146123855 17:30217127-30217149 CTGCTGACCCAGGCCTGCCCAGG - Intronic
1146271308 17:31487792-31487814 CGCCCAGCTCAGGGCAGCCCTGG - Intronic
1146401078 17:32500500-32500522 CAGGCAGGCCAGGGCTGCCCAGG - Intronic
1146654274 17:34626145-34626167 CGGCCAGCCCCAGCCCGCCGGGG + Exonic
1146968413 17:37052655-37052677 CCTCCAGCACAGGCCTGCTCTGG - Intronic
1147742804 17:42678334-42678356 CGCCCAGCCCAGCCCTGCCCAGG - Intergenic
1147933095 17:43995014-43995036 CGGCCAGTCCGGGACTACCCGGG + Intronic
1147982146 17:44281295-44281317 TGTCCAGCCCAGGCCTAGCCAGG - Intergenic
1148327474 17:46791610-46791632 CCACCAGGCCAGGCATGCCCTGG + Intronic
1148568236 17:48646472-48646494 CGGGAAGCCCACGCCTGCCACGG + Intergenic
1149527772 17:57370196-57370218 TTTCCTGCCCAGGCCTGCCCTGG + Intronic
1150415889 17:64988588-64988610 CGGCCAGTCCAGGGCAGCCCAGG + Intergenic
1150723913 17:67636410-67636432 GGGCCACCCCTGGCCCGCCCTGG + Intronic
1150795814 17:68235776-68235798 CGGCCAGTCCACGGCAGCCCAGG - Intergenic
1151660278 17:75515184-75515206 AGCCCAGCCCAGCCCAGCCCAGG + Intronic
1151853836 17:76708238-76708260 CAGCCCGCCCAGGCCTCCCTGGG + Intronic
1152013643 17:77735736-77735758 CTGCCAGGCCCAGCCTGCCCTGG + Intergenic
1152067324 17:78118933-78118955 CTGCCAGCCCAGCCCTCCCCAGG + Intronic
1152070786 17:78132682-78132704 CCCCCTGCCCAGGCCTCCCCAGG + Intronic
1152177723 17:78798769-78798791 CAGGCTGCCCAGGCCTGTCCGGG - Intronic
1152238574 17:79150639-79150661 GGGCAAGGCCAGGCCTGCCAGGG + Intronic
1152342426 17:79732589-79732611 CCGCCAGCCCAGGAATGCCAAGG - Intronic
1152528559 17:80903438-80903460 CCTGCACCCCAGGCCTGCCCAGG + Intronic
1152546772 17:81004195-81004217 AGCCCAGCCCAGCCCTTCCCGGG + Intronic
1152561183 17:81079547-81079569 CCACCAGCCCAGGGCTGCCTAGG - Intronic
1152564251 17:81093078-81093100 AGCCCAGCCCAGCCCAGCCCAGG - Intronic
1152569451 17:81115307-81115329 CGTCCAGCCCAGCCCTGGCATGG - Intronic
1152578945 17:81157574-81157596 TGCCCAGCCCAGGCCAGCCCAGG + Intronic
1152606594 17:81294715-81294737 CGCCCAGCGAAGCCCTGCCCCGG + Intronic
1152613792 17:81328831-81328853 AGGCTAGCCCAGGGCTACCCGGG + Intronic
1152652074 17:81499452-81499474 GGGCCTGGCCAGGCCTCCCCAGG + Intergenic
1152760550 17:82105131-82105153 CGGTGAGCCCACGCCTTCCCTGG + Intronic
1152925011 17:83083180-83083202 CGGCCAACCCACCTCTGCCCAGG - Intronic
1153600247 18:6774066-6774088 CGGCCAGCACTGTCCTGTCCTGG + Intronic
1154092461 18:11378352-11378374 AGGACTGCCCAGGCCTCCCCAGG - Intergenic
1155170897 18:23266251-23266273 TGGCCAGCCCATGCCTGCTGGGG + Intronic
1155174440 18:23290282-23290304 CAGCCAGCAAGGGCCTGCCCAGG + Intronic
1156467312 18:37356011-37356033 AGCCCAGCCCAGCCCAGCCCTGG + Intronic
1156467315 18:37356016-37356038 AGCCCAGCCCAGCCCTGGCCTGG + Intronic
1157572364 18:48721496-48721518 AAGCCAGCCCAGCCCTCCCCGGG + Intronic
1157788409 18:50507499-50507521 TCGCCAGCCCAGACCTACCCTGG + Intergenic
1159630718 18:70746404-70746426 CTGCCAGCCTTGGCCTGCCAAGG - Intergenic
1160013719 18:75125506-75125528 TGGCCCTCCCAGGCCAGCCCAGG - Intergenic
1160044375 18:75373099-75373121 AGGTGAGCCCAGGCCTGCTCAGG + Intergenic
1160386103 18:78497898-78497920 CGGCCAGCACACACCTGCCCAGG + Intergenic
1160413152 18:78688416-78688438 CGGCCAGGCCGAGTCTGCCCTGG - Intergenic
1160455059 18:78993881-78993903 CGGGCAGCCCGGGGCTGCCGAGG - Exonic
1160793225 19:932581-932603 CAGCCACCCCAGGCCTTCCGCGG + Exonic
1160796019 19:945760-945782 GGGCCAGAACACGCCTGCCCCGG - Intronic
1160834626 19:1118893-1118915 CGGCCCGCCCTGTCCTGTCCTGG - Intronic
1160837404 19:1131344-1131366 CGGGCAGCCCCGGCCCTCCCTGG - Intronic
1160865441 19:1253966-1253988 CCGCCAGCCCGGCCCGGCCCGGG - Intronic
1160874699 19:1291562-1291584 CGGCCAGCCTGGGCCTCCCCGGG + Intronic
1161143685 19:2664452-2664474 CGGCCAGGCCGGGCGTGACCTGG + Intronic
1161217250 19:3100695-3100717 TGGCCAGCCCAGGGCAGCCCAGG - Intronic
1161219235 19:3110435-3110457 CGGCCGGCCCAGGCTACCCCTGG + Intronic
