ID: 1172113937

View in Genome Browser
Species Human (GRCh38)
Location 20:32562925-32562947
Sequence GAGTGGAGAAGGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1837
Summary {0: 1, 1: 1, 2: 9, 3: 195, 4: 1631}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172113921_1172113937 26 Left 1172113921 20:32562876-32562898 CCTAAGGAGGGCAGGGAGGGTGG 0: 1
1: 0
2: 11
3: 115
4: 715
Right 1172113937 20:32562925-32562947 GAGTGGAGAAGGAGGGTGGAGGG 0: 1
1: 1
2: 9
3: 195
4: 1631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172113937 Original CRISPR GAGTGGAGAAGGAGGGTGGA GGG Intronic
900145593 1:1157561-1157583 GTGTGGAGCAGGAAGGGGGAAGG + Intergenic
900149096 1:1170533-1170555 GAGAGGAGGAGGAGGGAGGAGGG - Intergenic
900384020 1:2401228-2401250 GAGGGAGGAAGGAGGGAGGAAGG - Intronic
900384024 1:2401239-2401261 GAGGGAGGAAGGAGGGAGGAAGG - Intronic
900391602 1:2436251-2436273 GAAAGGAGGAGGAGGGAGGAGGG - Intronic
900391684 1:2436485-2436507 GAAAGGAGGAGGAGGGAGGAGGG - Intronic
900530301 1:3149759-3149781 GAGCGGTGAAGGTGGATGGATGG - Intronic
900614736 1:3560461-3560483 GGGTGAGGAAGGAGGGAGGAAGG - Intronic
900657218 1:3764520-3764542 GATACGAGGAGGAGGGTGGATGG - Intronic
900765469 1:4502095-4502117 GAGGGGACAAGGAGGGTGCCAGG - Intergenic
900795269 1:4703967-4703989 GTGGGGAGAAGCAGGGTAGAGGG - Intronic
900932880 1:5747797-5747819 GAAAGGAGAAAGAGGGAGGAAGG + Intergenic
901152561 1:7113491-7113513 GAATGGAGAGGGAGGAAGGAGGG + Intronic
901159064 1:7161271-7161293 GGGTGGAGAAGGAGGGCTGCAGG - Intronic
901411645 1:9088344-9088366 AGGTGGAGAAGGAGGAGGGAGGG - Intronic
901517104 1:9755368-9755390 GGGTGGAGATGGGGGGAGGAGGG - Intronic
901742422 1:11350944-11350966 GAAAGGAGAGGGAGGGAGGAAGG - Intergenic
901928812 1:12583835-12583857 AAGTGGAGTAGGTGAGTGGATGG - Intronic
902280572 1:15371348-15371370 TAGTGGAGGAGGACGGGGGAGGG + Intronic
902389772 1:16096397-16096419 GAGTGGAGTGTGAGGGAGGAGGG - Intergenic
902528264 1:17073610-17073632 GAGTGGGGAGGGAGAGAGGAGGG + Intronic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
902550529 1:17216517-17216539 GAGTGGGGAAGGAGTGGGCATGG + Intronic
902833114 1:19030211-19030233 GAGGAGAGAAGGAGGGAGGGAGG + Intergenic
902881083 1:19372168-19372190 GAGTGGAGGAGCAGGGTGGGAGG - Intronic
902985072 1:20149976-20149998 GGGTGGAGAAGGAGGCAGAAGGG + Exonic
903004499 1:20289750-20289772 GTGTGGAGAAGGAGGTAGGGTGG + Intergenic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903383437 1:22912020-22912042 GGGTGGAGAAGGATGGAGAATGG + Intronic
903406772 1:23103900-23103922 GAGGGGGGAAGGAGGGAGGGAGG + Intronic
903576439 1:24342397-24342419 GGGTGGAGGAGGAGAGGGGAAGG - Intronic
903625952 1:24730316-24730338 GAGGGGAGGGGGAGGGGGGAGGG + Intergenic
903684349 1:25120079-25120101 GAGGGAAGAAGGAGGGAAGAGGG - Intergenic
903687018 1:25139301-25139323 TAGAGGAGAGGGAGGCTGGAGGG - Intergenic
903772147 1:25770713-25770735 GAGGGGAGAAGGAAAGTGGGCGG - Intronic
903850351 1:26301926-26301948 CAGTGGAGAAGGATGGGGAAGGG + Intronic
903950086 1:26991587-26991609 CAGTGAAGAGGAAGGGTGGAGGG - Intergenic
904033368 1:27546837-27546859 GAAGGGAGAAGCAGGTTGGACGG - Intronic
904163644 1:28538750-28538772 GGGTGGGGAGAGAGGGTGGAGGG + Intronic
904391534 1:30189303-30189325 GAGTGGGGAGGGAGGGTGTGGGG - Intergenic
904560757 1:31395606-31395628 GAGTAGAGAGGAAGGGTGGCGGG + Intergenic
904582325 1:31553846-31553868 GAGTGGGGGAGGGGGGTGGAAGG - Intergenic
904814205 1:33182819-33182841 GGGTGGAGAAGGAGCCTGGGTGG + Intergenic
905266328 1:36756529-36756551 GAGGGGAGAAGGAGAGGGAAAGG + Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905404834 1:37725710-37725732 GGGTGGAGATGAAGGGGGGAAGG + Intronic
905435297 1:37951531-37951553 CAGAGGTGAAGGAGAGTGGAGGG - Intergenic
905491388 1:38346731-38346753 GAGAGGAGAAGGGGAGGGGAGGG + Intergenic
905799123 1:40832216-40832238 GAGTGCACAAGGATGGGGGATGG + Intronic
905921510 1:41722473-41722495 GAGGGGAGAGGGAGGGGAGAGGG - Intronic
906000620 1:42421372-42421394 GAGTGCAGAAGGCTGGGGGAAGG + Exonic
906098864 1:43243190-43243212 GAAGAGAGAGGGAGGGTGGATGG - Intronic
906293598 1:44635682-44635704 GAGCGGGGAAGGAAGGTGGGTGG - Intronic
906538073 1:46562936-46562958 GACTGGAGCAGGAGGCTGGAAGG + Intronic
906735818 1:48126045-48126067 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
906805534 1:48776478-48776500 GACGGGAGAAGGAGGCAGGAAGG + Intronic
906837768 1:49102272-49102294 GAGTGGAGGAGGAGGCAGGGAGG + Intronic
907076345 1:51582655-51582677 GTGTAGAGAAGGAGGGAGGCAGG - Intronic
907305993 1:53513500-53513522 GAGTGGAGAAGCTGGGAGGAAGG - Intronic
907387499 1:54135714-54135736 GAGAAGAGAAGGAGGGTAGGGGG - Intronic
907553801 1:55327251-55327273 AGGTGGAGAAGGAGGGAAGAAGG + Intergenic
907922844 1:58929522-58929544 GAGAGCATAAGGAGGGCGGAGGG - Intergenic
908004811 1:59717059-59717081 GAATGGACAAGGAGGGTTAAGGG - Intronic
908504189 1:64778825-64778847 AAGAGGAAAAGGAGCGTGGATGG - Intronic
908516465 1:64897490-64897512 GGGGGGAGGAGGAGGGGGGAGGG + Intronic
908732354 1:67239026-67239048 GAGTGAGGAAGGAGGATGGAAGG + Intronic
909151409 1:72010607-72010629 GAGTGGAGAAAGGGGTTGGGGGG - Intronic
909183690 1:72457785-72457807 GAGGGGAGAGGGAGGGAGGAAGG - Intergenic
909432244 1:75602436-75602458 GAGTGGTTAAGGATTGTGGAGGG + Intronic
909498273 1:76304338-76304360 GAGGGAAGAGGGAGAGTGGAGGG - Intronic
909543311 1:76815315-76815337 GAGTGGAGAAAGGGGCTGGAGGG - Intergenic
909561799 1:77016065-77016087 GAGTGGAGAAGGAGGGGATGTGG - Intronic
909580480 1:77227892-77227914 GAGTGGAGATGAAAAGTGGAGGG + Intergenic
909883118 1:80905187-80905209 CAGTGGATAAAGAGAGTGGAAGG + Intergenic
910333006 1:86097539-86097561 GAAGGGAGGAGGAGGGAGGAGGG - Intronic
910552174 1:88487789-88487811 CAATGAAGAAGGAGGGAGGAAGG + Intergenic
910736295 1:90461592-90461614 GAGGGCAGAGGGAGGGAGGAGGG - Intergenic
910852902 1:91666103-91666125 GTTGGGAGAAGGAGGCTGGATGG + Intergenic
911070103 1:93825635-93825657 CCCTGGGGAAGGAGGGTGGAAGG - Intronic
911090630 1:94014321-94014343 GACGGGGGAAGGAGGGAGGAGGG + Intronic
911201015 1:95043759-95043781 GAAAGGAGAAGGAGCGAGGAGGG + Intronic
911326872 1:96478884-96478906 GACTCGATAAGGAGGGTTGAGGG - Intergenic
912212355 1:107569658-107569680 GACTGGAGAAGGAGGCTGAGTGG - Intergenic
912283611 1:108344464-108344486 GAGGGTAGGAGGAGGGTGGAGGG + Intergenic
912331944 1:108828010-108828032 GGGAGGCCAAGGAGGGTGGATGG + Intronic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912941973 1:114053211-114053233 GAGTGGAGAAGAGAGGTGGCAGG + Intergenic
912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG + Intergenic
913088275 1:115458828-115458850 TATTGGAGCAGGAGGGTGGATGG - Intergenic
913226425 1:116704298-116704320 GGGTGAATAAAGAGGGTGGATGG - Intronic
913355336 1:117915018-117915040 GAGAGGAAAGGGAGGATGGAGGG + Intronic
914244855 1:145878046-145878068 AAGGGGAGAAGGAGGGTAGGTGG + Intronic
914334084 1:146699423-146699445 GATTGGAAGAGGAGGGTGGAAGG + Intergenic
914747128 1:150509089-150509111 GCCTGGAGTAGGAGGGTGGGTGG + Intronic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
914984968 1:152448600-152448622 GAGTGCTGAAGGCAGGTGGAGGG + Intergenic
915106390 1:153537264-153537286 GGGTGGAGGGTGAGGGTGGAGGG + Exonic
915205786 1:154269558-154269580 GAGGGGAGGAGGAGAGAGGAAGG - Intronic
915267369 1:154728675-154728697 GAGAAGAGAAGGTGGGTGCAGGG + Intronic
915288517 1:154867944-154867966 GAGTGGAGATGGAGGAAGGTGGG - Intronic
915304314 1:154969106-154969128 GAGTAGAAAAGGGGGGTAGATGG - Intronic
915516023 1:156413190-156413212 GGGTGCAGATGGAGGGTGGCAGG + Intronic
915661051 1:157405315-157405337 GAGTGGTAAAGATGGGTGGAAGG - Intergenic
915725501 1:158014208-158014230 GAGAGAAAAAGGAGGGAGGAGGG + Intronic
916070685 1:161168007-161168029 GTTTGGAGAAGGGGGGTGAAGGG - Exonic
916276081 1:162994753-162994775 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
916332049 1:163628292-163628314 GAGGGGAGGAGGAGGGGGGAGGG - Intergenic
916524763 1:165598881-165598903 GAGAGGAGAAGAGGGGAGGAGGG + Intergenic
916736722 1:167614140-167614162 GAGGGAAGAAGGAGGGAAGAAGG - Intergenic
917045587 1:170856330-170856352 GAGAAGAGAAGAAGGGAGGAGGG + Intergenic
917105008 1:171483330-171483352 GAGGGGAGAAGGAGGGAGGGAGG + Intergenic
917140306 1:171828523-171828545 GAGAGAAGCAAGAGGGTGGAGGG + Intergenic
917231689 1:172844750-172844772 GAGAGAAGAGGGAGGGAGGAAGG + Intergenic
917392358 1:174552314-174552336 GGGTGGAGGCGGAGGGTGGAAGG - Intronic
918018270 1:180659435-180659457 GAGGGAAGAAGGAGGGAAGAAGG - Intronic
918066314 1:181104648-181104670 GAGGGGAGTAGGAGGTCGGAAGG - Intergenic
918294136 1:183139455-183139477 GAGTGTAAAAGGAGGGAGAAAGG - Intronic
918317103 1:183331376-183331398 GAGAGGAGAAGGGAGCTGGAGGG + Intronic
918462866 1:184794385-184794407 AAGCGGAAATGGAGGGTGGAAGG - Exonic
