ID: 1172113891

View in Genome Browser
Species Human (GRCh38)
Location 20:32562774-32562796
Sequence CTGCAGGAGCAGAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 8, 3: 58, 4: 544}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172113891_1172113903 11 Left 1172113891 20:32562774-32562796 CCCTCCCCATTCTGCTCCTGCAG 0: 1
1: 0
2: 8
3: 58
4: 544
Right 1172113903 20:32562808-32562830 CCCTGATCACCCCAAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172113891 Original CRISPR CTGCAGGAGCAGAATGGGGA GGG (reversed) Intronic
900089338 1:913037-913059 CTGCAGGAGCCTAAAGGAGATGG + Intergenic
900138133 1:1127514-1127536 CTGGAGGGGCAAGATGGGGAGGG - Intergenic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900552692 1:3264584-3264606 CAGGAGGAGCGGAAAGGGGAGGG + Intronic
900623227 1:3596726-3596748 CTGTAGGAGCAGGGTGGAGACGG - Intronic
900696630 1:4016170-4016192 CCGCAGCAGAAGAATGGGCAAGG + Intergenic
901034361 1:6327385-6327407 CGGCAGGAGCAGGAGGAGGAGGG - Exonic
901771950 1:11535080-11535102 CAGCAGGAGCAGGATGTGGGTGG - Exonic
902222825 1:14977688-14977710 CTTCAGGTGCAGAATGGGCTGGG + Intronic
902601097 1:17540431-17540453 CTGCAGGAGGAGACTGTGGGAGG + Intronic
902649147 1:17825455-17825477 CTGCAGGAGCAACATGGCCACGG - Intronic
903182729 1:21613230-21613252 CTGCAGGAGGAGATAAGGGAGGG + Intronic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
903352307 1:22725023-22725045 CACCAAGAGCAGAAGGGGGAGGG - Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
904432414 1:30472976-30472998 CTGAAGGAGCAGAAAGGGAAGGG - Intergenic
904464774 1:30701316-30701338 CTTCAGGAGGAGGAAGGGGAGGG - Intergenic
904647394 1:31978069-31978091 CTGCAGGGGCAGATGGGAGATGG + Intergenic
904700478 1:32355013-32355035 CTGCAGGAGGTGAAAGGTGATGG - Intronic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905658009 1:39698501-39698523 CTGGAGGAGCAAAATGCAGATGG + Intronic
905658018 1:39698578-39698600 CTGGAGGAGCAAAATGCAGATGG + Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
905816155 1:40952615-40952637 CAGCGGGAGCAGAACGGGAATGG + Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906636843 1:47415917-47415939 GGGGAGGAGCAAAATGGGGAGGG + Intergenic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
907328675 1:53657469-53657491 CGGATGGAGCAGAATGTGGAAGG + Intronic
907472564 1:54683500-54683522 GGGCAGGAGCAGAATCAGGAAGG - Intronic
907865752 1:58397659-58397681 CAGAAGGAGCAGGCTGGGGAAGG - Intronic
908370973 1:63477075-63477097 CTGGAGGAGCAGCATGTCGAGGG + Intronic
908440843 1:64152294-64152316 CTAGAGGAGAAGAATGGGGAAGG - Intronic
909245354 1:73274146-73274168 CTGTAGGAGCAGAGGTGGGAAGG + Intergenic
909444531 1:75733941-75733963 ATTCAGGAGCAGGATTGGGATGG + Intronic
909872793 1:80764359-80764381 CAGCAGGAGCAGAATAGAAAAGG - Intergenic
910746472 1:90580319-90580341 CTGCAGCAGCTGCAGGGGGAGGG - Intergenic
911131044 1:94388807-94388829 CTGGAGGAGTAAAATAGGGAAGG + Intergenic
911288537 1:96027929-96027951 CTGCAGGAACAGTGTGGGGCAGG - Intergenic
911770567 1:101735664-101735686 CTGCTGGAGCATAAAGGGCAAGG + Intergenic
912346673 1:108969358-108969380 CCCCAGGAGCAATATGGGGAGGG - Intergenic
912472846 1:109917384-109917406 CTGCAGCTGCACAATGGCGATGG - Exonic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
912628125 1:111223051-111223073 CCGCAGGAGAGGCATGGGGAAGG - Intronic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
914447903 1:147765660-147765682 AGGCAGGAGCAGATTGTGGAGGG + Intronic
914619214 1:149390407-149390429 CTGCTGGAGAAGGATGCGGACGG + Intergenic
914995513 1:152540057-152540079 TGGCAGGAACAGAATGGAGAAGG - Intronic
915003016 1:152610845-152610867 TGGCAGGAACAGAATGGAGAAGG + Intergenic
915287833 1:154864156-154864178 CTGCAGGACCAGGATGCAGAAGG - Intronic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
915585892 1:156843745-156843767 CTGCAAGAGGAAAATGGGGCTGG - Intronic
915644793 1:157262036-157262058 CTGAGGGAGCAGAATGGAGCTGG - Intergenic
917180391 1:172290466-172290488 TGGCTGGAGCAGAATGAGGATGG + Intronic
918139951 1:181711764-181711786 CCCAAGGAGCAGAAGGGGGAAGG + Intronic
918389259 1:184040884-184040906 GTGCTGGAACAGTATGGGGAGGG - Intergenic
918689624 1:187465119-187465141 CTGCAGGGTCAGAATGGTGGAGG + Intergenic
919915383 1:202135674-202135696 CTGAGGGAGCGGGATGGGGAGGG - Intronic
919924102 1:202183378-202183400 CTGCAGGAGCTGAAGGAGGTGGG + Intergenic
920460603 1:206136673-206136695 TTGCTGGTGCAGAGTGGGGATGG + Intergenic
921383926 1:214551307-214551329 CCGCAGGAGGCGAAAGGGGAGGG + Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
922225920 1:223645843-223645865 CTCCTGGAGCAGAAGGGAGAGGG + Intronic
922279641 1:224111530-224111552 CTGCAGGAGAAGAAGAGAGATGG + Intergenic
922764920 1:228151720-228151742 CTGCTGGGGCAGAGTGGGCATGG + Intronic
923861708 1:237898285-237898307 CAGCAGGAGCAGAATGGCCTGGG + Intergenic
924509936 1:244721910-244721932 CTGAAGCAGCAAAGTGGGGAAGG - Intergenic
1062925746 10:1314413-1314435 CTGCAGGGGCAGACCAGGGAGGG - Intronic
1062952748 10:1516946-1516968 CTGAAGTAGCAGAAAAGGGATGG + Intronic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063881338 10:10535788-10535810 CCACAGGAGCAGAATGGGGAGGG + Intergenic
1064107567 10:12512976-12512998 CTGGAGGAACACAGTGGGGATGG + Intronic