1161391904 19:4025469-4025491 CGCCCGGCCCAGCCCTGCCATGG - Intronic
1161593804 19:5141163-5141185 CTGCCTGCACAGCCCTGCCCAGG - Intronic
1161686348 19:5704531-5704553 CGGCCTGCCCAGCCCTGCCCCGG + Intronic
1162046780 19:8005420-8005442 CGGCCAGGCCAGGCGAGCTCAGG + Intronic
1162046783 19:8005430-8005452 AGGCGAGCTCAGGCCTGCCGCGG + Intronic
1162078725 19:8206153-8206175 TCTCCAGCCCTGGCCTGCCCAGG + Intronic
1162198962 19:9007580-9007602 GTCCCAGCCCAGGCCTGGCCAGG - Intergenic
1162233126 19:9283715-9283737 CGGCCTGCCCTGCCCGGCCCGGG - Intergenic
1162910370 19:13844578-13844600 CCCCCACCCCAGGCCCGCCCTGG - Intergenic
1162985304 19:14265777-14265799 CGGCCAGCCCTGGCCTCCCTTGG + Intergenic
1163117914 19:15199764-15199786 CGGCCTCCCCAGCCCAGCCCCGG - Intronic
1163124537 19:15237897-15237919 CAGCCCACGCAGGCCTGCCCTGG + Exonic
1163237666 19:16038763-16038785 GGGCCAGTCCAGGTCTGTCCTGG + Intergenic
1163366431 19:16878394-16878416 GGGGCAGCCCAGGCCTCCCCTGG - Intronic
1163430577 19:17264747-17264769 TGGCCAGCCCAGGCCTGAACAGG - Exonic
1163440856 19:17321988-17322010 TGGACACCGCAGGCCTGCCCAGG - Exonic
1163470919 19:17496538-17496560 CGGCCAGCCCAGGCTCAGCCAGG + Intronic
1163585342 19:18160849-18160871 CGGCCAGTCCAGGCCTCACGAGG + Intronic
1163824365 19:19514762-19514784 CGGACATCGCCGGCCTGCCCCGG - Exonic
1163829180 19:19539743-19539765 CGGCCAGCCCTCACCAGCCCTGG + Exonic
1164672014 19:30077631-30077653 TGGCCAGCCCTGGGATGCCCTGG + Intergenic
1165420198 19:35718452-35718474 CGGCCTGCCCACGCCGCCCCCGG - Intronic
1165872188 19:38980872-38980894 TGGCAAGACCAGGCCAGCCCTGG + Intergenic
1166510822 19:43407752-43407774 CGGCTATCCCAGGCCAGCCGAGG - Intronic
1166814363 19:45533640-45533662 TGGCCTGGCCTGGCCTGCCCTGG - Intronic
1167007395 19:46784831-46784853 CGACCTGCCCTGGCCTGCCGTGG - Intronic
1167020535 19:46871733-46871755 CCGCCTGCCTAGGCCTCCCCAGG - Intergenic
1167117224 19:47495379-47495401 CAGCCAGCCCAGGCCAGCTCAGG + Intronic
1167146031 19:47681159-47681181 CCCCCAGCCCAGCCCTGGCCTGG + Exonic
1167347427 19:48955210-48955232 CGACAAGCCCGGGCCTGCCCGGG - Intronic
1167547985 19:50140675-50140697 CCGCCAGCCTCGGCCTCCCCAGG + Intergenic
1168264795 19:55216875-55216897 GGGCCAGCCAGGACCTGCCCGGG + Intergenic
925022142 2:579593-579615 GGTGCAGCCCAGTCCTGCCCAGG - Intergenic
925090992 2:1155979-1156001 AGGCCAGGCCAGGCCAGGCCAGG + Intronic
925841408 2:7995463-7995485 GGGCCTGCCCCTGCCTGCCCAGG + Intergenic
926366026 2:12133810-12133832 CCCAGAGCCCAGGCCTGCCCCGG - Intergenic
927083779 2:19654847-19654869 CCACAAGCCCAGGCATGCCCAGG + Intergenic
927493500 2:23536446-23536468 CGGCCTGAGCAGGCCTGCCGTGG + Intronic
928928070 2:36598187-36598209 CGCCCAGCCCGGCCCCGCCCCGG + Exonic
928929742 2:36611741-36611763 CGGCCTGCTCAGACCTGACCTGG - Intronic
929781525 2:44960372-44960394 CTGCAAACCCAGGCCTACCCTGG + Intergenic
929921158 2:46172470-46172492 AGGCCCGCCCAGGCCTGCCCAGG - Intronic
929921161 2:46172480-46172502 AGGCACGCCCAGGCCCGCCCAGG - Intronic
931566812 2:63622901-63622923 CGCCGAGCCCCGGCCTGGCCCGG - Intronic
931671791 2:64654049-64654071 CGGCCGGCCGCGGCCGGCCCCGG - Intronic
931877158 2:66526386-66526408 AGGCCAGGCCCGGCCTGCCATGG - Intronic
931976224 2:67646859-67646881 GGGCCAGGCCAGCCCAGCCCAGG - Intergenic
932432556 2:71684709-71684731 CGGCCGGCCCCGGCCTGCTGAGG + Intronic
933986140 2:87593902-87593924 CAGGCAGCCCAGAGCTGCCCAGG + Intergenic
934566940 2:95346475-95346497 CGGCCCCCCCGCGCCTGCCCGGG - Intronic
936073120 2:109384434-109384456 CGGCCAGCTCAGGCCACCCCTGG - Intronic
936165560 2:110116529-110116551 CAGCCAGCCCAGCCCTTCTCTGG - Exonic
936186337 2:110306931-110306953 CCGCCAGCCTCGGCCTCCCCAGG + Intergenic
936307696 2:111356901-111356923 CAGGCAGCCCAGAGCTGCCCAGG - Intergenic
936463617 2:112728471-112728493 TGGCCAGCTCAGGGCTTCCCTGG + Intronic
936729227 2:115360682-115360704 CTGCCAGCCTAGGCCTCCCTTGG - Intronic