918733117 1:188022989-188023011 GAGAGGAGAAGGGGAGGGGAGGG + Intergenic
918887745 1:190218732-190218754 GAGGGGACAAGGAGGGTGGGGGG - Intronic
919502102 1:198349973-198349995 GAGTGGGGATGGAGGTGGGATGG + Intergenic
919519726 1:198572909-198572931 GAGAGGAGTAGGTGGGTGGGAGG + Intergenic
919819333 1:201463092-201463114 GAGGGCAGGTGGAGGGTGGAGGG - Intergenic
920034624 1:203057956-203057978 GAGTTGAGAAGGAGGAGGGTGGG + Intronic
920073717 1:203321771-203321793 GAGGGGAGAAGAAGAGGGGAAGG - Intergenic
920080509 1:203369482-203369504 GAGGGGAGTGGGAGGGTGGAAGG - Intergenic
920116364 1:203624502-203624524 GAGGGAAGAGGGAGGGAGGAAGG + Intergenic
920215336 1:204358723-204358745 GAGAGCTGCAGGAGGGTGGAAGG - Intronic
920363000 1:205432184-205432206 GAAGGGAAAAGGAGGGAGGAGGG + Intronic
920507995 1:206530664-206530686 GAGTAGAAAAGCAGGGAGGAGGG + Intronic
920655003 1:207868512-207868534 GTGTGGAGGAGGAGGCGGGAAGG - Intergenic
920701958 1:208224693-208224715 GAGTGAAGAAGGAAGGTGAGAGG + Intronic
920779862 1:208978752-208978774 GGCTGGAGAAGTAGGGAGGAAGG + Intergenic
920920625 1:210294697-210294719 GAGTGGAGATAGAGGGCTGATGG - Intergenic
921072152 1:211669867-211669889 GAGGGGTGATGGAGGGCGGACGG - Intronic
921294999 1:213693218-213693240 GAGGAGAGAAGGAGGGAAGAGGG - Intergenic
922083182 1:222318209-222318231 ATGTGGAGAAGGAGGGCGGGCGG - Intergenic
922163535 1:223096320-223096342 GAGGGTAGAAGGTGGGAGGAAGG - Intergenic
922432565 1:225570454-225570476 GAGAGGAGAAGGAGGTGGAAGGG - Intronic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
922531715 1:226350070-226350092 GAGGAGAGAAGGAGGCAGGATGG - Intergenic
922599530 1:226838972-226838994 GACTGGATATGGAGGGTGGGAGG + Intergenic
922723309 1:227909860-227909882 GAGGGGAGGAGGAGGCAGGAGGG + Intergenic
923300444 1:232635440-232635462 GAGGGAGGAAGGAGGGAGGAAGG + Intergenic
923452861 1:234136157-234136179 GAAGGAAGAAAGAGGGTGGAGGG - Intronic
923482447 1:234397458-234397480 GGGAGGGGAAGGAGGGAGGATGG + Intronic
923529594 1:234803128-234803150 AAGGGGAGGAGGAGGGGGGAAGG - Intergenic
923751824 1:236753830-236753852 GAGTGGAGAAGGAGAAACGAAGG - Intronic
924005131 1:239600709-239600731 GAGGGAAGAAGGAAGGAGGAAGG - Intronic
924032082 1:239895818-239895840 GAGTGTGGAGGGTGGGTGGAGGG + Intronic
924118877 1:240776422-240776444 GGGAGGGGTAGGAGGGTGGAGGG - Intronic
924202618 1:241675225-241675247 GAGGGAGGAAGGAGGGAGGAAGG - Intronic
924261370 1:242234811-242234833 GAGTGCAGTAGGAGGGAGGGAGG + Intronic
924415099 1:243850143-243850165 GAGGGGAGGAGGAGGGAGGGGGG - Intronic
924608658 1:245556254-245556276 AAGAGGAGGAGGAGGGAGGAAGG - Intronic
1063222046 10:3978062-3978084 GACTGGAGAAGGAGAGAGGAAGG - Intergenic
1063223426 10:3992487-3992509 GAGGGGAGAAGGTGGAGGGAAGG - Intergenic
1063736853 10:8766782-8766804 AAGTGAAGACGGAGGGAGGAAGG - Intergenic
1064300346 10:14117661-14117683 GAAGGTGGAAGGAGGGTGGAAGG + Intronic
1064563330 10:16614333-16614355 GAGAGGAGAAGGATGGTGACCGG + Intronic
1064627243 10:17273848-17273870 GAGAGGAGGAGGAGGGAAGAAGG - Intergenic
1064635242 10:17358596-17358618 AGGAGGAGAAGGAGGGAGGAAGG + Intronic
1064709821 10:18111731-18111753 GAGAGGAGAGGGAGAGTTGAGGG + Intergenic
1064715670 10:18174225-18174247 GAGGGGAGAAGGAAGGGGAAGGG - Intronic
1065169280 10:23010742-23010764 GAGAAGAGAAGGAGTGGGGAGGG - Intronic
1065256659 10:23876321-23876343 GACTCCATAAGGAGGGTGGAAGG + Intronic
1065411707 10:25436547-25436569 GAGTGGCCAGAGAGGGTGGAAGG + Intronic
1065487619 10:26249921-26249943 GGGCGGAGAAGGAGGCAGGAGGG + Intronic
1065550114 10:26861223-26861245 AAGCGGAGACCGAGGGTGGAGGG + Intergenic
1065728770 10:28691712-28691734 GAGTGGAGAGGGGGGATGGAGGG - Intergenic
1065811504 10:29447723-29447745 GAGAGGGGAAGGAGGGAGAATGG - Intergenic
1065857034 10:29839091-29839113 GGAGGGAGAAGGAGGGTGTAGGG + Intergenic
1066175411 10:32898593-32898615 GAGGGTAGTAGGAGGGTGAAAGG + Intergenic
1066199011 10:33128057-33128079 GAGGGGAGAGGGAGGGGGGAAGG - Intergenic
1066224131 10:33365811-33365833 CAGGGGAGAAGGAAGGGGGATGG - Intergenic
1066651856 10:37664019-37664041 GTGTGTAGAAGGAAGGTGCAAGG - Intergenic
1067100938 10:43334034-43334056 GGGAGGTGGAGGAGGGTGGATGG + Intergenic
1067147285 10:43702829-43702851 TAGGGAAGAAGGAGGGTGGTGGG + Intergenic
1067175598 10:43943508-43943530 GAGCGGGGAAGAGGGGTGGAGGG + Intergenic
1067477359 10:46575854-46575876 CAGTGGAGAAGGAGGGTGGGAGG + Intergenic
1067558247 10:47287084-47287106 GGGTGGAGTAGCAGGGTGGAGGG + Intergenic
1067617381 10:47765930-47765952 CAGTGGAGAAGGAGGGTGGGAGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067908608 10:50320757-50320779 AAGTGGAGATAGAGGGAGGAAGG - Intronic
1068764683 10:60750018-60750040 GAGAGTAGGAGGAGGGTGGGAGG + Intergenic
1068830720 10:61491584-61491606 GAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1069059177 10:63875932-63875954 GAGGGGGGAAGGTGGGAGGAGGG - Intergenic
1069333478 10:67321000-67321022 GGGTGGAGCAGGAGGGAGGATGG - Intronic
1069638583 10:69940702-69940724 GAGAGGAGAAGGGGGGCGGGAGG + Intronic
1069640762 10:69954108-69954130 GGATGGAGGAGGAGTGTGGAGGG - Intronic
1069685162 10:70313218-70313240 GAGTGCAGAAGGAAGGAGGAGGG - Intronic
1069721092 10:70549793-70549815 CATTGGAGAAGGAAGGTGGCTGG + Intronic
1069770149 10:70893482-70893504 GAGTGGGGAAGGATGAGGGAAGG + Intergenic
1069786369 10:70990726-70990748 GATTGGGGAGGGAGGGTGGTGGG + Intergenic
1069821156 10:71229556-71229578 GTGATGGGAAGGAGGGTGGATGG - Intronic
1070032707 10:72692502-72692524 GAGAGGAGGAGGAGGGGCGACGG + Intronic
1070259210 10:74838000-74838022 GAGGGGAGAAGGAGGATCCAAGG + Intronic
1070982279 10:80659329-80659351 GAGTGAAGAAGCAGAGTGGAGGG - Intergenic
1071181821 10:82994917-82994939 GAGAGGAGAAGAAGAGGGGAAGG + Intergenic
1071203814 10:83251734-83251756 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1071249025 10:83796938-83796960 GAGGGGACAGGGAGGGAGGAGGG + Intergenic
1071268974 10:83989798-83989820 GAGGGAAGAAGGAGGAAGGAAGG + Intergenic
1071444889 10:85736261-85736283 AAGGAGAGAAGGAGGGAGGAGGG + Intronic
1071565985 10:86671489-86671511 GACTGGGAAAGGAGGGTGGCGGG + Intronic
1071676656 10:87661170-87661192 AAGTGGGGAAGGAGTGTGGAGGG + Intronic
1071876247 10:89846366-89846388 GAAGGGAGAAGGAGGGAGGAAGG + Intergenic
1072079251 10:92012181-92012203 GAGGGGAGAAGGGGAGGGGAGGG - Intronic
1072188923 10:93065146-93065168 GAGTGGAGAAGTTAGGGGGAGGG + Intronic
1072230502 10:93410339-93410361 GAGTGCAGAGGGAAGGTAGAGGG - Intronic
1072674416 10:97454728-97454750 GAAAGGAGAAGGTGGGTGGTGGG - Exonic
1073115404 10:101088865-101088887 GAGTAGAGAAGGGGTGGGGATGG + Intergenic
1073152746 10:101323012-101323034 GAGAGGAGCAGGAGGAGGGAGGG + Intergenic
1073215519 10:101834051-101834073 GAGTAGATATGGAGGGAGGAGGG - Intronic
1073240672 10:102055930-102055952 GAGGGGAGAGGGAGGGAGGACGG - Intronic
1073331678 10:102674142-102674164 AAGTGGAGACGGAGGGAGGGAGG + Exonic
1073339079 10:102731576-102731598 GAGTGCAGAAGGAAGGTCAAAGG + Intronic
1073482736 10:103797280-103797302 GAGAGAAGAAGGTGGGTGGTGGG + Intronic
1073988855 10:109240691-109240713 GAGGGAAGGAGGAGGGGGGATGG + Intergenic
1074002440 10:109386725-109386747 GAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1074326366 10:112455288-112455310 GAGTGGAGGAGGGGAGGGGAGGG - Intronic
1074472988 10:113744268-113744290 GAGTGGAGAGGGACTCTGGAGGG - Intergenic
1074505873 10:114069983-114070005 GAGAGGCTAAGGTGGGTGGATGG - Intergenic
1074721108 10:116265945-116265967 AACTGCAGAGGGAGGGTGGAGGG - Intronic
1074827996 10:117228491-117228513 AAGGGGAGAAGGAGGGAGGGAGG - Intergenic
1075079106 10:119370962-119370984 GAGTGGGGCGGGGGGGTGGAAGG - Intronic
1075162531 10:120037096-120037118 GAGGGTGGAAGGTGGGTGGAGGG + Intergenic
1075263364 10:120981097-120981119 GAGTGGAAAGGGATGGGGGAGGG - Intergenic
1075575195 10:123572745-123572767 GAGAGGAGGAGGAGAGGGGAGGG + Intergenic
1075656242 10:124163005-124163027 GAAGGGGGAAGGAGGGAGGAAGG + Intergenic
1075733668 10:124651322-124651344 AGGTGCAGAAGGAGGCTGGAGGG + Intronic
1076000410 10:126908325-126908347 GAGTTGGTAAGGATGGTGGAGGG - Intronic
1076358267 10:129868630-129868652 GACAGCAGAAGGAGGGTGCAGGG + Intronic
1076484560 10:130807766-130807788 GAGTGAAGAATGGGTGTGGATGG + Intergenic
1076694804 10:132242314-132242336 GAGTGCAGCAGGAGGACGGAAGG + Intronic
1076722851 10:132400309-132400331 GAGTGGGTAAGGAGGGTGTGGGG + Intronic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077216199 11:1396192-1396214 GAGTGGGGGACGTGGGTGGAAGG - Intronic
1077216212 11:1396228-1396250 GAGTGGGGGACGTGGGTGGAAGG - Intronic
1077216225 11:1396264-1396286 GAGTGGGGGACGTGGGTGGAAGG - Intronic