1064344572 10:14520286-14520308 CTCCAAGAGGAGAGTGGGGAAGG - Exonic
1066628456 10:37434015-37434037 CTGGAGGAGCAGTGTGGGGAGGG + Intergenic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG + Intergenic
1067438776 10:46296665-46296687 CTGCAGCAACACAGTGGGGAGGG - Intronic
1068143903 10:53040885-53040907 CTCCAGGAGTAGAGTGAGGAGGG + Intergenic
1069911318 10:71761591-71761613 CTGCAGGTGCAGACAGGTGAGGG - Exonic
1069947340 10:71997137-71997159 CTGCAGTGGAAGAGTGGGGAGGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070526777 10:77302319-77302341 CTTAAGGAGCAGTATGGGGGTGG - Intronic
1070816587 10:79328371-79328393 CTCCAGGAGCAGAAGGGGGCTGG + Intergenic
1070823249 10:79375528-79375550 CTGCAGGAGCTGAGTGTGGAGGG + Intergenic
1070837958 10:79462938-79462960 CCACAGGAGCAGAGAGGGGAGGG + Intergenic
1072708040 10:97696308-97696330 CTGCAGAAGCATAATGGGCAAGG - Intergenic
1072740685 10:97907345-97907367 CTGCAGGTAGAGAAGGGGGAGGG + Intronic
1073340929 10:102744035-102744057 GAGCAGGAGCAGGAGGGGGATGG + Exonic
1074192608 10:111150733-111150755 CTGCAGGAGTAGAAGAGGGTTGG - Intergenic
1075221230 10:120586582-120586604 CAGGAGGACCAGAATGGGAAAGG + Intronic
1075618131 10:123906107-123906129 GTGCAGGAGCAGACAGGGGGAGG - Intronic
1075627597 10:123973737-123973759 CTGAAGGAGCTGGATGGGGCTGG - Intergenic
1075667323 10:124240523-124240545 CAGCAGCAGGAGATTGGGGATGG - Intergenic
1075852974 10:125603769-125603791 CTGCAGGAGTTGGGTGGGGAGGG - Intronic
1076053551 10:127353322-127353344 GTGCAGGAGCAAAATGGGAATGG + Intronic
1076200892 10:128557115-128557137 CTGGAGGTGCCGACTGGGGAGGG + Intergenic
1076800909 10:132827756-132827778 CTGCAGGAGAAGTTGGGGGAGGG - Intronic
1077187080 11:1240168-1240190 GTGCAGGTGCAGGCTGGGGATGG - Exonic
1077485072 11:2834871-2834893 CTGCAGGAGCCTCGTGGGGAGGG - Intronic
1077727507 11:4689738-4689760 CTGCTGGGGCAGAATGTTGATGG + Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078461710 11:11519737-11519759 CTGCAGGAGCAACCAGGGGAAGG + Intronic
1079237798 11:18702069-18702091 CTGCAGGAGCTGGATCAGGATGG + Exonic
1079310084 11:19357586-19357608 TTGGAGGAGTAAAATGGGGATGG + Intronic
1080726829 11:34906390-34906412 CTGAAAGAGCAGACTGGGGAGGG + Intronic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1083301124 11:61740104-61740126 CTGAAGGAGCACAGTGGGAAAGG - Intronic
1083443900 11:62694505-62694527 TGGCAGGATCAGAATGGGTAGGG - Intronic
1083594994 11:63914955-63914977 CTGCAGGGGCAGCAGGGGCAGGG + Intronic
1083868329 11:65470945-65470967 CTGCAGGAACTGAAGAGGGAGGG - Intergenic
1084314490 11:68337135-68337157 CTGAAGGAGACGAATCGGGAGGG + Intronic
1084412791 11:69013910-69013932 CTCCAGGGGCTCAATGGGGAAGG - Intergenic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084690477 11:70722416-70722438 CTGGAGGAGCAGAAAGGGACAGG - Intronic
1084944272 11:72630506-72630528 CAGCAGGAGCAGTTTGGGGGAGG + Intronic
1085810962 11:79680690-79680712 CTGAAGGAGCAGTTTGGGAAGGG - Intergenic
1088711714 11:112514255-112514277 CTGCAGGAGATCCATGGGGAGGG + Intergenic
1088712673 11:112522824-112522846 TTCCAGAAGCAGAATGGAGAAGG + Intergenic
1088728258 11:112658378-112658400 CTGCATGAGCAGAATGTTGTGGG - Intergenic
1088835128 11:113571449-113571471 CTGCATGAGTAGACTGGAGAAGG + Intergenic
1089523503 11:119081436-119081458 CTGCAGGAGAAGAGGAGGGAAGG - Intronic
1089555703 11:119315100-119315122 CTGCAAGAGCAGCCCGGGGAGGG - Intronic
1090174223 11:124633437-124633459 CAGAAGTAGAAGAATGGGGATGG + Exonic
1090329632 11:125920850-125920872 CAGCAGGAGCAGAGAGGAGAGGG + Intronic
1090481724 11:127074811-127074833 TTGCGGGAGCAGAATGTTGACGG + Intergenic
1090599429 11:128355032-128355054 CAGCTGGAGCAGACTGGGAAGGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092205779 12:6613623-6613645 ATGGTGGTGCAGAATGGGGAGGG - Intergenic
1092231804 12:6779934-6779956 CTGCTGGAGCAGGAGGGGCATGG + Intergenic
1092763898 12:11835462-11835484 CTGCATGGGCAGAATGAGGGAGG - Intronic
1093160525 12:15741336-15741358 CTGCTGGCTCAGGATGGGGATGG - Intronic
1093235758 12:16606787-16606809 CTGCAGGAGTCGACTGAGGAAGG + Intronic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1094032745 12:26031719-26031741 CTGCGGGATCAGAGTGGGAATGG + Intronic
1095955273 12:47802431-47802453 CTGGAGGAGTCGAATGGGGTGGG - Intronic
1096230344 12:49893309-49893331 CAGCAGGAGCAGAGTGTGGCAGG - Intronic
1096456076 12:51788135-51788157 CTGAAGGAGTAGAATTGGGAAGG + Intronic
1096836389 12:54353818-54353840 GTGGAGGAGGTGAATGGGGAAGG + Intergenic
1097041926 12:56161007-56161029 CTATAGCAGCAGAATGGGGCAGG - Intronic
1097214596 12:57400638-57400660 CTGCAGGAGCAGAAGGTGTCTGG - Intronic
1097572071 12:61346340-61346362 CTGCAGCACCAAAATGGGGTCGG + Intergenic
1099200992 12:79676701-79676723 CTGAGGGAGCAGAATAGTGAAGG - Intronic
1104437189 12:128765723-128765745 CTGTGGGAGCAGAGTGGGAAAGG - Intergenic
1104634221 12:130427595-130427617 CTGCCAGAGCAGAAGGGAGAGGG + Intronic
1104641012 12:130467291-130467313 CTCCAGGAGCAATTTGGGGAGGG - Intronic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104915659 12:132263087-132263109 CTTCAGGAGCACGTTGGGGACGG + Intronic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1105407772 13:20145864-20145886 CTGCTGGAGCGGGATGGGGAGGG - Intronic