937076472 2:119111116-119111138 CTGCCAGCCCAGGCTGGCCATGG + Intergenic
937900466 2:127015852-127015874 AGGCCAGCCCAGCCATGCCATGG - Intergenic
937956044 2:127422341-127422363 AGGCCAGCCAAGGCCTGCTGGGG - Intronic
938540165 2:132278881-132278903 CGGCTAGCCAAGGCCAGCCAAGG + Intergenic
938540167 2:132278891-132278913 AGGCCAGCCAAGGCCAGCCAAGG + Intergenic
938774543 2:134530017-134530039 CAGCCAGTCCAGGCCTTCACAGG + Intronic
939002291 2:136750202-136750224 GGGCCAGCTCATGCCTGCCTTGG + Intergenic
939153966 2:138502261-138502283 CGGCGAGCTCCGGCCTGCTCTGG + Intronic
942024560 2:171899482-171899504 CCGCCAGCCTCGGCCTCCCCAGG + Intronic
943190997 2:184679919-184679941 AGCCCAGCTCAGGCCTTCCCTGG - Intronic
946053248 2:216880998-216881020 CGGCCAGGGCAGGCTGGCCCTGG + Intergenic
946369911 2:219274485-219274507 AGTCCAACCCAGGCCTGCCAGGG - Intronic
946386230 2:219386106-219386128 CAGCCAGGCCAGGTCAGCCCAGG + Intronic
946572019 2:221034870-221034892 TGGCCAGCCCAGCTCTGTCCAGG + Intergenic
946662760 2:222018991-222019013 CTGTCAGCCCAGGCCTGCAGGGG - Intergenic
947528455 2:230893781-230893803 TAGGTAGCCCAGGCCTGCCCCGG - Intergenic
947623195 2:231604084-231604106 AGGCCAGGCCAGGCCACCCCTGG - Intergenic
947749257 2:232524215-232524237 CCTCCAGCCCAGCCCAGCCCTGG + Intronic
947749259 2:232524220-232524242 AGCCCAGCCCAGCCCTGGCCCGG + Intronic
947958987 2:234218784-234218806 CTCCCAGCCCAGGCCTGTGCAGG - Intergenic
948383158 2:237564782-237564804 CTGCCAGCCCAGCCCTGCTGGGG - Intergenic
948476095 2:238221004-238221026 CGGGCTGCCCATGGCTGCCCCGG - Intergenic
948591420 2:239053234-239053256 CCGCCAGCCTAGCCCTGGCCTGG + Intronic
948629193 2:239291271-239291293 TGGCCAGCCCGGGCCAGCCCTGG - Intronic
948634674 2:239327628-239327650 CAGCCAGCCCAGACTTGGCCCGG + Intronic
948706164 2:239794003-239794025 TGGCCAGCCCTGGCCAGCGCAGG + Intronic
948792313 2:240385443-240385465 AGCCCAGCCCAGCCCAGCCCAGG - Intergenic
948875676 2:240826342-240826364 GGGGCAGCCCAGGGCAGCCCAGG + Intergenic
1169002596 20:2178781-2178803 GGGCCAGCCCAGAAGTGCCCAGG - Intergenic
1169383258 20:5126984-5127006 CGGCCGGCCCCGCCCCGCCCGGG - Exonic
1172113259 20:32559855-32559877 CGGCCAGCCCAGGCCTGCCCAGG + Intronic
1172143982 20:32743531-32743553 CGGACAGCCCAGGGCGGCCGGGG - Exonic
1172193129 20:33074358-33074380 GGGCCAGCCAAGCCCTGCTCTGG - Intergenic
1172272751 20:33663740-33663762 CGGCCAGCTCAGAGCTGCCCTGG - Exonic
1172429357 20:34876835-34876857 CTGACACCCCAGGCCCGCCCGGG - Intronic
1172619248 20:36308269-36308291 CGCCCAGCACAGGCCTCACCAGG - Intronic
1172722657 20:37012106-37012128 CCGCCAGCCTCGGCCTGCCGAGG + Intronic
1173153425 20:40587247-40587269 CGCCCAGCCCAGCCCTCACCTGG + Intergenic
1173162743 20:40664389-40664411 AGGCCAGGCCAGGCCAGGCCAGG - Intergenic
1173495235 20:43513854-43513876 CGGCCTGCCCAGCAGTGCCCTGG + Exonic
1173916030 20:46709496-46709518 CGGCCGCCCCAGGCCTGGCAAGG - Exonic
1174346848 20:49936558-49936580 CGGCGAGCCCGGGCCTGGTCGGG + Intronic
1175111415 20:56650840-56650862 AGCCCAGCCCAGCCCAGCCCAGG - Intergenic
1175273186 20:57749176-57749198 CGGGCACCCCAGGCTCGCCCTGG - Intergenic
1175489862 20:59372602-59372624 AGCCCAGCCCAGGCCGGCCCTGG - Intergenic
1175800415 20:61798178-61798200 CGCCCCGCCCGGCCCTGCCCCGG + Intronic
1175894319 20:62329372-62329394 AGCCCAGCCCAGCCCAGCCCTGG + Intronic
1176093095 20:63327594-63327616 GTGCCAGCACAGGCCTGACCCGG + Intronic
1176131080 20:63497123-63497145 CCCCCACCCCAGGGCTGCCCTGG + Intronic
1176178656 20:63739833-63739855 CGGCCAGCCCGGCCCGGCCCGGG + Intronic
1176189888 20:63803543-63803565 CTGCCGGCCCCGGGCTGCCCAGG + Intronic
1176372206 21:6068914-6068936 GGGCCAGCCCAGGCCTGCCACGG - Intergenic
1176887394 21:14272993-14273015 TGGCCAGCCCAGACTTCCCCAGG + Intergenic
1178885266 21:36479911-36479933 AGTCCAGCCTACGCCTGCCCAGG + Exonic
1179442847 21:41407681-41407703 CCCCCAGCCCAGGACTCCCCTGG - Intronic