1077248533 11:1550692-1550714 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248567 11:1550818-1550840 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248601 11:1550936-1550958 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248636 11:1551062-1551084 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248727 11:1551379-1551401 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248775 11:1551557-1551579 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248792 11:1551614-1551636 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248863 11:1551862-1551884 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248880 11:1551919-1551941 GAGTGGGGTGGGCGGGTGGATGG - Intergenic
1077254237 11:1573279-1573301 GGGTGGAGAGGGAGCGTGGGGGG + Intergenic
1077287740 11:1775306-1775328 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077287764 11:1775384-1775406 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287774 11:1775417-1775439 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287780 11:1775439-1775461 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287807 11:1775517-1775539 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287835 11:1775606-1775628 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287845 11:1775639-1775661 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287851 11:1775661-1775683 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287866 11:1775706-1775728 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287881 11:1775740-1775762 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077287932 11:1775885-1775907 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287946 11:1775929-1775951 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287973 11:1776007-1776029 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287988 11:1776052-1776074 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288006 11:1776107-1776129 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288021 11:1776152-1776174 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288032 11:1776186-1776208 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288047 11:1776231-1776253 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288062 11:1776276-1776298 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077321051 11:1942122-1942144 GAGTGGGGGAGGAAGGTGGGAGG + Intergenic
1077346026 11:2054427-2054449 GAGAGGCCAAGGCGGGTGGATGG - Intergenic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1077753244 11:4997494-4997516 GGGTCCAGAAGGAGGGTTGAGGG + Intergenic
1077993873 11:7436144-7436166 GAGTGGATAGTGATGGTGGAAGG - Intronic
1078034800 11:7792312-7792334 GAGTAGTGAAGGTGGGTGGAAGG - Intergenic
1078807953 11:14725504-14725526 AAGGGGAGAAGGAGGGGGAAGGG - Intronic
1079050613 11:17154743-17154765 GAGTGGACAAGGAGAATTGAAGG + Intronic
1079303081 11:19296753-19296775 AAGAGGAGAAGGAGGATGGAAGG + Intergenic
1079324118 11:19476936-19476958 AAGAGGAGAGGGAGAGTGGAGGG - Intronic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1079683505 11:23326974-23326996 GGGGGGAGAGGGAGGGGGGAAGG + Intergenic
1080086469 11:28288662-28288684 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
1080347399 11:31340346-31340368 GAGAGGAGCAGGAGGGAGGGAGG + Intronic
1080384274 11:31801476-31801498 CAGTGGAGAGAGAGGGTGGGAGG + Intronic
1080575706 11:33597371-33597393 GAGGGGAGAAGGGAGGAGGAGGG + Intronic
1080996874 11:37613557-37613579 GAAGGGAGAAAGAGGGTGAAGGG + Intergenic
1081017372 11:37899767-37899789 GAGTGGTAAAGGAGGAGGGAGGG - Intergenic
1081102654 11:39024421-39024443 GAGGAGGGAGGGAGGGTGGAAGG - Intergenic
1081189608 11:40087192-40087214 GCGTGGAGAAAGAAAGTGGAGGG - Intergenic
1081538518 11:44013459-44013481 TAGTAGAGATGGGGGGTGGAGGG + Intergenic
1081603695 11:44513308-44513330 GAGTGAGGAGGGAGGATGGATGG + Intergenic
1081728973 11:45355268-45355290 GAAAGGAGAGGGAGGGGGGATGG + Intergenic
1081758175 11:45559374-45559396 GGGTGGGGCAGGTGGGTGGAGGG - Intergenic
1083537200 11:63480387-63480409 GATTGGAGAAGGAAAGAGGAGGG + Intronic
1083799599 11:65038832-65038854 GAGTAGGGACTGAGGGTGGAGGG + Intronic
1083935954 11:65870249-65870271 GGCAGGAGAAGGAGGGCGGAGGG + Intronic
1084104931 11:66975084-66975106 GAGGGGAGGGGGAGGGGGGAAGG + Intergenic
1084214421 11:67639820-67639842 GGGAGGACAAGGAGGGAGGAAGG - Intergenic
1084470498 11:69356480-69356502 GAGGAAAGAAGGAGGGAGGAAGG + Intronic
1084495613 11:69501451-69501473 GAGAGGAAAAGGAGTGGGGAGGG + Intergenic
1084729884 11:71066132-71066154 GAGTGGGGAAGTTGGGTGGGGGG + Intronic
1084751246 11:71205537-71205559 GACTGGGGAAGGAGGCTGAAGGG - Intronic
1084764822 11:71301487-71301509 GAGTGGAGTTGGAGGGTGACTGG + Intergenic
1084928680 11:72535938-72535960 GGGAAGGGAAGGAGGGTGGAAGG + Intergenic
1085369654 11:75988904-75988926 AAGTGGGGAAGGGGGATGGATGG + Intronic
1085401866 11:76240316-76240338 GAGTGGAGAAGAGGGAAGGATGG - Intergenic
1085417701 11:76330243-76330265 GAGGGGAGGAGGGGGCTGGAGGG - Intergenic
1085520928 11:77138434-77138456 GAGGGGAGAAGGGAGGGGGAGGG + Intronic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1085914227 11:80865509-80865531 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1086124694 11:83338407-83338429 GACTGGGGAGGGAGGGAGGAAGG + Intergenic
1086419838 11:86627974-86627996 GACTGGACATGGAGGGTGGGGGG - Intronic
1086540281 11:87900742-87900764 GAGGGAAGAAGGAAGATGGAGGG + Intergenic
1086892784 11:92277699-92277721 GAGTGGAGAGAGAGAGAGGAGGG + Intergenic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087817919 11:102679387-102679409 GAGAGTAGGAGGAGGGTGGCGGG + Intergenic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088472218 11:110198679-110198701 GAGTGGGGTTGGGGGGTGGAGGG - Intronic
1088506458 11:110532326-110532348 GAGAGGCCAAGGTGGGTGGATGG - Intergenic
1089066022 11:115662616-115662638 GAGAGGCCAAGGTGGGTGGATGG - Intergenic
1089125637 11:116174655-116174677 GAGGGGAGGAGGATGGTGGGAGG - Intergenic
1089145800 11:116329021-116329043 GTGTGGGGAAGGTGGGTGCATGG - Intergenic
1089196371 11:116696091-116696113 GAGGGGAGGAAGAGGATGGAAGG - Intergenic
1089514053 11:119020346-119020368 TGGTGGAGAAGGTGGGAGGAGGG + Intronic
1089575861 11:119442664-119442686 GGGTGGGGAGGAAGGGTGGATGG - Intergenic
1089635299 11:119808023-119808045 GACAAGGGAAGGAGGGTGGAAGG - Intergenic
1089641849 11:119853022-119853044 GAGTGGAGAGGGAGATTGGCTGG - Intergenic
1089905270 11:122031724-122031746 GAGTGGGGAGGGTGGGTGGAGGG + Intergenic
1090062598 11:123477206-123477228 GAGAGGAGGGGGAGGGGGGAGGG - Intergenic
1090203283 11:124870770-124870792 GAGGGGAGAAGGAGGATGGTTGG + Intronic
1090414067 11:126528728-126528750 GAGAGGAGAAGGGGAGAGGAGGG + Intronic
1090464974 11:126925619-126925641 CAGTGGAGAATGAAGCTGGACGG - Intronic
1090644804 11:128758751-128758773 GAGTGGAGAAGGGATGAGGAAGG + Intronic
1090718296 11:129449941-129449963 GCCAGGAGAAGGAGGGCGGATGG + Intronic
1090719488 11:129458812-129458834 GAGTGGAAAAGGAGGCAGGAAGG - Intergenic
1090739683 11:129646138-129646160 GAGAGGAGGAGGAGGAAGGAAGG + Intergenic
1090916107 11:131164339-131164361 GAGGGGAGCAGGAGGGTGTCAGG + Intergenic
1091016553 11:132056237-132056259 GAAGAGAGAAGGAGGGTGAAGGG + Intronic
1091916317 12:4273620-4273642 GAGGGGAAAAGGAGGGAGGGAGG + Intergenic
1091934171 12:4422349-4422371 GGGTGGAGAAGGATGGAGAAGGG + Intergenic
1092042282 12:5395439-5395461 GAGTGGAGAGGGAGGGTGTTGGG - Intergenic
1092253490 12:6914409-6914431 GAGTGGGGAAGGGAGGAGGATGG - Intronic
1092281473 12:7101114-7101136 GAGGGAAGAAGGAGGGAGGGAGG - Intronic
1092388297 12:8052721-8052743 GAGAGTAAAAGGAGAGTGGATGG - Intronic
1092392838 12:8096515-8096537 TAGTGGAGAAGGAAGTTGCAAGG - Exonic
1092937915 12:13380848-13380870 AGGTGGAGATGGAGGGAGGATGG - Intronic
1092968250 12:13666358-13666380 GAAGAGAGAGGGAGGGTGGAAGG + Intronic
1092986615 12:13851929-13851951 CAGAGGAGGAGGAGGGTGGGTGG + Intronic
1093141626 12:15516549-15516571 GAGGGAAGAAGGAAGGGGGAGGG + Intronic
1093873115 12:24316247-24316269 AAGGGGAGTAGAAGGGTGGAGGG + Intergenic
1094018573 12:25889934-25889956 AAGAGGAGAAGCAGGCTGGAGGG + Intergenic
1095385527 12:41645723-41645745 GAGAGAAGAGGGAGGGAGGAAGG + Intergenic
1095578447 12:43766352-43766374 GGTTGGAGTAGGAGGTTGGAAGG - Intronic
1096129692 12:49148051-49148073 GATTGGGGAAGGAGTGTGGGAGG + Intergenic
1096230214 12:49892611-49892633 GAGTGGTGAGGGAGGTAGGAGGG - Intronic
1096240989 12:49960310-49960332 ATGTGGAGAACGAGGCTGGAGGG - Intergenic
1096318992 12:50593905-50593927 GAGAGGAAAAGGAGAGGGGAGGG - Intronic
1096319408 12:50598738-50598760 GAGGGGAGGGGGAGGGGGGAGGG - Intronic
1096372753 12:51083009-51083031 GAGTGGAGAATGATGTAGGATGG - Intronic
1096406438 12:51347313-51347335 GAGGGTAGATGGAGGGTGGAGGG + Intergenic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096528814 12:52230872-52230894 GGGTGGAGACAGAGGCTGGATGG + Intergenic