1105752401 13:23433553-23433575 CTGCAGGAGCGGCCTGGGGACGG - Intronic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1107022799 13:35768330-35768352 CTGCAGCAGCAGCCTGTGGATGG + Intergenic
1108095232 13:46894173-46894195 CTGGAGGAGCAGCCTAGGGAGGG + Intronic
1108454370 13:50598194-50598216 CTGCAGGGGCAGAAGGGCAAGGG - Intronic
1110814487 13:79846288-79846310 CTTAAGGAATAGAATGGGGAGGG - Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111555704 13:89878917-89878939 CTGTAGGTGAAGAATTGGGAAGG - Intergenic
1111675717 13:91386026-91386048 CTGCAAGAGAATGATGGGGATGG - Intergenic
1112019292 13:95357799-95357821 CTTCAGGAGCAATTTGGGGAGGG + Intergenic
1112426964 13:99311359-99311381 GCACAGGATCAGAATGGGGATGG + Intronic
1113095052 13:106654346-106654368 CTGTCAGAGCAGAGTGGGGAGGG + Intergenic
1113130272 13:107028919-107028941 CAGCAGGAAAAGGATGGGGAGGG - Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113692789 13:112323635-112323657 CTGCAGGGGCAGGAAGCGGAGGG - Intergenic
1114158900 14:20140413-20140435 TAGCAGGAAGAGAATGGGGAAGG + Intergenic
1114530505 14:23392653-23392675 CTGCAGGAGAAGGGTGGGGGTGG + Intronic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1115762613 14:36590509-36590531 CTGCACGTGCACAATGGGCATGG + Intergenic
1116601062 14:46923373-46923395 ATGAAGGTGCAGAATGGAGATGG + Intronic
1117873051 14:60220813-60220835 CTACAAGAGCAGAGTGAGGAGGG - Intergenic
1118733298 14:68684422-68684444 CCGCAGGAGCTGACTGGGGGAGG + Intronic
1119631668 14:76237482-76237504 AGGCAGGAGCAGAAAGGGGAAGG - Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1122155239 14:99746727-99746749 CACCAGCAGCAGAATGGGGATGG - Intronic
1122277845 14:100604330-100604352 CTGGGAGAGCAGATTGGGGAAGG + Intergenic
1122307572 14:100775668-100775690 CAGCAGGAGAAGAGTGGGCAGGG - Intergenic
1122737965 14:103854791-103854813 CTGCAGGAGCAGGGAGGGGGAGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1202830767 14_GL000009v2_random:26907-26929 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1124245393 15:28066697-28066719 CTTCAGGATCAGAAAGGGAAGGG - Intronic
1125186876 15:36941033-36941055 CTGCAGAAGAAGAATGGAGGGGG - Intronic
1125769348 15:42154538-42154560 GGGAAGGAGCAGAGTGGGGAGGG + Intronic
1125782532 15:42282684-42282706 ATTAAGGAGCAGATTGGGGAAGG - Intronic
1125925483 15:43559509-43559531 ATGCATGAACAGGATGGGGATGG + Intronic
1125953443 15:43773584-43773606 CTGCGGCAGGAGAATGGGGCAGG + Intronic
1126180872 15:45783938-45783960 CTGCAGCATCACAAAGGGGAAGG + Intergenic
1126334464 15:47571074-47571096 AGGCAGGAGAAGAGTGGGGAGGG - Intronic
1127263848 15:57345778-57345800 CTGCAGGAGAGTAATGGGGCAGG - Intergenic
1127674773 15:61228830-61228852 TTGCGGGAGCAGAGTGGGGCGGG - Intronic
1127931555 15:63600502-63600524 GTGCAGGGGCAGAAAGAGGAGGG + Intronic
1128157579 15:65401569-65401591 CAGAAGGAACAGGATGGGGACGG + Intronic
1128350540 15:66885491-66885513 CTCTAGGTGCTGAATGGGGAAGG - Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128819694 15:70640633-70640655 CTGCAGCAGCACAATGGGAGTGG - Intergenic
1129084865 15:73078279-73078301 CTGCAGGAGAAGCAGGGAGAAGG + Intronic
1129110254 15:73333104-73333126 CTGCAGGAGTAGAGAGGGGCTGG - Intronic
1129144326 15:73633349-73633371 CGGCAGGAGGAGGACGGGGAAGG - Exonic
1129152768 15:73699496-73699518 CTCCTGGACCAGAGTGGGGAAGG - Intronic
1129301053 15:74625779-74625801 CTGGAGGAGGAGGATGGGCAGGG - Intronic
1129615730 15:77097718-77097740 CTGCAGGAGAGGGAAGGGGAAGG + Intergenic
1129692564 15:77722036-77722058 CTGCAGGTGCAGAGAGGGGTGGG - Intronic
1129759804 15:78122844-78122866 CTGAATGAGCAGAATGGTTAGGG + Intronic
1131035606 15:89220045-89220067 ATGCAGGAGCAGGATGGTGAAGG - Intronic
1131427725 15:92360546-92360568 CTGGAGGAGCAAATGGGGGAAGG + Intergenic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1132267180 15:100484454-100484476 CTGCCGGAGCAGCAGAGGGAGGG - Intronic
1132368818 15:101278313-101278335 CGCCAGGAGCAGTGTGGGGAAGG + Intergenic
1132659141 16:1053831-1053853 CAGCAGGTGCAGACTGGGCAGGG + Intergenic
1132746598 16:1438810-1438832 CTGCAGGGGCAGCATGAGGTGGG - Exonic
1133263021 16:4564439-4564461 CTGAGGGAGTAAAATGGGGAGGG - Intronic
1133721445 16:8498233-8498255 CTGCAGAAGCAGAGCGGGAATGG - Intergenic
1134252594 16:12584970-12584992 CTGAAGGAGCAGGGTGGGGGAGG - Intergenic
1134369489 16:13609760-13609782 GAGCAGGAGCAGATGGGGGAAGG + Intergenic
1134416820 16:14050787-14050809 CTCCAGGTGCAGAATGGGGGCGG + Intergenic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1134809629 16:17156494-17156516 CTGCAGGAGCAAAGTGGGGCTGG - Intronic
1135117877 16:19738993-19739015 CTGCAGAGGGAGCATGGGGAGGG - Intronic
1135125501 16:19806166-19806188 CTGCAGGAGCAGGAGGGTGCTGG + Intronic
1136074847 16:27809930-27809952 CTGGAGGAGAAGATGGGGGAAGG + Intronic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136786554 16:32938554-32938576 ATGTAGGAGCGGGATGGGGACGG - Intergenic
1136883214 16:33915240-33915262 ATGTAGGAGCGGGATGGGGACGG + Intergenic
1137067575 16:35864240-35864262 TTGCAGGAACAGACTGGGGTAGG - Intergenic
1137573573 16:49583037-49583059 AGGCAGGAACAGAAAGGGGAAGG - Intronic