1179481533 21:41681696-41681718 CGGCTCACCCAGGCCTGCCATGG - Intergenic
1179571487 21:42281258-42281280 CGGCCACCACAGGGCTGCCCTGG + Intronic
1179600805 21:42476196-42476218 AGCCCAGCCTAGGCCTGGCCAGG + Intronic
1179630229 21:42673345-42673367 AGCCAAGCCCAGGCCTGCCCAGG + Intronic
1179751313 21:43469625-43469647 GGGCCAGCCCAGGCCTGCCACGG + Intergenic
1179828303 21:43980682-43980704 CTGCCTGCCCAGCACTGCCCCGG - Intronic
1179937348 21:44613890-44613912 CTCCCAGGCCAGGCCTGGCCAGG + Intronic
1180071546 21:45439252-45439274 CGGGCGGTCCAGGCCTGCCTGGG - Intronic
1180158644 21:45989503-45989525 CGGCCTGACCAGGCCTGGGCTGG + Intronic
1180158645 21:45989506-45989528 CCTCCAGCCCAGGCCTGGTCAGG - Intronic
1180160065 21:45995167-45995189 CCGCCTGCCAAGCCCTGCCCTGG - Intronic
1180195683 21:46192192-46192214 AGGCCTCCTCAGGCCTGCCCTGG + Intronic
1180581951 22:16846110-16846132 GGCCCAGCCCTGGCCAGCCCGGG + Intergenic
1180699689 22:17774510-17774532 GGGCCCGCCCCGGCCCGCCCCGG + Intronic
1180794212 22:18594019-18594041 TGTCCAGTCCAGACCTGCCCAGG - Intergenic
1180984063 22:19893722-19893744 TAGCCAGCCCACGCCTGGCCGGG + Intronic
1181029871 22:20144535-20144557 AGCCCAGCCCAGCCCAGCCCAGG + Intronic
1181162591 22:20967059-20967081 CGGCCAGCCCGGGCCTGATGGGG - Intronic
1181227528 22:21401301-21401323 TGTCCAGTCCAGACCTGCCCAGG + Intergenic
1181251122 22:21533538-21533560 TGTCCAGTCCAGACCTGCCCAGG - Intergenic
1181274986 22:21682571-21682593 CAGCCAGCCCAGGCCTCTACAGG + Intronic
1181514334 22:23402599-23402621 CGGCCCGCCCTGGCCGGCCCAGG - Intergenic
1181522404 22:23457118-23457140 AGGCCAGGCCAGGCCAGCCGGGG + Intergenic
1181522692 22:23458694-23458716 GGCCCAGCCCAGGCATGCTCCGG + Intergenic
1181639786 22:24190429-24190451 TGGCCGGCCCAGGCCTGGCGTGG - Intergenic
1182122104 22:27794914-27794936 CGGCTAGGCCAGGCCAGGCCAGG + Intronic
1182331011 22:29552028-29552050 CGGCCAGCCTCGGCCTCCCGAGG + Intronic
1182355230 22:29719880-29719902 CGGCCGCCCCAAACCTGCCCGGG - Intergenic
1182519238 22:30876094-30876116 GGCCCAGCCAAGGCTTGCCCTGG - Intronic
1182668179 22:31973868-31973890 GGGACTTCCCAGGCCTGCCCAGG - Intergenic
1182749402 22:32629506-32629528 CAGCCAGCCCAGGCTTTCTCAGG + Intronic
1182916867 22:34041613-34041635 AGCCCAGCCCAGCCCAGCCCAGG + Intergenic
1183408317 22:37640985-37641007 CTCCCAGCTGAGGCCTGCCCTGG - Intronic
1183649163 22:39144503-39144525 TGGCCCGCTCAGGCCCGCCCGGG + Intronic
1183821069 22:40346472-40346494 CGCCCCGCCCCGTCCTGCCCTGG + Intergenic
1184235829 22:43182551-43182573 TGGCAAGGCCAGGCCTGCTCTGG + Intronic
1184390387 22:44200266-44200288 CGGGCAGCCAAGGCTTACCCCGG + Intronic
1184445353 22:44544005-44544027 GGCCCAGCCCAGGCCGGCTCTGG - Intergenic
1184458413 22:44624241-44624263 CTGGCAGCAGAGGCCTGCCCGGG - Intergenic
1184974578 22:48051976-48051998 CGCCCCGGCCAGGCCAGCCCAGG + Intergenic
1185042702 22:48513624-48513646 GGGGCCGCACAGGCCTGCCCAGG - Intronic
1185109682 22:48894039-48894061 GTCCCAGCCCTGGCCTGCCCCGG - Intergenic
1185136058 22:49073325-49073347 TGGCCTGCCCACACCTGCCCTGG + Intergenic
1185287809 22:50010385-50010407 AGGGCAGCCCAGACCAGCCCGGG + Intronic
1185310656 22:50152553-50152575 AGGCCCGCCCAGGGCTGGCCAGG + Intronic
1185376196 22:50483608-50483630 CACCCAGCCCTGCCCTGCCCTGG - Exonic
1185408729 22:50672121-50672143 CAGCCACCCCAGGCCAGCACTGG - Intergenic
949252160 3:1998569-1998591 ACGCCAGCCTAGGCCTACCCAGG + Intergenic
949937700 3:9129531-9129553 CTGGCAGCCCAGGCCTTCCTGGG - Intronic
950006931 3:9697402-9697424 CTCCCAGCGCAGGCATGCCCTGG + Intronic
950264578 3:11564571-11564593 CTTCCTGCCCAGACCTGCCCGGG - Intronic
950548103 3:13650741-13650763 CGGCCGGGCCTGGCCTGCACTGG - Intergenic
950703483 3:14766222-14766244 CGCCCCGCACAGGGCTGCCCTGG - Intronic
951472322 3:23069968-23069990 TGCCCAGCCCAGCCCAGCCCAGG + Intergenic
952334577 3:32392837-32392859 CGGCCAGGCAACGTCTGCCCTGG - Intronic
952965292 3:38617350-38617372 CTGCCAGGCCAGGCCAGCCAAGG + Intronic