1096571081 12:52523727-52523749 GAGGGAAGAAGAAGGATGGAGGG - Intergenic
1096656937 12:53097848-53097870 GCGTGGAGGAGGAGGATGGGGGG + Exonic
1096886135 12:54721256-54721278 GAGAGGAGAAGGAGGGGGAGAGG - Intergenic
1096950014 12:55458646-55458668 GAGAGGGGAGGGTGGGTGGAGGG + Intergenic
1096977173 12:55706199-55706221 AGATGGAGAAGGAGGGAGGAAGG + Intronic
1097102208 12:56597781-56597803 AGGTGGGGAAGGAGGCTGGAAGG + Exonic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097587379 12:61530868-61530890 GAGAGGAGAAGGAGAGAGAAGGG - Intergenic
1098280083 12:68853815-68853837 GAGAGGGAAAGGAGGGAGGAAGG + Exonic
1098460770 12:70730846-70730868 GAGAGCAGAAGGAAGGAGGAAGG + Intronic
1098486856 12:71031509-71031531 GAGGGGAGAGGAAGGGAGGAAGG + Intergenic
1098504852 12:71237605-71237627 AAGAGGAGGAGGAGGGTGGATGG - Intronic
1098584915 12:72143371-72143393 GAGAGGAGTAGGAGGAAGGAGGG + Intronic
1098622176 12:72614988-72615010 AATTGGAGAAGGAGGAGGGAAGG + Intronic
1098874286 12:75850885-75850907 AATTGGAGAGGGAGAGTGGAAGG - Intergenic
1099242591 12:80155750-80155772 GAGTGGAGAGGGTGGGAGGTGGG - Intergenic
1100209030 12:92381941-92381963 GAGGGGGGATGGAGGGAGGAAGG + Intergenic
1100299930 12:93297445-93297467 GAGAGTAGGAGGAGGATGGAAGG + Intergenic
1100386520 12:94109215-94109237 GCGTGGAGGAGGAGGGAGAAGGG + Intergenic
1100911483 12:99368221-99368243 TACTAGAGGAGGAGGGTGGAAGG + Intronic
1101094085 12:101318075-101318097 TGGTGGGGAAGGTGGGTGGAAGG - Intronic
1101201043 12:102436602-102436624 TTGTGGCAAAGGAGGGTGGAAGG + Intronic
1101630581 12:106489893-106489915 GAGGGGAGAAGGAGGCTGGTAGG + Intronic
1101664091 12:106793856-106793878 TCCTGGAGAAGGTGGGTGGAAGG + Intronic
1101752800 12:107596771-107596793 GAAGGGGGAAGGAAGGTGGAGGG - Intronic
1101811048 12:108108066-108108088 GAGAGGAGAGGGAGGGTGTGGGG + Intergenic
1101968338 12:109295809-109295831 GAGTGGAGGAAGCGGGTGGAAGG - Intronic
1102290284 12:111693639-111693661 GAGTGGGGTAGAAGGGAGGAAGG - Intronic
1102552550 12:113702233-113702255 GGGGAGAGAAGGAGGGAGGAAGG - Intergenic
1102705703 12:114878457-114878479 GGGAAGAGAAGGAGGGTGGAGGG - Intergenic
1103444351 12:120984480-120984502 GAGAAGGGAAGGAGGGAGGAAGG + Intronic
1103589403 12:121980585-121980607 GGGAGGCTAAGGAGGGTGGATGG - Intronic
1103884006 12:124187571-124187593 GGGTGGAGGGGGAGAGTGGAGGG + Intronic
1103948730 12:124540690-124540712 GGGTGGAGATGGAGGGGGGTGGG + Intronic
1103948822 12:124540938-124540960 GAGTGGAGATGGAGGGGGATGGG + Intronic
1103948861 12:124541055-124541077 GAGTGGAGATGGAGGGGGTGGGG + Intronic
1103948899 12:124541173-124541195 GAGTGGAGATGGAGGGGGATGGG + Intronic
1103949013 12:124541519-124541541 GAGTGGAGATGGAGAGGGAAGGG + Intronic
1103949041 12:124541610-124541632 GAGTGGAGATGGTGGGGGGGTGG + Intronic
1103949091 12:124541748-124541770 GAGTGGAGATGGAGGGGGATGGG + Intronic
1103949120 12:124541815-124541837 GAGTGGAGATGGAGGGGGATGGG + Intronic
1103949130 12:124541838-124541860 GAGTGGAGATGGAGGGGGTGGGG + Intronic
1103949139 12:124541860-124541882 GAGTGGAGATGGAGGGGGTGGGG + Intronic
1103963906 12:124626181-124626203 CAGAGGAGGAGGAGTGTGGAGGG - Intergenic
1104087990 12:125493427-125493449 GAGTGGAGACAGAGGATGCAGGG + Intronic
1104191072 12:126482426-126482448 GAGGAGAGAGGGAGGGAGGAAGG - Intergenic
1104191078 12:126482445-126482467 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
1104191095 12:126482487-126482509 GAGAGGGGAAGGAGGGAGGGAGG - Intergenic
1104191105 12:126482510-126482532 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1104253575 12:127120020-127120042 AAATGGAGAAGGACAGTGGAGGG + Intergenic
1104301397 12:127568343-127568365 GAGGGGAGAAGGAGAGAGAAAGG + Intergenic
1104316227 12:127704394-127704416 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1104781276 12:131422094-131422116 AGGTGGAGGAGGAGGGAGGAGGG - Intergenic
1104984126 12:132587120-132587142 CAGTGCAGCTGGAGGGTGGACGG + Intergenic
1105007380 12:132729612-132729634 GAGGGGAGGGGGAGGGGGGAGGG + Intronic
1105443177 13:20432045-20432067 GAGGGAAGAAGGAGGGAGAAAGG + Intronic
1105591500 13:21796826-21796848 GAGAGGAGAAGAAGGCAGGATGG - Intergenic
1106108125 13:26752177-26752199 GATTGTAGAAGGACAGTGGAAGG + Intergenic
1106120337 13:26854822-26854844 GAGGTGAGAAGAAGGGTGAAAGG + Intergenic
1106304863 13:28500652-28500674 GAGGGGAAGAGGAGGGTGCAGGG + Intergenic
1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG + Intergenic
1106363578 13:29055511-29055533 GAGGGTAGAAGGTGGGAGGAGGG - Intronic
1106584143 13:31042867-31042889 GAGGGTGGAAGGAGAGTGGAAGG + Intergenic
1106811394 13:33361699-33361721 GAGAGGAGAAAGAGAGTGAAAGG + Intergenic
1107630011 13:42333700-42333722 GATTGGAGGAGGAGAGTGCAGGG + Intergenic
1107643167 13:42465391-42465413 GAGTGGAGAAGGAGGAAGAGGGG + Intergenic
1107834917 13:44405295-44405317 GAGTGGGGAAGGAAGGTGGGAGG - Intergenic
1107946303 13:45420012-45420034 GAAAGGAGAAAGAGGGAGGAAGG + Intergenic
1108192775 13:47959472-47959494 GGGCGGAGGAGGAGGGGGGAAGG + Intronic
1108299638 13:49061427-49061449 GAGGGGAGAAGGGGAGGGGAGGG - Intronic
1108299687 13:49061527-49061549 GAGGGGAGAAGGGGAGGGGAGGG - Intronic
1108299781 13:49061721-49061743 GAGAGGAGAGGGAGAGGGGAGGG - Intronic
1108332702 13:49405983-49406005 GAGAGGAGAATGATGGTGGCAGG + Intronic
1108441321 13:50456256-50456278 CAGTGGACAAGGAGGCTGGAGGG - Intronic
1108813052 13:54253589-54253611 GAGGGTGGAAGGTGGGTGGAAGG + Intergenic
1109448986 13:62483784-62483806 GAGTGGAGAAAGAGGAAGAAGGG - Intergenic
1109714181 13:66199558-66199580 GAGAGTAGAAGGTGGGAGGAGGG + Intergenic
1110451060 13:75637183-75637205 GAGCGGAAAAGAAGGGTGGGTGG + Intronic
1110473356 13:75885538-75885560 CAGAGGCCAAGGAGGGTGGACGG - Intergenic
1110775446 13:79404183-79404205 AAGGGGAGAAGGAAAGTGGATGG - Intronic
1111234836 13:85396496-85396518 GAGGGCAGAAGGTGGGAGGAGGG - Intergenic
1111446196 13:88348129-88348151 GAGGGAAGAAGGAGGGAGGAAGG + Intergenic
1111791753 13:92865513-92865535 GAGGGGAGATGGTGGTTGGAGGG + Intronic
1112015186 13:95325604-95325626 GAAGGGAGAAGGAAGGAGGAAGG + Intergenic
1112101616 13:96196225-96196247 GATTTGAGTAGGAGGGTAGAAGG - Intronic
1112210586 13:97373410-97373432 GAGTAGAGAGAGAGAGTGGAAGG + Intronic
1112703952 13:102044726-102044748 GAGTGGTGGAGGATGGTGGAAGG - Intronic
1112748326 13:102552976-102552998 GATTGGAGAAGTAGTATGGAAGG + Intergenic
1112790994 13:103002107-103002129 GAGAGGAGGAGCAGGGTGTAAGG - Intergenic
1112813124 13:103242224-103242246 GAGTGGAGAAAGTGGGAGGAGGG - Intergenic
1113144746 13:107196148-107196170 GAGTGGAGAAGGTGGAAGAAGGG + Intronic
1113149987 13:107252481-107252503 GAGAGGAGAAGGAAGGAGGAGGG + Intronic
1113179788 13:107612091-107612113 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1113179805 13:107612122-107612144 GAGGGGAGGAGGAGTGGGGAGGG + Intronic
1113414894 13:110120918-110120940 GAGGGGAGAAGGATGGAAGAGGG - Intergenic
1113567086 13:111325574-111325596 GGGTTGTGGAGGAGGGTGGAGGG + Intronic
1113596197 13:111535292-111535314 GAGTGGATAAAGAAGGTGGGCGG - Intergenic
1113726158 13:112603857-112603879 GAGGGCAGAGGGAGGATGGAGGG + Intergenic
1113899611 13:113788889-113788911 GAGTGGGGCAGGAGGGAGGGAGG - Intronic
1113909724 13:113836344-113836366 GAGGGGAGGAGGAGGGGGTAGGG + Intronic
1113924334 13:113931950-113931972 CAGAGGAGCAGGAGGGTGGAGGG - Intergenic
1113954369 13:114089298-114089320 GAGGGGGGGAGGAGGGGGGAGGG + Intronic
1114486557 14:23066062-23066084 GAGGGGGGAAGGAGGTTAGATGG + Intronic
1114517606 14:23309820-23309842 GAGTGGGAGAGGAGGGTGGCAGG - Exonic
1114634650 14:24180575-24180597 GGGTGGAGAGGGAGGGAGAAAGG + Intronic
1114638690 14:24204311-24204333 GAGTGGAGCAGAAGGCTGGCGGG + Intronic
1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG + Intronic
1114649875 14:24277752-24277774 GACTGTGGGAGGAGGGTGGAAGG + Intergenic
1115027809 14:28764498-28764520 TAAGGGAGAAGGAGGGAGGAGGG + Intergenic
1115399597 14:32941251-32941273 GGGAGGGGAAGGAGGGAGGAGGG - Intronic
1115629376 14:35228449-35228471 GCGGGGAGATGGAGGGAGGAAGG - Intronic
1116109421 14:40558249-40558271 GTGAAGAAAAGGAGGGTGGAAGG - Intergenic
1116133323 14:40889252-40889274 GAGGGAAGAAGGAGGGAGGGAGG + Intergenic
1116252937 14:42509987-42510009 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1116585226 14:46695052-46695074 GAGAGGAAAAGAGGGGTGGAGGG + Intergenic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1116951673 14:50883680-50883702 GGGTGGGGAAGGAGAGTGGCTGG + Intronic
1117043105 14:51785959-51785981 GAGGGTAGAAGGTGGGAGGATGG - Intergenic
1117162398 14:53002227-53002249 GAGATGAGAAGGAGGGAGGAGGG - Intergenic
1117836981 14:59818018-59818040 GAGTGGGGAATGTGGGAGGAGGG - Intronic
1117908816 14:60616734-60616756 TATTGGAGAAAGGGGGTGGAAGG - Intergenic