1137776419 16:51058421-51058443 ATCCAGGAGCAGAATGGGGAGGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1137981288 16:53072215-53072237 CTGCAGGAGCAGCAGCTGGAGGG - Intronic
1138349136 16:56337274-56337296 CTGCTGAAGCAGCATGGGGCCGG + Intronic
1140219396 16:73032980-73033002 CAGCAGGAGCAGGATGGGGAAGG + Intronic
1141046677 16:80721807-80721829 CACCAGGAGAAGGATGGGGATGG - Intronic
1141138228 16:81480575-81480597 CTGGAGCAGCAGAATGGGTCAGG - Intronic
1142099938 16:88265707-88265729 CTGCAGGAGCAGACGGGAGTGGG + Intergenic
1203088789 16_KI270728v1_random:1200220-1200242 ATGTAGGAGCGGGATGGGGACGG - Intergenic
1142769376 17:2085662-2085684 AGCCACGAGCAGAATGGGGAGGG + Intronic
1143622178 17:8087009-8087031 ATGAAGGAGCAGGATGGAGAAGG + Intronic
1143795682 17:9334252-9334274 CTGTAGGAGCAGTTTAGGGAGGG + Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1143975133 17:10823938-10823960 GTGCAGGAGTAGCTTGGGGAAGG - Exonic
1144838330 17:18170079-18170101 CTGCAGAAGCAGATCTGGGAAGG - Intronic
1145019249 17:19416749-19416771 CTGCTGGAGCAGATTTGGGAAGG - Exonic
1145065669 17:19759796-19759818 CTGCTGGAGGAGAAGCGGGAAGG + Intergenic
1145791445 17:27630140-27630162 ATCCAGGAACATAATGGGGATGG + Exonic
1146658853 17:34651428-34651450 CTGGAGGAGCAGAACGGGGCTGG + Intergenic
1147999706 17:44380566-44380588 CTCCAGGGGCGGGATGGGGAAGG - Intronic
1148698775 17:49576139-49576161 CTGAAGGAGCAGGAAGGGGAAGG + Exonic
1149612467 17:57967635-57967657 CTGAGGGAGAAGAATGGGGAGGG - Intergenic
1150335689 17:64329072-64329094 CAGCAGGAGCACAAGGGTGAGGG - Intronic
1150339792 17:64357237-64357259 ACCCAGGAGGAGAATGGGGATGG - Intronic
1150402758 17:64872411-64872433 CAGAGGGAGCAGAATGGAGATGG + Intronic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1151702272 17:75749884-75749906 CTGGAGGAACAGAAGCGGGAGGG - Intronic
1152335464 17:79698018-79698040 CTGCAGGAGCAGGTGGGGGTGGG + Intergenic
1152422214 17:80199994-80200016 CTCCAGGAGGGGACTGGGGATGG + Intronic
1154334082 18:13452207-13452229 CAGCAGGAGATGAATAGGGAGGG + Intronic
1155398711 18:25415423-25415445 CTGCAAGAGCAAATAGGGGAGGG - Intergenic
1155700928 18:28742547-28742569 CTGCAATAACAGAATAGGGAGGG - Intergenic
1155914585 18:31543339-31543361 CTGCAGGAGCAGGCTTGGTAGGG + Intronic
1156151313 18:34246754-34246776 CAGCAGCAACAGTATGGGGAGGG + Intergenic
1157409014 18:47448177-47448199 CTGCAGGACCAGGAAGGAGATGG + Intergenic
1157444005 18:47731324-47731346 CCGTGAGAGCAGAATGGGGAAGG + Intergenic
1159027476 18:63197616-63197638 CAGCAGGAACAGAAAAGGGAAGG + Intronic
1159837188 18:73352611-73352633 CTGCTGGGCCAGAATGGGGGAGG + Intergenic
1159933901 18:74344920-74344942 CTCCAGGAGTAGAATTGGTATGG + Intronic
1160406145 18:78647453-78647475 CCGCAGGAGCAGGAGGCGGAGGG + Intergenic
1160761816 19:789291-789313 CAGCAGAGGCAGAATTGGGAGGG - Intergenic
1160955251 19:1688313-1688335 CTGTGGGACCAGAATGGGGTGGG + Intergenic
1161170770 19:2811539-2811561 CTGGAGGAGGAGCATGGGGTGGG + Intronic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161391268 19:4022036-4022058 CTGCAGGTCCAGATTGGGCATGG - Intronic
1161541008 19:4851621-4851643 ATGCAGGAGCGGAGTGGCGAAGG + Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161652304 19:5492822-5492844 TTGCAGGCGAAGAATGTGGACGG - Intergenic
1163516273 19:17765786-17765808 CAGCAGGAGGAGAAGGTGGAGGG + Intronic
1163545051 19:17936387-17936409 CTGCGGGAAGAGGATGGGGATGG - Intronic
1163838057 19:19588167-19588189 ATCCAGGAGAAGAATAGGGATGG - Intronic
1164398202 19:27884558-27884580 CTGAAAGGGCAGACTGGGGAAGG + Intergenic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1165242258 19:34478203-34478225 GTCCAGGAGAAGGATGGGGATGG - Intergenic
1166055341 19:40285034-40285056 CTTCAGGAGCTGAGTGGGGGTGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166558103 19:43715035-43715057 CTACAAGAGGAGAATGGAGAAGG + Intergenic
1167331479 19:48859072-48859094 GCGCAGGGGCAGAACGGGGACGG + Exonic
1167609854 19:50501809-50501831 CTGCAGGCACAGAATGGAGGGGG - Intergenic
1167849114 19:52188693-52188715 CTGAGGGAGTTGAATGGGGATGG - Intergenic
1168326194 19:55539664-55539686 CTGTGGGAGCAGAACTGGGAAGG + Intergenic
1202641926 1_KI270706v1_random:100869-100891 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925237646 2:2293456-2293478 CTGCAGGAGCAGGGCGTGGAGGG + Intronic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG + Intergenic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
927181631 2:20450621-20450643 CTCCAGGAGCAGAGGGGAGAGGG + Intergenic
927611326 2:24544198-24544220 CTGGAGGAGAAGATTAGGGAAGG + Intronic
929589237 2:43134448-43134470 CTGCAGGAGCAGGGTGGGATGGG - Intergenic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929869499 2:45746347-45746369 CAGGAGGAGCAGATTTGGGAAGG - Intronic
929948487 2:46388494-46388516 CTGCATGATCAGAAGGGGCAGGG - Intergenic
930257527 2:49109253-49109275 TTGCAGGAGCAGAGTGGGTGGGG + Intronic
931219483 2:60276439-60276461 CTGGAGGAGCAAAATGGAGATGG - Intergenic
931620732 2:64206985-64207007 CTGCAGGAGAATAGTGGGAAAGG - Intergenic
932448383 2:71794466-71794488 CTGCAGGGCCAGAGTGGGGAGGG + Intergenic
934155460 2:89195839-89195861 AAGCAGTAGGAGAATGGGGAAGG - Intergenic
934211863 2:89986919-89986941 AAGCAGTAGGAGAATGGGGAAGG + Intergenic
935155294 2:100479070-100479092 CTCCAGGAGCAGAGTGCTGAGGG + Intronic