953684974 3:45070529-45070551 GCTCCAGCCCAGGCCTCCCCCGG + Intergenic
953959400 3:47256003-47256025 CCGCCAGCCCCGGCCTCCCGAGG + Intronic
954028776 3:47803359-47803381 CGGGCATCCTAGGCCTGCCCGGG + Intronic
954514063 3:51155264-51155286 TACCCAGCCCAGCCCTGCCCTGG + Intronic
954622181 3:52002566-52002588 ACCCCAGCCCAGGCCTGCTCAGG - Intergenic
954801435 3:53189255-53189277 AGACCAGCCCAGCCCAGCCCAGG - Intronic
957620007 3:82584111-82584133 CCGCCAGCCTCGGCCTCCCCAGG + Intergenic
959778435 3:110199463-110199485 CAGCCAGCCCAGCCCTCACCAGG + Intergenic
961176856 3:124842803-124842825 GAGCCTGCCCAGACCTGCCCTGG - Intronic
961346934 3:126269022-126269044 TGGCCAGCCCTCGCCAGCCCAGG - Intergenic
961518977 3:127456027-127456049 CGGGCATCCGAGTCCTGCCCAGG - Intergenic
962685762 3:137846145-137846167 GGGCCAGACCTGGCCTGCCAGGG - Intergenic
963778677 3:149465209-149465231 CTGCCAGGCCAGCCCAGCCCCGG + Intergenic
964475089 3:157090798-157090820 GGGCCATCCCAGCCCTGCCTTGG - Intergenic
964509699 3:157437463-157437485 CAGCCCGCCCAGGCCTGCCTTGG - Intronic
966831913 3:184017481-184017503 CAGCCCGCTCCGGCCTGCCCAGG + Intronic
966871268 3:184291788-184291810 TGGCCTGTCCAGGGCTGCCCAGG + Intronic
966883656 3:184362933-184362955 GAGCCGGCCCAGGCCGGCCCCGG + Intronic
966891444 3:184410236-184410258 CGGCCAGCCCAGCCCTTCTGTGG + Intronic
967135398 3:186508814-186508836 AGGCCAGCCATGACCTGCCCAGG - Intergenic
967859633 3:194141363-194141385 CGGCCACGCCGGGCCAGCCCTGG + Intergenic
967862215 3:194160695-194160717 CCGCCATCCCCGGCCTGTCCTGG + Intergenic
968081118 3:195847583-195847605 GGGGCAGCGCAGGCCAGCCCAGG - Intergenic
968457283 4:706107-706129 CGGCCCTCCCGGGCCTGCCAAGG - Intronic
968591124 4:1460150-1460172 CAGCCAGCCCCGCCCTGCTCTGG + Intergenic
968612252 4:1562650-1562672 CGCCCGGCCCACGCCAGCCCTGG - Intergenic
968650526 4:1758550-1758572 CCACCTGCCCAGGCCTGTCCGGG - Intergenic
968755341 4:2413019-2413041 CGCCCAGCCCTGCCCTGCCAGGG + Intronic
969301681 4:6300718-6300740 CAGCCAGTGCATGCCTGCCCTGG - Exonic
969431931 4:7160483-7160505 CGGCCCGGCCAGGCCCGCCTTGG + Intergenic
969695923 4:8734833-8734855 CAGGCAGCCCTGGCCTGGCCAGG - Intergenic
970522579 4:16900554-16900576 TGGCCTGCACAGGCCTGCCTAGG - Intergenic
976092418 4:81471965-81471987 CTGCCAGCCCCGCCCCGCCCCGG + Intronic
978373423 4:108051517-108051539 GGGCCAGGCCAGGCGAGCCCCGG + Intronic
980328447 4:131379463-131379485 CGGCCAGCCAGCGCCTGCTCAGG + Intergenic
981315273 4:143335720-143335742 AGACCAGCCCTGGCCAGCCCTGG + Intergenic
981717210 4:147763603-147763625 CAGCCAGGCCAGGCCAGGCCAGG - Intronic
981993572 4:150953605-150953627 CTGCCAGCCCGGGCCTCCCGAGG + Intronic
982584863 4:157222874-157222896 CTGCCTGCCCACGCCTGCGCGGG - Intronic
984741038 4:183163287-183163309 CTGCCAGCTCACCCCTGCCCTGG + Intronic
985341128 4:188955768-188955790 AGGCTGGCCCAGCCCTGCCCAGG + Intergenic
985520541 5:372178-372200 CCGCCAGCCCACCCCAGCCCTGG - Intronic
985539013 5:479218-479240 CGGCCTGCCCTGACCTCCCCAGG - Intronic
985682875 5:1265627-1265649 CCCCCAGCCCAGGGCGGCCCTGG + Intronic
987073691 5:14360730-14360752 GGGCCAGACCAGCCCTGCGCAGG + Intronic
987441934 5:17967234-17967256 TGGCAGGCCCAGGCCAGCCCAGG - Intergenic
992216328 5:74528159-74528181 CTTTCAGACCAGGCCTGCCCAGG + Intergenic
994245471 5:97471442-97471464 TGGCCAGGCCAGGTGTGCCCAGG - Intergenic
995846492 5:116499402-116499424 CGGCCAACCCCCGCCCGCCCAGG - Intronic
997013598 5:129905378-129905400 CGGCCAGCGCGCGGCTGCCCAGG - Exonic
997261216 5:132466729-132466751 CTCCCTGTCCAGGCCTGCCCAGG + Intronic
997439928 5:133902018-133902040 CTGCCAGTCCAGGACTGCCTGGG - Intergenic
997530860 5:134580337-134580359 CGGCCAACACCGGCCCGCCCTGG - Exonic
997805229 5:136910844-136910866 CCACCAGCCCAGGTCTGCTCAGG + Intergenic
998523113 5:142818293-142818315 TGGCCAGCCAAGCCATGCCCCGG + Intronic
999319264 5:150603316-150603338 CTGCCAGCCCAGGACTAGCCAGG + Intronic