1118124360 14:62883675-62883697 GATGGGATAATGAGGGTGGAGGG + Intronic
1118169169 14:63369220-63369242 GACTGGAGAGGGAGGGAGGGAGG + Intergenic
1118235119 14:63996191-63996213 GAGTGGAAAGGAAGGGAGGAAGG - Intronic
1118240037 14:64047172-64047194 CAGTGGAGAGGGAAGCTGGAGGG + Intronic
1118348074 14:64954234-64954256 GTGAAGAGAAGGAGGGAGGAAGG + Intronic
1118436901 14:65779783-65779805 GAGTGGAGACTGAAGGTGGTTGG - Intergenic
1118560589 14:67076830-67076852 GAGTGGAGAAAGAGTGTGGTAGG - Intronic
1118564995 14:67129823-67129845 GAAGGGAGAGGGAGGGAGGAAGG + Intronic
1118621778 14:67620270-67620292 GAATGGAGAGGGAGGGAGGGAGG + Intronic
1118694914 14:68375236-68375258 GAGCGGGGAAGGAGGGTGTTAGG - Intronic
1119162111 14:72461254-72461276 CAGTGGAGAGGGTGGGAGGATGG + Intronic
1119276490 14:73361604-73361626 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1119539452 14:75428646-75428668 GGGTGGAGGTGGAGGGTGAAGGG + Intronic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1120049353 14:79847234-79847256 GTGTGGAGATGGAGATTGGAAGG - Intronic
1120516516 14:85477315-85477337 CCGGGGAGAAGGTGGGTGGAGGG - Intergenic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120899917 14:89566891-89566913 GAGGGGAGAAGGAGGGGGTAGGG - Intronic
1121104388 14:91271084-91271106 GAGGGGCGCAGGGGGGTGGAGGG + Intergenic
1121104397 14:91271102-91271124 GAGGGGCGCAGGGGGGTGGAGGG + Intergenic
1121211420 14:92210507-92210529 GAGTGGAGAAGGGTGGGGGGTGG + Intergenic
1121623004 14:95363164-95363186 GAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1121835429 14:97087973-97087995 GAGTGGTGGGGGAGGGTGGTGGG + Intergenic
1121916006 14:97837424-97837446 GAGTGGAGAGGGAGGGCAGCAGG + Intergenic
1121955743 14:98210912-98210934 GAGTTCAGATGGAGGATGGATGG + Intergenic
1122059798 14:99129397-99129419 GAGCAGGGAAGGAGGCTGGATGG - Intergenic
1122080360 14:99262857-99262879 GGGGGGAGGAGAAGGGTGGAGGG + Intronic
1122449919 14:101797473-101797495 GGGTGGAGAAAGAGGGCAGAGGG - Intronic
1122631385 14:103109213-103109235 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122631399 14:103109250-103109272 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122631413 14:103109287-103109309 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122631427 14:103109323-103109345 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631441 14:103109359-103109381 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631455 14:103109395-103109417 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631469 14:103109431-103109453 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631483 14:103109467-103109489 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631497 14:103109503-103109525 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631511 14:103109540-103109562 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122631525 14:103109576-103109598 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631539 14:103109612-103109634 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631553 14:103109648-103109670 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631568 14:103109685-103109707 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122636281 14:103131203-103131225 GAGGGGAGCTGGAAGGTGGAGGG + Intronic
1122672013 14:103379678-103379700 GAGTGAAGAAGGGGACTGGAGGG + Intergenic
1122672909 14:103385684-103385706 GAGTGGAGAAGGAGGTGAGGGGG + Exonic
1122835085 14:104426936-104426958 GCGGGGAGGAGGAGGGTGGGCGG - Intergenic
1122840754 14:104461588-104461610 CAGGGGACAAGGGGGGTGGACGG + Intergenic
1122915956 14:104859097-104859119 AGATGGAGATGGAGGGTGGATGG - Intergenic
1122916178 14:104860035-104860057 GGATGGAGATGGAGGGTGGATGG - Intergenic
1122916257 14:104860395-104860417 GGATGGAGATGGAGGGTGGATGG - Intergenic
1122916316 14:104860640-104860662 GGATGGAGATGGAGGGTGGATGG - Intergenic
1122916359 14:104860803-104860825 GGGTGGTGATGGAGGGTGGAGGG - Intergenic
1122976574 14:105173331-105173353 GAGTGGAGAGGGTGGGTTGGAGG - Intronic
1123022704 14:105409158-105409180 GAGGGGAGAGGGAGTGGGGAAGG - Intronic
1123827924 15:24101692-24101714 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123842383 15:24261103-24261125 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123857412 15:24427162-24427184 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123862043 15:24477694-24477716 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1124717888 15:32083570-32083592 GATGAGATAAGGAGGGTGGATGG + Intronic
1124805729 15:32880519-32880541 CAGTGGAGAAGGAAGGTGAATGG - Intronic
1125128643 15:36255040-36255062 GAGTGGGGAAGGTGGGGGGCGGG - Intergenic
1125196280 15:37050679-37050701 GAGTGGAGGGGCAGGGTGGAGGG - Intronic
1125613701 15:40991014-40991036 GGGTGGTGGAGGTGGGTGGAGGG + Intronic
1125954748 15:43782571-43782593 GATTGGAGCAGGAGTATGGAGGG - Intronic
1126104159 15:45136417-45136439 GAGCGGGGAAGGAGGATGGGAGG + Intronic
1126436902 15:48645864-48645886 GAGTGGAAAGGGAGGATGGATGG - Intergenic
1126855465 15:52834664-52834686 GGGTGGAGGAGGAGGAGGGAAGG + Intergenic
1127324381 15:57881054-57881076 GGGTGGAGATGGAGCATGGACGG - Intergenic
1127500888 15:59553310-59553332 GAGACGAGAGGGAGGGGGGATGG - Intergenic
1127719487 15:61685857-61685879 GAGTGGAGAAGGAGCTGAGATGG - Intergenic
1127933770 15:63616175-63616197 GAGTGAAGAACCAAGGTGGAAGG - Intronic
1128307392 15:66608537-66608559 GAGTGGGGAGGGAGGAGGGAAGG + Intronic
1128359437 15:66950762-66950784 GGGTGGAGAATAGGGGTGGAGGG + Intergenic
1128506377 15:68275926-68275948 CAGAGGAGAGGGAGGGTGGTAGG + Intergenic
1128675220 15:69603413-69603435 GTGTGGAGAAAGAGGAGGGAGGG + Intergenic
1128677822 15:69624691-69624713 GAGAGGAGAGGGAGGGAAGATGG - Intergenic
1128783357 15:70377414-70377436 GGTTGGAGGAGGAAGGTGGAGGG - Intergenic
1128913860 15:71541924-71541946 GACAGGAGGAGGAGGCTGGAAGG + Intronic
1128940870 15:71786751-71786773 GAGGGGAGGAGGAGGGGGGGAGG + Intergenic
1129239803 15:74244578-74244600 GACTGGAGAAGGAGGGGAGGAGG - Intronic
1129286001 15:74525493-74525515 GAGGGCAGAACAAGGGTGGAAGG + Intergenic
1129306414 15:74667424-74667446 GAAAGGAGAAGGGGGGAGGAGGG + Intronic
1129467089 15:75730302-75730324 AAGGGGAGAAGGAGGATGGAGGG + Intergenic
1129478697 15:75806193-75806215 GATTGGAGCAGAAGGATGGAGGG - Intergenic
1129690077 15:77708221-77708243 AAGAAGAGCAGGAGGGTGGATGG + Intronic
1129720138 15:77873418-77873440 AAGGGGAGAAGGAGGATGGAGGG - Intergenic
1129867605 15:78921550-78921572 GAGTGGAGAGGTGGGGAGGAAGG - Exonic
1129917790 15:79289654-79289676 AAGGTGGGAAGGAGGGTGGATGG - Intergenic
1130067384 15:80615968-80615990 TAGTGAAGAAGAAGGGTGAAGGG - Intergenic
1130070090 15:80639834-80639856 TAGTGAAGAGGGAGGATGGAAGG + Intergenic
1130151202 15:81313070-81313092 GAGTGGGGCAGGAGGCAGGAAGG + Exonic
1130380962 15:83372044-83372066 GAATGGGGAAGAAGGGTAGAGGG + Intergenic
1130909170 15:88259141-88259163 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1131081379 15:89539130-89539152 GAGTGGGAAAGAAGGATGGAGGG + Intergenic
1131166394 15:90145086-90145108 GAAGGGTGAAGGAGGGAGGAGGG - Intergenic
1131229166 15:90647470-90647492 GTGTGGAGGAGGAGGGGTGAGGG - Intergenic
1131646227 15:94348329-94348351 GAGAGGAGAGGGAGAGGGGAAGG - Intronic
1131846584 15:96495352-96495374 CAGAGAAGGAGGAGGGTGGAAGG + Intergenic
1131967757 15:97862612-97862634 GGGTTGAGAGGGAGGGTGAAGGG - Intergenic
1132070422 15:98771881-98771903 CAGTGGAGAAGAAGGAAGGAGGG - Intronic
1132078610 15:98845431-98845453 GAGGGGAGGAGGAGGAGGGAGGG - Intronic
1132235955 15:100221874-100221896 GAGAGCAGAAGGAGTGTGCAAGG - Intronic
1132291856 15:100709412-100709434 TATTGGAGAAGGAGTGAGGAAGG + Intergenic
1132378521 15:101348901-101348923 GAGAGGAGCAGGAGGGTGGCGGG - Intronic
1132569680 16:638612-638634 GAGTGGGGAAGGTGGGGGCAGGG + Intronic
1132592253 16:731144-731166 GAACGGAGAGAGAGGGTGGAAGG + Intronic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1132947679 16:2540928-2540950 GAGGGGAGAAGCAGGGAGCATGG + Intronic
1132968058 16:2670697-2670719 GAGGGGAGAAGCAGGGAGCATGG - Intergenic
1132989989 16:2787441-2787463 GAGGGGTGAAGGATGGGGGAGGG - Intronic
1133415845 16:5606437-5606459 GAGGGAGGAATGAGGGTGGAGGG - Intergenic
1133520190 16:6549284-6549306 GGGAGGAGTAGGAGGGAGGAGGG + Intronic
1133520249 16:6549432-6549454 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1133520285 16:6549536-6549558 GAGGGGAGGAGGAGGATGGGAGG + Intronic
1133689547 16:8199989-8200011 GAGAAGAGAGGGAGGGAGGAAGG - Intergenic
1133859628 16:9582110-9582132 CAGTAGAGAAGGAGTGTGGCTGG - Intergenic
1133981699 16:10637436-10637458 GAGGGGAGGAGGAAGGAGGAGGG + Intronic
1134112430 16:11523949-11523971 GAGGGGAGCGGGTGGGTGGATGG - Intergenic
1134238218 16:12484578-12484600 GAGTGGAGAGGGTGGGGGCAGGG - Intronic