935190870 2:100777810-100777832 CTGCAGGAGCAGACTGGATTTGG - Intergenic
935217172 2:100983487-100983509 GTGCAGGGGCAGGAAGGGGAGGG - Intronic
937408737 2:121654200-121654222 ATGGAGGAGCAGGTTGGGGATGG + Intergenic
937487059 2:122326272-122326294 CTGGAGGAAAAGAAAGGGGAAGG + Intergenic
937492851 2:122388050-122388072 CTCTAGGAGCAATATGGGGAGGG - Intergenic
937819174 2:126288405-126288427 CCACAGGAGCACAATGGGTAAGG + Intergenic
938548884 2:132361300-132361322 CTGCAGGATCTGGGTGGGGAAGG + Intergenic
939376860 2:141379958-141379980 CTTCAGGAGCAGGCTGAGGAAGG - Intronic
939568085 2:143808316-143808338 CAGCAGGAGCTGAATGGGAGGGG + Intergenic
940278235 2:151962012-151962034 GTGCAATAGCAGAGTGGGGAAGG - Intronic
942223717 2:173796423-173796445 CTCCAGGAGCAATTTGGGGAGGG - Intergenic
944427937 2:199603389-199603411 CTGCAGGGGCAGAAGGGAGCTGG + Intergenic
945742475 2:213680286-213680308 CCACAGGAGCATAATGGAGAAGG + Intronic
945934361 2:215887721-215887743 TTGCAAGAGCAGCATGGTGAAGG + Intergenic
946782260 2:223204105-223204127 CTTCAGGAGCAAAATGGGTTTGG - Intergenic
947267686 2:228301159-228301181 CTGAAAGGGCAGACTGGGGAGGG - Intergenic
947496746 2:230643264-230643286 CTGCAGGACTAGAGTGGGCAGGG - Intergenic
947671645 2:231940755-231940777 ATGCAGGACCAGGATGGGGTTGG - Intergenic
947927932 2:233937983-233938005 CTGCAGGAACAGCCTGTGGACGG - Intronic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948113948 2:235479813-235479835 CTGCAGAACCAGCATGGGGGTGG - Intergenic
948617037 2:239205804-239205826 CGGCAAGAGGTGAATGGGGAAGG + Intronic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
948737518 2:240018934-240018956 GGGCAGGAGCAGGATGGGGGTGG - Intronic
948838299 2:240636796-240636818 ATGCAGGAACAGAAGGGGGAGGG - Intergenic
948882771 2:240868921-240868943 CAGCAGGAGCTGGTTGGGGATGG - Exonic
949044269 2:241863777-241863799 CTGCAGAAGCAGTTTCGGGATGG - Intergenic
1168851756 20:981800-981822 CTGCAGGACCAGCATAGGGCAGG - Intronic
1169447930 20:5688052-5688074 TTGCATGAGCAGGAAGGGGAAGG - Intergenic
1169794186 20:9443620-9443642 CTGCAGGATCAGACTGAGGCTGG + Intronic
1169864981 20:10190355-10190377 CTGCTGAAGTATAATGGGGAAGG - Intergenic
1170199291 20:13725145-13725167 CTGCATGAGCAGATAGGGTAGGG - Intronic
1171292490 20:23990268-23990290 CTGCAGGAGCAGAAGTGCCAGGG - Intergenic
1171340690 20:24425245-24425267 CTGCAGGAACACAGTGGAGATGG + Intergenic
1171371621 20:24665972-24665994 CTGCAAGACGAGAATGGGGCTGG + Exonic
1171491945 20:25526131-25526153 TCACAGGGGCAGAATGGGGAAGG - Intronic
1171824065 20:29878625-29878647 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1171877708 20:30593827-30593849 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172487007 20:35304380-35304402 CTGCAGGAGCTGTCTAGGGAGGG - Intronic
1172624829 20:36340974-36340996 TTCCAGGAGGAGCATGGGGAGGG - Intronic
1173274335 20:41566502-41566524 CCACAGGAGCAGAGTGGGGAAGG - Intronic
1174171110 20:48618749-48618771 CTGAAGGAGCTGAAGGGGGAAGG - Intergenic
1174197842 20:48786047-48786069 CAGCAGGAAGAGAATGGGGCTGG + Intronic
1174454893 20:50642004-50642026 CTGCGGAAGCAGAAGGGGGTGGG - Intronic
1174471909 20:50767726-50767748 CTGCGGAAGCAGAAGGGGGTGGG + Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175844505 20:62051465-62051487 CTGCACGTGCAGCCTGGGGAGGG - Intronic
1175888960 20:62307656-62307678 CTGCTGGAGCAGAAGGGGCTGGG - Exonic
1175940631 20:62536036-62536058 CTCCAGAAGCAGAGTTGGGAGGG - Intergenic
1175949210 20:62574045-62574067 CTGCAGGAGCCACATGGGGCTGG + Intergenic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1176020248 20:62959008-62959030 CTGCAGGAGCTGGAGGAGGAGGG + Intronic
1176609954 21:8871745-8871767 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1177397666 21:20558327-20558349 CTGCATAACCAGAATGGAGATGG - Intergenic
1177807499 21:25888648-25888670 TTGCAGGAGCAAAATCGGGAAGG - Intronic
1177861859 21:26463719-26463741 CAACAGGAGCAGAATGGAGCTGG - Intergenic
1178288442 21:31345658-31345680 CTAAAGGAACAGAATGGGCACGG + Intronic
1178337738 21:31758782-31758804 TTCCAGGAGAAGAATTGGGATGG + Intergenic
1178466135 21:32849793-32849815 TTGCAGGAGCAGGGAGGGGAGGG + Intergenic
1178906733 21:36642797-36642819 TTGCTGGAGAAGAGTGGGGAAGG - Intergenic
1179970853 21:44836163-44836185 CTGCAGGGGTAGGGTGGGGATGG - Intergenic
1180360019 22:11880996-11881018 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1181416356 22:22762257-22762279 CTGCAGGAGAGGAAAGGAGAGGG - Intronic
1181725992 22:24811302-24811324 CAGCAGGTGCAGGATGGGTAGGG - Intronic
1182801925 22:33038635-33038657 GTGCAGCAGCACACTGGGGATGG - Intronic
1182874801 22:33682390-33682412 GTGCAGGAGAAGAAGTGGGAAGG - Intronic
1184241975 22:43215838-43215860 TTGCTGGAGCTGAATGGGGTGGG + Intronic
1184755331 22:46512661-46512683 CCGAAGGAGCAGAGTGGGGCGGG - Intronic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185276996 22:49954081-49954103 CCGCAGGAGGAGAGTGTGGAAGG + Intergenic
1185344915 22:50306936-50306958 CTGCAGGAGCAGGGTGCGGAGGG + Intronic
949488980 3:4568974-4568996 GAGCAAGAGAAGAATGGGGAGGG + Intronic
950032647 3:9862707-9862729 CTGGAGGCGCTGAATGGGGCCGG + Intergenic
950429074 3:12940645-12940667 TTGCAGGGGCAGGCTGGGGAGGG - Intronic