999327401 5:150651586-150651608 AGCCCAGCCCAGCCCAGCCCAGG - Exonic
999440299 5:151595568-151595590 CGGCCAGCCCTGGCATTGCCTGG + Intergenic
1000046286 5:157524392-157524414 CTGCCTGGCCTGGCCTGCCCGGG - Intronic
1001136062 5:169103764-169103786 GGGCCAGGGCAGGCCTGCTCAGG + Intronic
1001136063 5:169103767-169103789 CAGCCTGAGCAGGCCTGCCCTGG - Intronic
1001204296 5:169747607-169747629 TGGCCAGCCCAGGCCTTCACTGG - Intronic
1001290216 5:170451951-170451973 CCACCAGCCCAGGCCTGGGCAGG - Intronic
1001309415 5:170600222-170600244 CGACCAGCCCTGCCCTGCCTTGG + Intronic
1001506444 5:172283928-172283950 GGGCCAGCCCTGGCCTGGCGGGG - Exonic
1001523708 5:172413967-172413989 CGGCCAGGCAATGCCTGCCTAGG + Intronic
1002000617 5:176194635-176194657 CGGTCGCCCCATGCCTGCCCAGG + Intergenic
1002001587 5:176199346-176199368 CGACCGCCCCATGCCTGCCCGGG + Intergenic
1002166608 5:177351578-177351600 CGAGAAGCCCAGGCCTTCCCAGG + Exonic
1002167851 5:177359226-177359248 CGGCCAGCCCGGGGCTGGGCAGG - Intronic
1002213088 5:177609841-177609863 GGCCCAGCCCAAGCCTGCCTTGG - Exonic
1002233119 5:177782898-177782920 GGGGCAGCCCTGGCCAGCCCAGG - Intronic
1002252753 5:177939634-177939656 CGACCGCCCCATGCCTGCCCGGG - Intergenic
1002253722 5:177944346-177944368 CGGTCGCCCCATGCCTGCCCAGG - Intergenic
1002262861 5:178006883-178006905 GGGGCAGCCCGGGCCAGCCCAGG + Intronic
1002271467 5:178075422-178075444 GGGCCAGCCCAGGGCTGGCACGG - Intergenic
1002789499 6:426949-426971 CCCCCACCCCAGGCCTGCCTTGG - Intergenic
1003097998 6:3157310-3157332 CGGCCAGCCCGGGGCCGCCGCGG + Intronic
1005842459 6:29752621-29752643 CGCCCAGCCCAACCCCGCCCTGG - Intergenic
1005998256 6:30945336-30945358 CTGCCAGGCCAGGCCAGGCCAGG + Intronic
1005998258 6:30945341-30945363 AGGCCAGGCCAGGCCAGGCCAGG + Intronic
1006520046 6:34565977-34565999 CTGCCTGCCTGGGCCTGCCCTGG + Intergenic
1006595894 6:35192324-35192346 CGCCCACCCCAGCCATGCCCTGG - Intergenic
1007281117 6:40713284-40713306 CTGCCAGCCCAAGCCTCCTCTGG + Intergenic
1007400172 6:41598834-41598856 CAGGCAGCCCGGGCCTCCCCTGG + Exonic
1007816988 6:44531605-44531627 CAGCCAGCCCCGGCTTTCCCTGG - Intergenic
1013033772 6:106360921-106360943 CCGCCAGCCCAGGGCGACCCCGG + Intergenic
1013276415 6:108589331-108589353 AGGGCAGCCAAGGCCTGGCCCGG - Intronic
1013598577 6:111683342-111683364 GGGCCCACCCAGGCCTGTCCTGG - Intronic
1015749999 6:136550126-136550148 CGGCCAGCCCGGCTCGGCCCCGG - Intronic
1015937323 6:138416521-138416543 CTGCCAGCCCCAGCCTGCCGAGG - Exonic
1016428849 6:143962166-143962188 CCCCCAGACCAGGCCTGCCTTGG - Intronic
1017006982 6:150035108-150035130 ATGCCAGCCCAGGTCAGCCCAGG - Intergenic
1017236108 6:152119052-152119074 CAGGCAGCCCAGACCAGCCCTGG + Intronic
1017693866 6:156994750-156994772 AGTCCAGCCCAGGGCTGCCTAGG + Intronic
1017716530 6:157217381-157217403 TGCCCAGCCCAGGCCTTCCTCGG - Intergenic
1017889387 6:158626229-158626251 AGGCCAGGCCGAGCCTGCCCTGG - Intronic
1018744609 6:166752009-166752031 GGGCCAGCACAGGCCAGCCAAGG + Intronic
1019128738 6:169858800-169858822 CGGCCAGCCCCAGCAGGCCCTGG - Intergenic
1019305478 7:332555-332577 CAGCCCGCCCACCCCTGCCCTGG - Intergenic
1019481200 7:1267580-1267602 CCCCCAGCCCAGGGCTGCTCTGG - Intergenic
1019588633 7:1817843-1817865 GGCCCAGCCCAGGCATGCTCCGG - Intronic
1020083162 7:5297123-5297145 TGCCCAGGCCTGGCCTGCCCCGG - Exonic
1020107808 7:5430231-5430253 CGGCGTGCACAGGCCTGCCCCGG - Intergenic
1020204737 7:6105416-6105438 CGGCCAGCACACGCCCACCCCGG - Intronic
1020274250 7:6615385-6615407 CGGCCAGCCCGGGACGCCCCAGG + Intergenic
1022097952 7:27152464-27152486 CCGCCAGGCCTGGCCTGGCCGGG + Intronic
1022112397 7:27239658-27239680 GGGCCAGGCCAGCCCAGCCCCGG + Intergenic
1022233688 7:28440503-28440525 CTCCCAGGCCAGTCCTGCCCTGG + Intronic
1022410337 7:30135011-30135033 CAGCCGGCCCAGCCCGGCCCCGG + Exonic
1022892268 7:34713780-34713802 GGCCCATCCCAGGCCTGTCCCGG + Intronic