1134501898 16:14775872-14775894 CAGAGGCCAAGGAGGGTGGATGG - Intronic
1134523322 16:14928123-14928145 GAGAGGAGGAGGAGGGGAGAGGG - Intronic
1134578663 16:15353022-15353044 CAGAGGCCAAGGAGGGTGGATGG + Intergenic
1134723925 16:16404523-16404545 CAGAGGCCAAGGAGGGTGGATGG - Intergenic
1134943505 16:18307347-18307369 CAGAGGCCAAGGAGGGTGGATGG + Intergenic
1135030604 16:19035274-19035296 GAGTGGAGAGGGAGAGAGGGAGG + Intronic
1135122729 16:19780408-19780430 GAGAGGCCAAGGAGGGAGGATGG - Intronic
1135229637 16:20693711-20693733 AAGTGGAGAAGCAGGCAGGAGGG - Intronic
1135275783 16:21111411-21111433 GGTTGGAGTAGGCGGGTGGAGGG - Intronic
1135591453 16:23707906-23707928 GAGTAGAGAAGGGTGGAGGATGG - Intronic
1135818782 16:25660455-25660477 TTGTGGAGTAGGAGGTTGGAAGG - Intergenic
1135920390 16:26644087-26644109 AAAGGGAGAAGGAGGGAGGAAGG - Intergenic
1135928867 16:26719547-26719569 GAGTGAAGCAGGAGGGCAGAGGG - Intergenic
1135932178 16:26747606-26747628 GGATGGAGAGGGAGGGGGGAGGG - Intergenic
1136056867 16:27696486-27696508 GAGGGCAGAAGGTGGGAGGAAGG - Intronic
1136138863 16:28276054-28276076 AAGTGGAGGAGGAGGGAGGCTGG + Intergenic
1136171630 16:28493415-28493437 GAGGGGAGAAGGAGGGTATGGGG + Intronic
1136368419 16:29820643-29820665 GAGTGGGGAAGGAGGATGGGTGG + Intronic
1136381367 16:29897352-29897374 GAGAGGAGTATCAGGGTGGAAGG - Intronic
1136542324 16:30935013-30935035 GAGTAGAGAACGAGGCAGGAGGG + Intronic
1136619223 16:31416991-31417013 GAGGGGGGAGGGAGGGGGGAAGG - Intronic
1136989711 16:35144610-35144632 GAGAGGAGAAGGTGGGAGGTGGG - Intergenic
1137506906 16:49062010-49062032 GAGTGGGGAGGGTGGGAGGAGGG - Intergenic
1137585183 16:49659999-49660021 GGGTGGAGGAGGAGGAAGGAAGG - Intronic
1137776677 16:51060746-51060768 GAAGGGAGAAGGAGGGAGGGAGG + Intergenic
1137791629 16:51179919-51179941 TAGAAGAGAAGGAGGGAGGAGGG - Intergenic
1137846943 16:51699315-51699337 GAGTGGAGAAGAGTGGGGGAAGG - Intergenic
1137942491 16:52702603-52702625 CAGGGGAGGAGGAGGGTGGATGG - Intergenic
1137977260 16:53042295-53042317 GAGGGGAGACGGAGGGAGGAAGG - Intergenic
1138069010 16:53971967-53971989 GAGTGGTGAAGGAGGGAAGGGGG - Intronic
1138439789 16:57027027-57027049 GAGTGGAGGAGGACCGGGGAGGG + Intronic
1138486681 16:57349768-57349790 GAGGGAAGAAGGAGGCAGGAAGG - Intergenic
1138506366 16:57480262-57480284 GGGTGGGGCAGGAGGGTAGAGGG - Intronic
1138558179 16:57785136-57785158 GAGTGGAGCAGGAAGGTGCGGGG - Intronic
1138637423 16:58352191-58352213 GAGTGGAGAAGGAGGTTGGATGG - Intronic
1138941265 16:61793402-61793424 GAGGGTAGAGGGAGGGAGGAGGG - Intronic
1138976899 16:62218639-62218661 AAGTGGAAAATGAGGGAGGAAGG - Intergenic
1139144375 16:64306908-64306930 GAAGAGAGAAGGAGAGTGGAGGG + Intergenic
1139504478 16:67392195-67392217 GTGTGAAGATGGAGGATGGAGGG - Intronic
1139612170 16:68067128-68067150 GAGGGGAGAAGGGAGGGGGAGGG - Intronic
1139620064 16:68132271-68132293 GAGTGGTGATAGAGGATGGAGGG + Intronic
1139701551 16:68710959-68710981 GGGAGGGGAAGGAGGGGGGAGGG + Intronic
1139754509 16:69132189-69132211 GTGTGGAGACGGAAGGCGGAGGG - Intronic
1139999534 16:71011826-71011848 GATTGGAAGAGGAGGGTGGAAGG - Intronic
1140205917 16:72933319-72933341 CAGAGGAGTAGGAAGGTGGAGGG + Intronic
1140337210 16:74118746-74118768 GAGAGGAGAAGGAGGGAGGGAGG + Intergenic
1140615563 16:76658343-76658365 GAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1140662413 16:77199970-77199992 GACAGGCAAAGGAGGGTGGAGGG + Exonic
1140814010 16:78604669-78604691 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814018 16:78604684-78604706 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814026 16:78604699-78604721 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814034 16:78604714-78604736 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814042 16:78604729-78604751 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814050 16:78604744-78604766 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814058 16:78604759-78604781 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814066 16:78604774-78604796 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814090 16:78604824-78604846 GAGGGGGGAAGGAGGGAGGGAGG - Intronic
1140891373 16:79288095-79288117 GAGGGCAGAGGGAGGGTGAAGGG + Intergenic
1141251648 16:82364088-82364110 GTGTGGAGTGGGAGGGTGGGGGG + Intergenic
1141263675 16:82476238-82476260 AGGAGGAGAAGGAGGGAGGAGGG - Intergenic
1141266987 16:82506663-82506685 GAGGGGCGAAGGAGGAGGGACGG - Intergenic
1141285296 16:82666391-82666413 GATTGGAGAGGGAGGGCTGATGG - Intronic
1141388565 16:83645646-83645668 GATTGGAGAAGGATGGGGAAGGG - Intronic
1141513137 16:84525382-84525404 GAGCGGAGGGGGAGGGAGGATGG - Intronic
1141515251 16:84539763-84539785 CAGTGGAGAATGAGGGGTGAGGG + Intronic
1141527631 16:84622067-84622089 GATTGGGGTAGGAGGGTGGTGGG + Intergenic
1141672236 16:85498121-85498143 GAGTGGAGCTGGCGGGAGGAGGG + Intergenic
1141775718 16:86121601-86121623 GGAGGGAGGAGGAGGGTGGAAGG - Intergenic
1141802656 16:86321680-86321702 GTGTGGTGAAGGGGGCTGGAAGG - Intergenic
1141838975 16:86562151-86562173 GAGGGGAGAAGGAGGGCAGAAGG - Intergenic
1142008223 16:87700511-87700533 GAGGGAGGAAAGAGGGTGGAGGG + Intronic
1142008505 16:87701771-87701793 GACGGGAGAAGGATGGCGGACGG - Intronic
1142124271 16:88402424-88402446 GAGTGCAGTGGGAGGGAGGATGG + Intergenic
1142234538 16:88915520-88915542 GTGTGGAGGGGGAGCGTGGAGGG + Intronic
1142234577 16:88915630-88915652 GTGTGGAGGAGGAGCGTGGAGGG + Intronic
1142234581 16:88915643-88915665 GCGTGGAGGGGGAGCGTGGACGG + Intronic
1142234606 16:88915712-88915734 GCGTGGAGGGGGAGCGTGGAAGG + Intronic
1142251370 16:88993562-88993584 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1142251404 16:88993652-88993674 GAGGGAAGAGGGAGGGAGGAGGG - Intergenic
1142290863 16:89193087-89193109 CAGTGGAGAAGGGGCGTGGCTGG - Intronic
1142317833 16:89360047-89360069 GAGGGGAGAGGGCGGGAGGAGGG - Intronic
1142787205 17:2233647-2233669 GGGTGGAGAAGGAGGGGGGTTGG - Intronic
1143391484 17:6561505-6561527 GAGGGGAGGAGGAGGGGAGAAGG - Intergenic
1143503008 17:7349912-7349934 AAGTCGAGAAGGGGGGTTGAGGG - Intronic
1143534218 17:7526325-7526347 GAGGGGAGAAAGAGGGGAGATGG - Intergenic
1143704591 17:8687681-8687703 GAGGGGAGGAGAGGGGTGGAGGG - Intergenic
1143714631 17:8758123-8758145 GATCGGGGAAGGAGGGTGCAGGG - Intronic
1143939990 17:10530468-10530490 GAGAGGAGCAGGAGGGTTGTGGG + Intronic
1143965817 17:10755942-10755964 GAAAGGAAAAGGAGGGGGGAGGG - Intergenic
1144199429 17:12926123-12926145 GGGAGGCGAATGAGGGTGGATGG + Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144326415 17:14186308-14186330 GAGAGTAGAATGAGGGTGGGAGG - Intronic
1144333196 17:14243205-14243227 GAGGGGAGAAGAAAGGAGGAGGG + Intergenic
1144337568 17:14285424-14285446 GACTGGATATGGAAGGTGGAGGG + Intergenic
1144363640 17:14520908-14520930 GAGGGCAGAAGGTGGGAGGAGGG - Intergenic
1144475293 17:15583183-15583205 GAGAGTAGAATGAGGGTGGGAGG - Intronic
1144555638 17:16280283-16280305 GACTGGAGAAAGAGGGTTGATGG + Intronic
1144995415 17:19264886-19264908 GAGGAAGGAAGGAGGGTGGAGGG + Intronic
1145272044 17:21410019-21410041 GAGGGGAGAGGGAGAGTGGTGGG - Intronic
1145310253 17:21697482-21697504 GAGGGGAGAGGGAGAGTGGTGGG - Intronic
1145394612 17:22485253-22485275 GGGTGGAGAAGGAGGATTTATGG + Intergenic
1145841930 17:28002469-28002491 TAGTGGAGAGGGACCGTGGAAGG - Intergenic
1145937498 17:28723498-28723520 GACTGGAGGAGGAAGGGGGAGGG + Intronic
1146171778 17:30640108-30640130 GAGTGAGGTAGGAGGCTGGAAGG - Intergenic
1146187199 17:30731762-30731784 GAGGGGAGAAGGAGGAGAGAGGG - Intergenic
1146345233 17:32056133-32056155 GAGTGAGGTAGGAGGCTGGAAGG - Intergenic
1146624272 17:34424066-34424088 GAGTGGAGACGGAGGGATGGAGG + Intergenic
1146693676 17:34893265-34893287 GGGTCAGGAAGGAGGGTGGAGGG + Intergenic
1146725546 17:35152854-35152876 GAGTGGGGAAGGAGGCAGGTGGG - Intronic
1146799491 17:35807249-35807271 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1146954736 17:36930953-36930975 GAGAGAAAAAGGAGGGAGGAAGG - Intergenic
1147050143 17:37788239-37788261 AAGGGGAGAGGGAGGGAGGAGGG - Intergenic
1147119157 17:38325461-38325483 GAGGGGTGGGGGAGGGTGGATGG + Intergenic
1148129527 17:45254697-45254719 GAGGGGAGAATGAGGGTGCAGGG - Intronic
1148384238 17:47222845-47222867 GTGGGGAGAAGGTGGGTGGAGGG - Intronic
1148467559 17:47874005-47874027 GAGGGAAGAAGGAGGGAGGAAGG - Intergenic
1148467570 17:47874057-47874079 GAGGGAAGGAGGAGGGAGGAAGG - Intergenic
1148661670 17:49338980-49339002 GAGAGGAGGAGGCTGGTGGAAGG - Intronic
1148861382 17:50606049-50606071 CTGTGGTGAAGGAGGCTGGAGGG + Intronic
1149090457 17:52772119-52772141 GAGAGTAGATGGAGGGAGGAAGG + Intergenic
1149294452 17:55249334-55249356 GAGTGGGGAAGGAATGAGGAAGG - Intergenic
1149315189 17:55431972-55431994 GAGTGGAGGGGGAGCGGGGAGGG + Intergenic