950523084 3:13507876-13507898 CTGAGGCAGCAGAGTGGGGATGG - Intergenic
950630602 3:14279385-14279407 CTACAGGTGCAAGATGGGGAGGG + Intergenic
950630968 3:14281747-14281769 AAGCAGGAGCAAATTGGGGAGGG - Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
950796051 3:15511549-15511571 CTGCAGGAGCAGCATTGGTTGGG - Intronic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
952914424 3:38222477-38222499 CTGCAAGAGCAGAGTGGGGAGGG + Intronic
954330043 3:49884966-49884988 CTGCAGAAGCTCAATGGGGAAGG + Intergenic
954443627 3:50535079-50535101 CTTGAGGAGCAGAATGGGGGAGG - Intergenic
954941388 3:54376192-54376214 CTGCAGGTGTGGAATGGGAAGGG - Intronic
955406976 3:58631665-58631687 GTGGAGGAGCAGGATGGGAAAGG + Intergenic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
960097068 3:113699056-113699078 CTCCTGGAGCAGGATGGGGGTGG - Intergenic
960915312 3:122688883-122688905 CTGCAGGAGCTGACAGGGCAGGG + Intronic
961128807 3:124446359-124446381 CCACAGCAGCAGATTGGGGATGG + Intronic
961471142 3:127113806-127113828 CTGCAGGGGCAGGATAGGGTTGG - Intergenic
961602686 3:128073349-128073371 CAGCAGGAGCAGGCTGGGGGCGG - Intronic
961645340 3:128389797-128389819 CTGCTCCAGCAGAATGGGCAGGG + Intronic
962236471 3:133711593-133711615 CTAGAGGAGCACAAAGGGGAGGG - Intergenic
962808430 3:138943065-138943087 CGGCAGGAGCAGGATGGAGAGGG - Intergenic
964626157 3:158762049-158762071 TGGCAGGAGCAGGATGGGGAAGG + Intronic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
965670401 3:171142032-171142054 CTGCAGGAGCTCCATCGGGAAGG - Intronic
1202736640 3_GL000221v1_random:6535-6557 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
968562154 4:1289818-1289840 CGGCCGGAGCAGGATGGGGGCGG - Intergenic
968641141 4:1715699-1715721 CTGCAGGAGCAGGGTGGGAGGGG - Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968831814 4:2936095-2936117 CGCCAGGAGCAGTTTGGGGAGGG - Intergenic
968896839 4:3409241-3409263 GAGCAGGAGCACACTGGGGAGGG + Intronic
969457458 4:7308299-7308321 CTGGAGCAGCAGAAGGGGCAGGG - Intronic
971306501 4:25487146-25487168 CCCCAGGAGCAATATGGGGAGGG - Intergenic
971322645 4:25617763-25617785 CTCCAGGAGCAATTTGGGGAGGG - Intergenic
972541575 4:40043701-40043723 CGGCAGGAGCAGGAGGAGGAGGG - Intergenic
973176548 4:47212848-47212870 CTGCAGGTTCAGACTAGGGAGGG - Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
973820898 4:54660353-54660375 CTGCAGGAACGAAACGGGGAAGG - Intronic
973945155 4:55948204-55948226 CTGAGGCAGCAGAATAGGGAAGG - Intergenic
974339436 4:60596016-60596038 CTGAAGGAAAAGATTGGGGAAGG - Intergenic
975032962 4:69645920-69645942 CTGCAAGGTAAGAATGGGGAAGG - Intronic
975359385 4:73450189-73450211 CCAAAGGAGGAGAATGGGGAAGG - Intronic
976031558 4:80760865-80760887 GTGCAGGTGACGAATGGGGAGGG + Intronic
976878531 4:89889385-89889407 CCACAAGAGCAGAGTGGGGAAGG - Intronic
978739322 4:112119507-112119529 CTGCCGGAGGTGAATGGGAACGG - Intergenic
979682909 4:123481159-123481181 CTGCTTGAGCATAATGGAGATGG + Intergenic
980467614 4:133205128-133205150 CTTCTGGAGCAGAGTGGGAAGGG + Intronic
981166710 4:141567730-141567752 CTGTAGGATCAGAATGGGGAGGG - Intergenic
981310026 4:143288611-143288633 CTGATGGAGCAGAATGGGATGGG + Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
982209083 4:153020496-153020518 GTGCAGGAGGAGAGTGGGGAAGG - Intergenic
982822818 4:159965735-159965757 ATGCAGGAGAAGAAATGGGAAGG - Intergenic
983763229 4:171440437-171440459 GTGTAGGGGCAGAAGGGGGATGG - Intergenic
1202769294 4_GL000008v2_random:186734-186756 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
985756189 5:1719930-1719952 CAGCAGGAGCAGGATGTGGCAGG + Intergenic
986445992 5:7821813-7821835 CTGATGGAGCAGAAGGGGAAGGG + Intronic
987918552 5:24248648-24248670 CTGCAGGGGCAGAATGCTCATGG - Intergenic
988271996 5:29028969-29028991 CTGAAGGTAGAGAATGGGGAGGG + Intergenic
988787613 5:34579116-34579138 CTGCAAGAGGAGAAAGGAGAGGG + Intergenic
988998213 5:36734681-36734703 TGTCAGGAGCAGAATGGGTATGG - Intergenic
989439082 5:41448965-41448987 TTGCAGGTGCAGAAAGGGAAAGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989779761 5:45249939-45249961 CTGCAGGGGGAAAGTGGGGATGG - Intergenic
990258623 5:53997660-53997682 ATGAAGGAGGTGAATGGGGAAGG + Intronic
990855829 5:60265460-60265482 CCACAGGAGCACAATGGAGAGGG + Intronic
993092339 5:83441848-83441870 ATGCAGGTTCAGACTGGGGATGG - Intergenic
993224732 5:85153304-85153326 CTGCCTGAGCAGGATGGGGAAGG - Intergenic
993305639 5:86271877-86271899 GAGCGGGAGCAGAAAGGGGAAGG - Intergenic
993877094 5:93320125-93320147 CTGTAGTAGCTGAATGTGGAAGG + Intergenic
995738356 5:115327896-115327918 CTGAAAGCGCAGACTGGGGAGGG + Intergenic
996017538 5:118557269-118557291 CCCCAGGTGCTGAATGGGGATGG - Intergenic
996286186 5:121795756-121795778 CTGCAGGAGCACAGTGGGGGAGG + Intergenic
996698470 5:126424124-126424146 CTTCAAGAGCAGAGTGGGGATGG + Intronic
996844445 5:127883970-127883992 CTGCAGGCACAGAAAGGGAAAGG + Intergenic
997223711 5:132192974-132192996 CTGAAGGACCAGGAAGGGGAAGG + Exonic
997716388 5:136046312-136046334 CTGCAGGAGCAGAAGACAGAAGG - Intronic
998186269 5:139982226-139982248 GTGCAGGAGCAGATCGGGGGAGG - Intronic
998386061 5:141757797-141757819 GTGCAGGAGCCAAATGGGGTCGG + Intergenic
998464769 5:142334725-142334747 CTGAAGGGGCAGTGTGGGGATGG - Intergenic