1023043807 7:36194669-36194691 GGTCCAGCCCAGGCCTGGCCTGG - Intronic
1023243733 7:38178378-38178400 CGGCCGCCCCAGGCTGGCCCGGG - Exonic
1023601363 7:41884674-41884696 CTGCAAGCCCAGCCCTTCCCTGG + Intergenic
1024548578 7:50541935-50541957 CGGCCACCCCAAGTCTGCCAGGG + Intronic
1025211121 7:57020064-57020086 TGCCCAGGCCTGGCCTGCCCCGG + Intergenic
1025247565 7:57328712-57328734 CCGCCAGGCCTGGCCTGCCCAGG + Intergenic
1025660834 7:63556783-63556805 TGCCCAGGCCTGGCCTGCCCCGG - Intergenic
1026529194 7:71182717-71182739 CGGCCAGCTCTGCCCTCCCCAGG - Intronic
1026654472 7:72245200-72245222 CAGGCAGCCCAGCCCCGCCCTGG + Intronic
1026868856 7:73838779-73838801 ATGCCTGCCCAGACCTGCCCAGG + Intronic
1026885765 7:73943494-73943516 CCGCCAGCCCCAGCCAGCCCAGG + Intergenic
1026930414 7:74220353-74220375 GGGCCAGGCGAGGCCTCCCCAGG + Intronic
1027187737 7:75981981-75982003 AAGCCTGCCCAGCCCTGCCCCGG + Intronic
1030884540 7:114922147-114922169 GAGCCAGCCCAGGCCGGCTCTGG + Exonic
1032084131 7:128874694-128874716 CCGCAAGCCCAGGCCAGCTCAGG - Intronic
1032093321 7:128923031-128923053 GCGCCAGCCCAGGGGTGCCCTGG + Intergenic
1033407840 7:141088027-141088049 CCTTCAGCCCAGGCCTGTCCAGG - Intronic
1033622603 7:143075741-143075763 AGGGTAGCCCAGTCCTGCCCAGG + Intergenic
1034203405 7:149296130-149296152 CAGCCAGCCCAGGCCCTTCCGGG - Intronic
1034553740 7:151837015-151837037 CCTCCAGCTCAGCCCTGCCCTGG + Intronic
1034878301 7:154744418-154744440 CGGCCAGCCGAGGCATGTTCGGG + Intronic
1035308207 7:157946993-157947015 TGAGCAGCCCTGGCCTGCCCTGG + Intronic
1035351083 7:158247011-158247033 CTCCCAGCCCAGGCCTGGCATGG - Intronic
1035469204 7:159098931-159098953 CGGCGAGCGCAGGGCTGCCTGGG - Intronic
1035573834 8:691407-691429 GGTCCAGCACAGGCCTGTCCTGG + Intronic
1035581929 8:745982-746004 CGGCCTGCTCAGGCCAGCCAAGG + Intergenic
1035658895 8:1331982-1332004 CTGCCAGCCCTGGCCCACCCTGG - Intergenic
1036135573 8:6157999-6158021 CAGCATGCCCAGGGCTGCCCAGG + Intergenic
1036283730 8:7424397-7424419 CTGCAAGACCAGGCCAGCCCAGG - Intergenic
1036337741 8:7887132-7887154 CTGCAAGACCAGGCCAGCCCAGG + Intergenic
1036448930 8:8848113-8848135 CAGCCCGCCCAGGGCTGCACTGG + Intronic
1037822302 8:22140886-22140908 AAGCCTGCCCAGGCCTGCACCGG + Intronic
1037883646 8:22585268-22585290 GGGCCACCCCCAGCCTGCCCAGG - Intronic
1038272624 8:26087886-26087908 AGGACAGCCCAGGCCTGACCCGG + Intergenic
1040288900 8:46114335-46114357 CAGCCCGCCCAGGACAGCCCTGG + Intergenic
1040289352 8:46116475-46116497 CGGCCTGCCCAAGACAGCCCTGG + Intergenic
1040292416 8:46132245-46132267 CAGCCAGGCCAGGACAGCCCTGG + Intergenic
1040301082 8:46188341-46188363 CAGCCCGCCCAGGACAGCCCTGG + Intergenic
1040303831 8:46201913-46201935 CAGCCAGCCCAGGACAGCCCAGG - Intergenic
1040328967 8:46376303-46376325 CAGCCTGCCCAGGACAGCCCTGG - Intergenic
1040332262 8:46391647-46391669 CAGCCTGCCCAGGACAGCCCTGG - Intergenic
1040333272 8:46403205-46403227 CAGCCTGCCCAGGGCAGCCCTGG - Intergenic
1040336533 8:46418875-46418897 CAGCCAGCCCGGGACAGCCCTGG - Intergenic
1040337724 8:46424533-46424555 CGGCCTGCCCAGGACAGACCTGG - Intergenic
1040341553 8:46443666-46443688 GAGCCAGCCCAGGACAGCCCTGG + Intergenic
1040552548 8:48449675-48449697 GGGACAGCCCAGGCCTGTGCCGG + Intergenic
1041270611 8:56105363-56105385 CCGCCAGCCTCGGCCTCCCCAGG - Intergenic
1042590539 8:70393646-70393668 GGGCCAGGCCAGGTGTGCCCAGG + Intronic
1043388023 8:79767512-79767534 AGGCGAGCGCAGGCCTGCCGCGG - Intronic
1044992052 8:97804797-97804819 AGGCCAGGCCAGGCCAGGCCAGG - Intronic
1047514768 8:125544636-125544658 TGGGCAGCCCAGGCCTCCCATGG + Intergenic
1048922936 8:139247136-139247158 GGGCCAACCCTGGCCTGCCTGGG + Intergenic
1049014930 8:139913648-139913670 CGGCCATCCCAGGGCTGCAGAGG - Intronic
1049324982 8:142017108-142017130 GGGGCTGCCCAGGCCTGCCCGGG + Intergenic
1049352576 8:142171997-142172019 AGGCCTGCCCAGATCTGCCCCGG + Intergenic
1049355554 8:142186542-142186564 CGCCCAACCCAGACCTTCCCTGG + Intergenic