1149328978 17:55561780-55561802 GAGTGGTAAAGGTGGATGGATGG + Intergenic
1149965226 17:61155871-61155893 GAGTGGAGAGGGAAGAAGGAGGG - Intronic
1150133169 17:62680149-62680171 AACTGGAGGAGGCGGGTGGAGGG - Exonic
1150182910 17:63145303-63145325 GAGTGGGAAAGAAGGGTAGAAGG - Intronic
1150201144 17:63359287-63359309 GGGAGGACAAGGTGGGTGGATGG - Intronic
1150233452 17:63573000-63573022 GGGAGGCCAAGGAGGGTGGATGG - Intronic
1150502031 17:65660282-65660304 GAAAAGAGAAGGAGGGAGGAAGG - Intronic
1150580402 17:66468700-66468722 GACTTCTGAAGGAGGGTGGAGGG + Intronic
1150921893 17:69492672-69492694 GAGAGGAGAAGGAGAGGCGAAGG - Intronic
1151103369 17:71581788-71581810 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1151245919 17:72794567-72794589 GTGTAGAGAAGGAGGGAGCAGGG - Intronic
1151471737 17:74322610-74322632 AAGTGGTGAAGGTGAGTGGAAGG + Intergenic
1151579696 17:74971232-74971254 GAGTGGGGAGGCAGGGAGGAAGG - Intronic
1151601056 17:75106350-75106372 GAATGGAAAAGGAGGGAGGTGGG + Intergenic
1151664206 17:75536125-75536147 GAGTGGAGACTGAGGTTGGATGG + Intronic
1152010128 17:77707784-77707806 GAGGGGAGGAAGAGGGTGGTTGG + Intergenic
1152237156 17:79144546-79144568 GAGAGGAGTTGGTGGGTGGAGGG + Intronic
1152333041 17:79684725-79684747 GACTGGACAAGGAAGGGGGAAGG - Intergenic
1152423268 17:80205283-80205305 GAGGGAAGGAGGAGGGAGGAAGG - Intronic
1152598449 17:81249492-81249514 GGAGGGAGAAGGAGGGAGGAGGG + Intronic
1152624031 17:81380105-81380127 GAGTGGAGCGGGAGGATGGGAGG - Intergenic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1152879871 17:82808645-82808667 GAGGGGACAAGGCAGGTGGAGGG + Intronic
1152879944 17:82808892-82808914 GAGGGGACAAGGCAGGTGGAGGG + Intronic
1152993379 18:383663-383685 GTGTGGAGAAGGAGTGGGTAGGG - Intronic
1153081203 18:1227335-1227357 GGGTGGAGTTGGTGGGTGGAAGG - Intergenic
1153101322 18:1473219-1473241 GAGTGGGGAGGGAGAGAGGAAGG + Intergenic
1153153808 18:2126599-2126621 GAGAGTAGAAGGTGGGAGGAGGG - Intergenic
1153330379 18:3867470-3867492 GGGTGGGGAAGGAAGGAGGAGGG + Intronic
1153500181 18:5741074-5741096 GTGAGGAAAAGGAGGCTGGAAGG + Intergenic
1153675308 18:7451794-7451816 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1153853617 18:9122247-9122269 GAGGTGAGAAGTAGGGTAGAAGG + Intronic
1153870628 18:9316174-9316196 GAGGGGGGAAGGAGGGAGGGAGG + Intergenic
1154002514 18:10494517-10494539 GTGTGGGGAAGGAGGATGGGAGG - Intergenic
1155149057 18:23108073-23108095 GAGAGTAGAGGGAGGGTGGGAGG - Intergenic
1155248385 18:23932978-23933000 GATTGGAGCAGGAGGTGGGAGGG + Intronic
1155537312 18:26830784-26830806 GAGTGGAGGAGTAGGGCAGAAGG + Intergenic
1156340574 18:36206629-36206651 GAGGGTAGAAGGTGGGGGGAGGG - Intronic
1156360428 18:36379929-36379951 GAGTTGAAAAGGAGGATGGATGG + Intronic
1156808329 18:41215135-41215157 GAGTGGACAAGGAAGCTGAACGG - Intergenic
1157481848 18:48060238-48060260 GAGGGGAGAAGGAGGAGGGAAGG + Intronic
1157515312 18:48307002-48307024 GGGTGGAGTGGGAGAGTGGAGGG - Intronic
1157625205 18:49045173-49045195 GGGAGGAGGAGGACGGTGGAAGG + Intronic
1158103786 18:53861387-53861409 GAGGGAGGAAGGAGGGAGGAAGG + Intergenic
1158103791 18:53861398-53861420 GAGGGAGGAAGGAGGGAGGAGGG + Intergenic
1158103817 18:53861462-53861484 GAGGGAGGAAGGAGGGAGGAGGG + Intergenic
1158240042 18:55367342-55367364 GTTTGCAGAAGGAGGGAGGATGG - Intronic
1158851057 18:61496090-61496112 GAGGAGAGAAGGAGAGAGGAAGG - Intronic
1159194208 18:65090837-65090859 GAGTGGGGAAGGAGAAGGGAGGG - Intergenic
1159217017 18:65405629-65405651 GAGGGGAGAAGGAGGTAGGAGGG + Intergenic
1159325792 18:66915400-66915422 TAGTTGGGGAGGAGGGTGGAGGG + Intergenic
1159686983 18:71434769-71434791 TAGTGGTGGAGGTGGGTGGAGGG + Intergenic
1159959659 18:74545646-74545668 GAGAGGAGGAGGAGGGTCGGAGG - Intronic
1159973026 18:74676951-74676973 GAGGGCAGAAGGAGGGAAGACGG - Intronic
1160194251 18:76739328-76739350 GATTGGAGAAGAAGGGAGGGAGG - Intergenic
1160388135 18:78510228-78510250 GAGTGGAAAATAAGGCTGGAAGG + Intergenic
1160429590 18:78802242-78802264 GAGGGGAAACGGAGGCTGGAGGG + Intergenic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161022366 19:2016077-2016099 GAGGGGAGAAGGGAGGTGAATGG + Intronic
1161403970 19:4081693-4081715 GGGGGGAGTAGGAGGGAGGAAGG - Intergenic
1161404018 19:4081845-4081867 GGGAGGAGTAGGAGGGAGGAAGG - Intergenic
1161404075 19:4082046-4082068 GCATGGAGGAGGAGGGAGGAGGG - Intergenic
1161705522 19:5819069-5819091 GTGTGGGCAAGCAGGGTGGAGGG + Intergenic
1161754162 19:6119421-6119443 GAGAGGAGAGGGAGGGAGGGAGG - Intronic
1161803538 19:6429480-6429502 GAGGGGAGGAGGAGGGAGAAAGG + Intronic
1161821517 19:6533497-6533519 GAGGGGAGAGGGAAGGGGGAAGG - Intronic
1161846342 19:6713732-6713754 GAGTGGGGAAGGTGGGGGGCTGG - Intronic
1161974060 19:7599282-7599304 GAGTGGGGTGGGTGGGTGGATGG - Intronic
1162071005 19:8151967-8151989 GAGGGGAGAAGGAAGCCGGAGGG + Intronic
1162237708 19:9321729-9321751 GAGTGGGGGAGGAGGGTGGCAGG - Intergenic
1162328013 19:10010214-10010236 GAGGGGTGGAGGGGGGTGGAGGG - Intronic
1162717043 19:12640726-12640748 GAGGGTGGAAGGAGGGAGGAAGG + Intergenic
1162861009 19:13505870-13505892 GAGGGGAGGCGGAGGGAGGAGGG + Intronic
1162990674 19:14300044-14300066 GAGTGAGGTAGGAGGCTGGAAGG + Intergenic
1163061225 19:14763738-14763760 GAGAGGAGAAGGAGGAGGAATGG - Intronic
1163093214 19:15035808-15035830 GAGAGGAGAAGGAGGGAGGGAGG + Intergenic
1163093821 19:15041287-15041309 GAGGGGGGAGGGAGGGGGGAGGG - Intergenic
1163153031 19:15425836-15425858 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1163161027 19:15464248-15464270 GTGGGGAGAAGGCGGCTGGAGGG - Exonic
1163472701 19:17506573-17506595 GAGAGGAGAGGGAGGGAGGGAGG + Intergenic
1163772031 19:19197074-19197096 GAGAGGAGTAGGAGGGTGGGAGG + Intronic
1163779570 19:19239439-19239461 GAGAGGAGGGGGAGGGAGGATGG - Intronic
1163779650 19:19239708-19239730 GGGAGGAGCAGGAGGGAGGAGGG - Intronic
1163827203 19:19530334-19530356 GCCTGGTGAAGGAGGGTGGCAGG - Intronic
1164188312 19:22892760-22892782 AAGAGGAGGAGGAGGGGGGAGGG - Intergenic
1164249776 19:23466589-23466611 GAGAGGAGAAGGAGAGTAGAAGG - Intergenic
1164250127 19:23468686-23468708 AAGAGGAGAAGGAGGGAAGAAGG - Intergenic
1164292518 19:23880757-23880779 GAGAGGAGAAAGAGGATGAAAGG + Intergenic
1164441679 19:28284416-28284438 AAGAAGGGAAGGAGGGTGGAAGG + Intergenic
1164441692 19:28284449-28284471 GGGAGGAAAAGGAGGGTGGAGGG + Intergenic
1164441711 19:28284526-28284548 AAGAGGAGAAGAAGGGTGAAGGG + Intergenic
1164441774 19:28284758-28284780 TAGAGGGGAAGGAGGGTGGGAGG + Intergenic
1164441791 19:28284806-28284828 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441798 19:28284822-28284844 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441805 19:28284838-28284860 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441816 19:28284869-28284891 GTGGAGAGAAGGAGGGTGGAGGG + Intergenic
1164441830 19:28284900-28284922 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441866 19:28285021-28285043 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441877 19:28285053-28285075 CAGAGAGGAAGGAGGGTGGAGGG + Intergenic
1164441900 19:28285135-28285157 AGAAGGAGAAGGAGGGTGGAGGG + Intergenic
1164441932 19:28285238-28285260 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441961 19:28285326-28285348 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164463519 19:28468416-28468438 GAGGGGAGAAGGAGGGGAGAAGG + Intergenic
1164745202 19:30606947-30606969 GAGTGGAGAAGGGAGGGGAAAGG + Intronic
1164753899 19:30675574-30675596 GATTGGAGAAGGAGCTGGGAAGG + Intronic
1164757386 19:30700328-30700350 GAGGGGGGAGGGAGGGAGGAAGG - Intronic
1164781525 19:30897101-30897123 GAGTGGGGAAGTGGGGTGAAGGG - Intergenic
1165386125 19:35511649-35511671 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1165427614 19:35754680-35754702 GAGAAGAGGAGGAGGGTGGGAGG + Exonic
1165487667 19:36105158-36105180 AAGTGGGGAGGGAGGGTAGAAGG + Intergenic
1165510598 19:36264583-36264605 GAAAGGAGAAAGAGGTTGGAGGG + Intergenic
1165707819 19:37988876-37988898 GTGTGGAGTGGGAGGGAGGACGG - Intronic
1165828600 19:38719514-38719536 GAGTGGATAGTGAGGGAGGAAGG + Intronic
1166219907 19:41357661-41357683 GGGTGGAGCAGGAGGTGGGAAGG - Intronic
1166563365 19:43747953-43747975 GAGCAGAGAAGGAGGGAGGAGGG - Intronic
1166645605 19:44529595-44529617 GAGGAGAGAAGGGAGGTGGAGGG - Intronic
1166760015 19:45218355-45218377 AAGTGAAGAGGGAGGGTGGGAGG - Intronic
1166878059 19:45910070-45910092 GACTGGATAAGGAGGAGGGAAGG + Intergenic
1166881111 19:45930686-45930708 GAAGGGGGAAGGAGGGAGGAAGG - Intergenic
1167105432 19:47427640-47427662 GAGGGGAGTAGGAGGGTGGGAGG - Intergenic
1167130553 19:47582367-47582389 GGGAGGAGAAAGAGGGGGGAGGG - Intergenic
1167134934 19:47610194-47610216 GGATGGAGGAGGAGGGAGGAGGG + Intronic
1167591974 19:50409072-50409094 GGCTGGAGCAGGAGGGTGGCCGG + Intronic