999193080 5:149763148-149763170 CTGCAGGGCCAGAGTGGGGAGGG - Intronic
999250106 5:150177411-150177433 ATGCAGGAGGTGCATGGGGAAGG - Intronic
1000977112 5:167777073-167777095 TTACAGGAGTAGAAGGGGGAGGG + Intronic
1001653239 5:173329724-173329746 CTCCAGGAGGAGGGTGGGGACGG - Intergenic
1001925451 5:175632964-175632986 CTCAAGGAGCAGAGTGGGCAAGG - Intergenic
1001960596 5:175878499-175878521 CTGCTGGAGGAGAAAGGAGATGG - Intronic
1002072470 5:176688369-176688391 CTGCAGCAGCAGTTTGGGGGTGG + Intergenic
1002163738 5:177332303-177332325 CTGCAGGAGGGCAGTGGGGATGG + Intronic
1002308579 5:178298750-178298772 CTAAAGGAGCAGAATGGGCCAGG + Intronic
1002340367 5:178512837-178512859 TGGCAGGAGCAGAATAGGCATGG - Intronic
1002915571 6:1525502-1525524 ATGCTGGAGCAGAATGGGAAGGG - Intergenic
1003418424 6:5934341-5934363 CTGCAGGAACACAGTGGGCAAGG - Intergenic
1004403503 6:15310644-15310666 CTGCAGGTGCAGAGATGGGATGG + Intronic
1005726770 6:28656928-28656950 CATTAGGAGCAGAGTGGGGACGG + Intergenic
1005941456 6:30563285-30563307 CAACAGGAGAAGAATGGGGAGGG - Exonic
1006094189 6:31645425-31645447 CTGCTGGAGCACCATGGGGGTGG + Exonic
1006444131 6:34069433-34069455 CTGGAGCAGCCGCATGGGGAGGG - Intronic
1006467181 6:34202764-34202786 CTGCAGGGACAGAAAGGGGGTGG + Intergenic
1006514284 6:34537500-34537522 ATGCAGGACCGGAGTGGGGAAGG - Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007368864 6:41413275-41413297 CAGCAGCAGCAGAACTGGGAAGG - Intergenic
1007622467 6:43223410-43223432 ATGCAGGAGCAGAAGGGGTCTGG - Intronic
1007918623 6:45586200-45586222 CTTCAGGAGGATAATGGAGATGG + Intronic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008793349 6:55267849-55267871 TTGCAGGGGCAGAATCAGGAAGG + Intronic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1010985136 6:82414855-82414877 CTGGAGGAGCAGCAGTGGGAGGG + Intergenic
1011140546 6:84150875-84150897 CTGTAGGAGGAGAATGAGCATGG - Intronic
1011559915 6:88603801-88603823 CTGCAGAAGCATGATAGGGATGG - Intergenic
1012216855 6:96597751-96597773 ATGCAGCAGCAGAACTGGGAAGG - Intronic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1013335943 6:109161378-109161400 CTGCTGGAGCAGAAAGCAGAGGG + Intronic
1014251716 6:119122187-119122209 CTGGAGGTCCAGAATGGAGAGGG - Intronic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1016223054 6:141699318-141699340 CTGAAGGAGGAGAGTGGGAAGGG + Intergenic
1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG + Intronic
1016354095 6:143198990-143199012 CTGCAGTAGCAGAAAAGGGAAGG + Intronic
1016488295 6:144567299-144567321 GTGTTGGAGCAGACTGGGGAAGG + Intronic
1016644826 6:146394515-146394537 CTCCAGAAGCAGAAAGGGCATGG - Intronic
1017357256 6:153524218-153524240 GTGAAGGTGCAGAATTGGGAAGG + Intergenic
1017419385 6:154258069-154258091 AACCAGGAGAAGAATGGGGAGGG - Intronic
1018919504 6:168161515-168161537 GGGGAGGAGCAGCATGGGGAGGG - Intergenic
1019014168 6:168867646-168867668 CTGCAGGGGTAGCATGGGGACGG + Intergenic
1019215218 6:170438908-170438930 CTGGAGGAGCAGGCTGGGGGTGG + Intergenic
1019275101 7:172108-172130 CTGCACGTGCAGACAGGGGAGGG + Intergenic
1019561388 7:1660450-1660472 CTGCAGGAGCAGGTTGGGATGGG - Intergenic
1019581780 7:1767789-1767811 CTGCATGAGCAGACGGGGGTGGG - Intergenic
1019664351 7:2243957-2243979 CAGCAGGAGCAGAGTGGGTGGGG + Intronic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1019934919 7:4247880-4247902 CTGGAGGAGACCAATGGGGAGGG - Intronic
1020277649 7:6634619-6634641 CTGCAGGAGCAGGAAAGGGCAGG - Intergenic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1021311357 7:19101714-19101736 AGGCAGGAGAAGAATGGGGGTGG + Intronic
1023835712 7:44066086-44066108 CAGCAGCAGCAGAATGGGCAAGG + Intronic
1023860362 7:44214652-44214674 CAGCGGGATCAGGATGGGGATGG - Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024312155 7:47979375-47979397 CAGGAGGATCAGAACGGGGATGG - Intronic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1026397216 7:69967532-69967554 GTGCAGGAACATAAAGGGGAAGG + Intronic
1027052244 7:75027749-75027771 TTACACGAGCAGGATGGGGATGG - Intronic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1027877255 7:83787026-83787048 CCACAGGAGCAGAGTGGGAAGGG - Intergenic
1029275702 7:99402949-99402971 ATGCAGGAGGAGAATTGGCAAGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG + Intronic
1033022946 7:137745509-137745531 CTGCCTGAGCAGAATGGAGCAGG - Intronic
1033642899 7:143279273-143279295 CTGGAGGAGCAGTGTGGGAAAGG + Intergenic
1033809528 7:144994915-144994937 CTGCAGAAACAGAATCGGAAAGG + Intergenic
1034163617 7:149009865-149009887 CTTGAGGAGGAGAATGGAGAGGG - Intronic
1034437715 7:151071049-151071071 CTGCCAAAGCAGCATGGGGATGG - Intronic
1036070170 8:5433929-5433951 CTGCAGGAGCAGCATTGAGAAGG + Intergenic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1037218633 8:16488731-16488753 CTGATAGAGCTGAATGGGGATGG + Intronic
1037290527 8:17345223-17345245 CTGCAGGAGCAGAGCGTGGCAGG - Intronic
1037292523 8:17366439-17366461 CAGCATCAGCAGAATGGGAAGGG + Intronic
1037878517 8:22561312-22561334 CTGCAGGAGCAGAAGGGACCAGG - Intronic
1037908097 8:22727304-22727326 CTGCAGGAGGAGGATGGGAGAGG + Intronic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1040528230 8:48243144-48243166 CTGAAAGAGAAGATTGGGGAGGG + Intergenic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1040621370 8:49096303-49096325 CTGCAGGAACAGTAGGGGCAAGG - Intergenic