1049373343 8:142278040-142278062 CAGCCATCCCTGGCCTGCACAGG + Intronic
1049396526 8:142403484-142403506 CGCCCAGCCCAGGCCGAGCCCGG + Intergenic
1049411346 8:142475334-142475356 CTCCCAGGCCAGGCCTTCCCCGG + Intronic
1049454580 8:142680560-142680582 GGGCCAGCCAAGGCCTCACCTGG - Exonic
1049501767 8:142971093-142971115 CTGCCTGCCCAGGCCTGGCGTGG + Intergenic
1049508967 8:143018389-143018411 CGCGCCGCCCAGGCCTACCCCGG - Intronic
1049665090 8:143839479-143839501 CGCCGCGCCCAGGCCAGCCCAGG + Intronic
1049800200 8:144514137-144514159 CGCCCAGCCCATCCCGGCCCTGG + Intronic
1049989542 9:977945-977967 CGGCCGGCCCGGCCCTGCCCAGG + Intronic
1050472478 9:6007789-6007811 CGCCCAGCCTAGGCCTGCCGGGG - Intronic
1052851283 9:33380062-33380084 CAGCCACCTCAGGCCTGGCCTGG - Intergenic
1055336609 9:75238463-75238485 CGCGCAACCCAGTCCTGCCCAGG - Intergenic
1056369721 9:85941548-85941570 GGGTCAGCCCAGCCCAGCCCCGG - Intronic
1056454906 9:86750954-86750976 CCTCCAGCCCAGGGCTGCCTGGG - Intergenic
1056708535 9:88971609-88971631 AGCCCAGGCCAGGCCTCCCCAGG + Intergenic
1056731048 9:89167085-89167107 TGGCCAGCACACCCCTGCCCTGG + Intronic
1056796576 9:89662818-89662840 CGCCCTGCCCATGGCTGCCCTGG + Intergenic
1057019893 9:91689026-91689048 AGTCCAGGCCAGGCCTGCACGGG + Intronic
1057220633 9:93256081-93256103 CCCCCAGCCCAGGGGTGCCCGGG - Intronic
1057229232 9:93308804-93308826 AGGCCAGGCCAGGCCAGGCCAGG + Intronic
1057855273 9:98596577-98596599 GGCCCAGCCCAGCCCTGCCATGG + Intronic
1060267760 9:122122163-122122185 GGGCCAGCCCAGGGCAGCCGAGG - Intergenic
1060375972 9:123115368-123115390 CGCCCAGCCCAGGGCTGGCAAGG + Intronic
1060821854 9:126665785-126665807 GGGCCAGCCCATGCCAGCCCGGG + Intronic
1061196625 9:129110431-129110453 CGGCCCGCCCAGGCCGTCCAGGG + Intronic
1061287927 9:129634759-129634781 CGGGCAGCACAGGCCTGCTGTGG + Intronic
1061625686 9:131839371-131839393 TGTCCTGGCCAGGCCTGCCCCGG - Intergenic
1061859435 9:133460402-133460424 GCGCCAGCCCAGCCCAGCCCGGG - Intronic
1061912525 9:133732588-133732610 CTGCCACAGCAGGCCTGCCCGGG + Exonic
1061931485 9:133835326-133835348 AGGCGAGCCCAGGCCAGCACAGG + Intronic
1061945688 9:133907249-133907271 CAGCAAGCCCTGCCCTGCCCAGG + Intronic
1062088788 9:134663214-134663236 GGGCCAGCCCAGGTCAGGCCAGG - Intronic
1062192841 9:135256525-135256547 TGGCCTGCCCAGGCCTCCCTGGG + Intergenic
1062209721 9:135357026-135357048 ATCCCAGCCCAGCCCTGCCCGGG + Intergenic
1062325374 9:136010239-136010261 GCCCCAGCCCAGGCCTGTCCCGG + Exonic
1062361289 9:136189541-136189563 CAGCCAGCCCAGCCCTCCCTCGG + Intergenic
1062399382 9:136365778-136365800 GGGCCAGGCCAGGGCTGTCCTGG + Intronic
1062440733 9:136568194-136568216 CGCCCAGAGCAGGCCAGCCCGGG + Intergenic
1062462993 9:136669627-136669649 GGGCCAGCCCAGGGCTGCGGCGG - Exonic
1062547834 9:137071523-137071545 ATGCCAGCTGAGGCCTGCCCAGG - Intergenic
1185482707 X:459680-459702 CCTCCAGCCCTGGCCTGCCTTGG + Intergenic
1189160361 X:38804038-38804060 TGCCCTGCCCTGGCCTGCCCCGG + Exonic
1189294874 X:39910957-39910979 TGCGCAGCCCGGGCCTGCCCTGG - Intergenic
1189309627 X:40010252-40010274 CGGGCAGCCCAGGCCCACCTAGG - Intergenic
1190258899 X:48785987-48786009 ACGCCAGCTCCGGCCTGCCCTGG - Intergenic
1190278456 X:48914107-48914129 GGGCCAGGCCAGGCCAGGCCAGG + Exonic
1190321947 X:49184825-49184847 CAGCCTGCCCAGCGCTGCCCAGG - Intronic
1190340687 X:49292957-49292979 CGGCCACCTCAGGCATGGCCGGG + Intronic
1191107842 X:56783248-56783270 CGGCCAGCCATGGCTTCCCCTGG + Intergenic
1192166701 X:68831183-68831205 CCCCCAGCCCCGCCCTGCCCCGG + Intronic
1196357223 X:114809101-114809123 CAGCAACTCCAGGCCTGCCCAGG - Intronic
1198561608 X:137856464-137856486 CTGCCATCCCAATCCTGCCCTGG + Intergenic
1200036357 X:153334210-153334232 CTGCCACGCCAGGCCTGCCTGGG + Exonic
1200039223 X:153353716-153353738 CCCCCAGCCAATGCCTGCCCCGG + Intronic
1200090307 X:153632879-153632901 CGGCCTTCCCAGCCCAGCCCCGG - Intergenic