1041560719 8:59215302-59215324 TTGCAGCAGCAGTCTGGGGAGGG + Intergenic
1041741148 8:61158311-61158333 CTGGAGGAACAGACTGGGAAGGG + Intronic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1042847319 8:73181399-73181421 CTGCAGGAGCAGATGGTGGTTGG + Intergenic
1044014976 8:87040056-87040078 CTCCAGGAGCAATTTGGGGAAGG + Intronic
1044708964 8:95036947-95036969 ATGCTCCAGCAGAATGGGGAAGG - Intronic
1045865168 8:106857156-106857178 TCACAGGAGCAGAATGGGGTGGG + Intergenic
1046522505 8:115343447-115343469 TTGCAGAAGGAAAATGGGGAAGG - Intergenic
1047525604 8:125631761-125631783 CTCCTGGAGCTGAATAGGGATGG + Intergenic
1047981822 8:130191332-130191354 CTGCAGGAGCAGATTATAGATGG + Intronic
1048387929 8:133930609-133930631 CTACAGGATCAGACTGGGGCTGG - Intergenic
1048719572 8:137308290-137308312 CTGCAGGATTAGAATGGGTTTGG - Intergenic
1048843817 8:138587988-138588010 ATGCAGGATCACAGTGGGGAGGG - Intergenic
1049019151 8:139941904-139941926 CTGAAGGAGCCCCATGGGGAGGG + Intronic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049179309 8:141212899-141212921 CAGCAGGGGCTGAGTGGGGAGGG + Intronic
1049447849 8:142639651-142639673 GTGGAGCAGCAGACTGGGGATGG + Intergenic
1049582910 8:143420887-143420909 CAGCAGGAACAGAAGGGTGAGGG + Intronic
1049586583 8:143435262-143435284 CAGCAGGAGCAGGGTGGGGGTGG - Intergenic
1049684548 8:143934092-143934114 CTGCAGCAGCAGCACAGGGAAGG + Intronic
1049706506 8:144045612-144045634 CTGCAGGAGGAGCTTGGGCAGGG + Intronic
1049812725 8:144582681-144582703 CTGCAGGAGGAGGATGAGGCGGG + Intronic
1049818340 8:144618946-144618968 CTGCAGGACGAGGATGAGGACGG - Intergenic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1050733540 9:8736906-8736928 CGGGAGGAGGGGAATGGGGAGGG - Intronic
1051613633 9:18985698-18985720 CTGCCGGAACAGAAAGGGCAGGG - Intronic
1051963470 9:22797240-22797262 TGGTAGGAGCAGAATGGGAACGG + Intergenic
1052135557 9:24905629-24905651 TAGCAGGAGCAGCATGGTGAAGG + Intergenic
1053395172 9:37766960-37766982 CTACGGGAGCAGAGTTGGGAGGG + Intronic
1053752017 9:41266625-41266647 CTGCAGGATCTGGGTGGGGAAGG - Intergenic
1054257538 9:62830955-62830977 CTGCAGGATCTGGGTGGGGAAGG - Intergenic
1054333775 9:63784767-63784789 CTGCAGGATCTGGGTGGGGAAGG + Intergenic
1054337225 9:63817734-63817756 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1054360419 9:64108905-64108927 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1055673161 9:78627410-78627432 CTGCAAGAGCAGAGGGGAGAGGG - Intergenic
1055957418 9:81787221-81787243 CTCCATGAGGTGAATGGGGAAGG - Intergenic
1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG + Intergenic
1056711379 9:88994514-88994536 AAGCAGCAGCAGAATGGAGAAGG + Exonic
1056841361 9:90000220-90000242 CTGCAGGAGCAGCAGGGAGAGGG - Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1058184742 9:101841065-101841087 CTGTAGGAGCAGGTTTGGGAGGG + Intergenic
1058412541 9:104748631-104748653 CTGAAGGGGCAGGATGGGAAGGG + Intronic
1059434500 9:114267902-114267924 TTCCAACAGCAGAATGGGGAGGG - Intronic
1059442780 9:114319159-114319181 CTGAATGGGAAGAATGGGGAGGG - Intergenic
1059915317 9:119093278-119093300 CTGCAGCAGCACTGTGGGGATGG + Intergenic
1060970883 9:127737192-127737214 CAGCAGCAGCAGAGTGGGAAAGG - Intergenic
1061930311 9:133828991-133829013 CTGTGGGAGCAGAGTGGGGCTGG - Intronic
1062218212 9:135400385-135400407 GGGCAGGAGCAGGATTGGGAGGG - Intergenic
1062364466 9:136202303-136202325 CTGGAGCCGCAGGATGGGGAAGG - Intronic
1203694182 Un_GL000214v1:80450-80472 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
1203492339 Un_GL000224v1:118981-119003 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1203377132 Un_KI270442v1:385055-385077 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1203504962 Un_KI270741v1:60853-60875 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1203705372 Un_KI270742v1:36975-36997 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1203558637 Un_KI270744v1:28830-28852 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
1203642091 Un_KI270751v1:23613-23635 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1185754047 X:2638566-2638588 CAGCAGGAGCAGGACGGGGTGGG - Intergenic
1186195870 X:7110030-7110052 CTGCAAGGGCAGCATGGGGAGGG + Intronic
1187426480 X:19181830-19181852 CTGAAAGAGCAGAAGGGAGATGG + Intergenic
1189778436 X:44491059-44491081 TTGCAGGAAGAGAAGGGGGATGG - Intergenic
1190256276 X:48765102-48765124 CTGAAGCTGCAGAATGGGAAAGG + Intronic
1190775450 X:53549000-53549022 CAACAGGAGCAGCTTGGGGATGG + Exonic
1192208196 X:69109966-69109988 CAGCAGGAGCTGGAAGGGGAGGG + Intergenic
1192484651 X:71514506-71514528 CTGAGGGAGCAGAAAGGAGAGGG + Intronic
1193352939 X:80483075-80483097 CTGAAAGGGCAGACTGGGGAGGG + Intergenic
1195758196 X:108220058-108220080 CTGTAGAAGCATAATGGAGAGGG - Intronic
1196895840 X:120334721-120334743 CAGTAGGAGCAGAATGGGGAAGG - Intergenic
1197182516 X:123551676-123551698 CTGCAGTAGTAGAATGGGTAGGG - Intergenic
1199424022 X:147680435-147680457 CTGCAGGAGCAGAGTAGGGAGGG + Intergenic
1199440851 X:147866439-147866461 CTGCAGCAGCAGCATGGGGTGGG + Intergenic