1167612218 19:50513016-50513038 GAGAGGGGAAAGAGGGCGGAGGG + Intronic
1168072175 19:53959417-53959439 GAGAGGAGATGGATGGGGGAAGG - Intergenic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168283689 19:55320176-55320198 GAGGGGAGAAGGAAGTGGGAGGG + Intronic
1168433796 19:56302283-56302305 GAGGGAAGAAGGAGAGAGGAAGG - Intronic
1168465002 19:56595047-56595069 GAGAAGAGACGGAGGGAGGAAGG - Intergenic
925229457 2:2220042-2220064 GAGTGGAGAAGAGGGGAGGATGG + Intronic
925356741 2:3246963-3246985 GAGAGGGGAAGGAGGGAGGGAGG + Intronic
925516901 2:4692801-4692823 CAGTACAGAAGGAGGGTGGATGG - Intergenic
926148190 2:10409654-10409676 GGGTGGAACAGGAAGGTGGAAGG - Intronic
926266852 2:11330921-11330943 GAGGAGAGGAGGAGGGAGGAAGG + Intronic
926335415 2:11859095-11859117 AAGTGGAGCAGGATGGTGGTTGG + Intergenic
926406799 2:12561850-12561872 GTGTAGAGAGGGAAGGTGGAGGG + Intergenic
926429152 2:12768089-12768111 GAGAGCAAAAGGAGGGAGGAAGG + Intergenic
926570575 2:14525355-14525377 AAGAGGAGAAGGAGGGAGGGTGG + Intergenic
926683563 2:15681112-15681134 GAGGGGAGGGGGAGGGGGGAGGG + Intergenic
926683579 2:15681136-15681158 GAGGGGAGGGGGAGGGGGGAGGG + Intergenic
926683591 2:15681154-15681176 GAGGGGAGGGGGAGGGGGGAGGG + Intergenic
926726927 2:16005671-16005693 AAGAGGAGAAGGAGGGTGGCTGG - Intergenic
926730904 2:16034653-16034675 GAGTGGAGATGGAGGGTTTGGGG + Intergenic
927282515 2:21321857-21321879 GGATGGAGAGGCAGGGTGGAGGG - Intergenic
927340285 2:21975913-21975935 CAGTAAAGAAGGAGGGTGGGTGG - Intergenic
927438455 2:23090593-23090615 GAGGGGAGGAGGAGAGGGGAGGG + Intergenic
927466138 2:23338101-23338123 GTGTGGAGAGGGAGAGTGGATGG + Intergenic
927850819 2:26498234-26498256 CAGTAGAGGCGGAGGGTGGAGGG + Intronic
927962791 2:27250977-27250999 GAGTGGAGAAGGAGGATAGGAGG + Intergenic
928043945 2:27908510-27908532 GAGAGGCCAAGGTGGGTGGATGG - Intronic
928158576 2:28899519-28899541 GACTAGAGAAGGTGGGTTGAAGG + Intronic
928250810 2:29677221-29677243 GAGGGGAGAAGGAAGGAAGAAGG - Intronic
928342662 2:30458632-30458654 GAGTGGAGAGTGATGGTGGGTGG + Intronic
928372429 2:30750305-30750327 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
928405256 2:31009879-31009901 GATGGGAAAAGGAGGGTGGCTGG - Intronic
928916841 2:36481251-36481273 GAGTGGAGAAGGAAGGCAGTTGG + Intronic
929434093 2:41914118-41914140 GAGTGGAGGAGGATGGGGGTGGG - Intergenic
929607865 2:43247145-43247167 CAGTGGAGAAGCTGGGAGGAGGG + Intronic
929680110 2:43985490-43985512 GGGTTCGGAAGGAGGGTGGAAGG - Intronic
929687496 2:44047231-44047253 GAGTGAAGGGGGAGGATGGATGG + Intergenic
929903330 2:46024655-46024677 GACTTCAGAAGGAGGGTGGAAGG + Intronic
929948585 2:46389094-46389116 GTGAGGAGCAGGAGGCTGGAAGG - Intergenic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930088770 2:47516961-47516983 GGGTGGAGAGGGAGGGAGGGAGG - Exonic
930249745 2:49021999-49022021 GAATTGAGAAGGAGGGGGAAAGG + Intronic
930288535 2:49465377-49465399 AAGGGGAGAAGGAAAGTGGAAGG - Intergenic
930692929 2:54383012-54383034 GAGGGGAGAGGGAGGGCAGAGGG - Intronic
931664992 2:64604041-64604063 GAGAGGAGAGGGAGGGAGAAGGG - Intergenic
931784530 2:65607498-65607520 AAGGGGATGAGGAGGGTGGAGGG + Intergenic
931787761 2:65635924-65635946 GGGAGGAGACGGAGGGAGGAAGG + Intergenic
932133941 2:69212212-69212234 GAGGGGAGGAGGAGGATGGGAGG + Intronic
932136173 2:69230948-69230970 GAGTGGGGAAGGTAGGAGGAGGG - Intronic
932302538 2:70677234-70677256 GAGGGGAGAGGGAGGGAGGGTGG + Intronic
932314346 2:70769490-70769512 GAGTGTGGAAGGAGGGTGCAGGG - Intergenic
932334470 2:70922277-70922299 AAGTGGAGAGGAAGGGAGGAGGG + Intronic
932416904 2:71579072-71579094 GGGTGGAGAGGGAGGCTGGATGG - Intronic
932583569 2:73008355-73008377 GCGGGGAGAAGGAGAGGGGAGGG + Intronic
933166891 2:79086530-79086552 CAGTGGAGAAGGAAGGTGTGAGG + Intronic
933234511 2:79850283-79850305 GAGGGGGGAGGGAGGGAGGAAGG - Intronic
933270351 2:80226637-80226659 GAGGGAAAAAGTAGGGTGGAGGG - Intronic
933684584 2:85133373-85133395 GAGCGGGGAGGGAGGGAGGAGGG - Intergenic
933721161 2:85398586-85398608 GAGGGGAGAAGGCAGGGGGAAGG - Intronic
934298628 2:91763157-91763179 AAGTGGAGAAGGAGAGTGAAAGG - Intergenic
934883489 2:98004684-98004706 GAGAGGAGGAGGAGGAGGGAGGG - Intergenic
936015854 2:108958559-108958581 GAGGGCAGAAGGACGGTGGGAGG + Intronic
936152665 2:110030181-110030203 GAGGGGAGCAGGCGGGAGGAAGG + Intergenic
936165499 2:110116323-110116345 GAGTGGAAAAGGAGGGAGCTGGG - Exonic
936192015 2:110341231-110341253 GAGGGGAGCAGGCGGGAGGAAGG - Intergenic
936270129 2:111042829-111042851 GAGTGGAGCTGGATGGAGGATGG + Intronic
936514411 2:113172892-113172914 TGGTGGAGAAGCAGGGTGCACGG + Intronic
936662738 2:114560220-114560242 GGGAGGAGAAGGAGGGCAGAGGG + Intronic
936751761 2:115650813-115650835 GAGCGGAAAAGGAGTGGGGAGGG + Intronic
936989979 2:118352993-118353015 GAGTGGGGAAAGTGGGAGGATGG - Intergenic
937307470 2:120881349-120881371 GGGTGGAGAAGGACAGTGGCAGG + Intronic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
937856871 2:126678642-126678664 CAGTGGTGAAGGATGCTGGAAGG - Intronic
938032851 2:128010215-128010237 GAGTGAAGGAGGAGGATGGCAGG + Intronic
938157271 2:128952216-128952238 GAGTGCAGAGGGGGAGTGGAGGG - Intergenic
938163847 2:129009423-129009445 GAGTGGAGCAGGTGGGAAGAAGG + Intergenic
938292469 2:130157399-130157421 GGGTGGAGAAGGAGGGGTGAGGG + Intronic
938464085 2:131515577-131515599 GGGTGGAGAAGGAGGGGTGAGGG - Intergenic
939198204 2:138999750-138999772 GAGAAGAGAAAGAGGGTGGTAGG + Intergenic
939891201 2:147738425-147738447 GAGTGGATAAGGTGAGTGGGTGG + Intergenic
940322385 2:152390678-152390700 GAGTGGGAAAGAAGGTTGGATGG - Intronic
940428740 2:153562012-153562034 GAGAGGAGAGGGAGGGAGAATGG - Intergenic
941268956 2:163401266-163401288 GAGGGTAGAAGGAAGGAGGAGGG - Intergenic
941347580 2:164389343-164389365 GAGAGGAGAGGGAGGGAGGGAGG - Intergenic
941464971 2:165814663-165814685 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
942034011 2:171993121-171993143 GAGTGGAGGTGGAGAGTGGGAGG + Intronic
942208004 2:173641884-173641906 GAGAGGAGCAGGTGGGTGAATGG - Intergenic
942507356 2:176657069-176657091 GGGAGGAGGAGGAGGGAGGAAGG + Intergenic
942571867 2:177323175-177323197 CAGTGGAGGAGGAGGGAGCAGGG - Intronic
942636738 2:178015773-178015795 GAGAGGAAAAGGAGGGTGGAAGG + Intronic
942749760 2:179274616-179274638 GACTGGAGAAGGTGAGGGGAGGG + Intergenic
943342615 2:186698762-186698784 GAGTGGGGAAGAAGTGGGGATGG - Intronic
943611470 2:190039663-190039685 GAGGGGAGAGGGTGGGAGGAGGG - Intronic
943628227 2:190222187-190222209 GAGTGCAGAAGCTGGGTTGAGGG - Intronic
944532090 2:200677209-200677231 GAGGAGAGAAGGAGGGAGGGAGG + Intergenic
944897211 2:204177521-204177543 GAGTAGGGAAGGAGGGAGGGAGG - Intergenic
944977830 2:205077160-205077182 GAGTAGAGAGGGAGGGAGGGAGG + Intronic
945154390 2:206823303-206823325 GAGTGGAGAGGGTGGGGGAAGGG + Intergenic
945158677 2:206865651-206865673 GTTTGGAAAAGGAGGCTGGAAGG - Intergenic
945851181 2:215009294-215009316 GAGGGGAACAGAAGGGTGGAGGG + Intronic
946045295 2:216816032-216816054 AAGAAGAGAAGGAGGATGGAGGG - Intergenic
946385917 2:219384470-219384492 GAGTGGGGGTGGAGGGTTGAAGG - Intronic
946452099 2:219789078-219789100 GAGTGGGGAGGGAAGGAGGAAGG - Intergenic
946519116 2:220446683-220446705 GAGGGGAGAAGGGGGGAGGAAGG - Intergenic
946971235 2:225094009-225094031 GACTTGAGAATGAGGGAGGAAGG - Intergenic
947030052 2:225783019-225783041 GAGGGAGGAAGGAGGGAGGAAGG - Intergenic
947148005 2:227086287-227086309 GAGAGGAGATGTAGGGAGGATGG + Intronic
947833388 2:233158033-233158055 GAGAGGGGAAGGAGGGAGGCAGG + Intronic
947873259 2:233451340-233451362 GAGTGGAAAAGGGAGGTGGCCGG + Intronic
947960898 2:234236351-234236373 GGGTGGAAAGGGAGGGAGGAAGG - Intergenic
948091804 2:235301776-235301798 GAGGGGAGGAGGTGGGAGGAAGG - Intergenic
948091837 2:235301905-235301927 GAGAGGAGGAGGAGAGAGGAGGG - Intergenic
948223203 2:236289658-236289680 GTGAGAAGGAGGAGGGTGGAGGG + Intergenic
948380144 2:237545039-237545061 GAGTGGGGACAGTGGGTGGAGGG + Intronic
948458454 2:238118080-238118102 GATGGATGAAGGAGGGTGGATGG + Intronic
948458693 2:238118948-238118970 GATTGATGGAGGAGGGTGGATGG + Intronic
948458708 2:238119005-238119027 GATTGATGGAGGAGGGTGGATGG + Intronic
948577761 2:238965369-238965391 GGGAGGAGAGGGAGGGAGGAGGG - Intergenic
948606967 2:239141978-239142000 GAGTGGAGAGGGATGCAGGATGG + Intronic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948653220 2:239462051-239462073 GAGTGAAGAGGGAGGGTGGCCGG - Intergenic
948695676 2:239732066-239732088 GGGTGGAGTGGGAGGGTGGGAGG - Intergenic
948871955 2:240805113-240805135 GAGAGGGGAGGGAGGGCGGAGGG + Intronic
948871968 2:240805142-240805164 GAGTGGGGAGGGAGGCGGGAGGG + Intronic
1168922527 20:1552406-1552428 CAGTGGAGATGTAGGGTTGAAGG - Intronic
1169023333 20:2347249-2347271 GAGTGGAAGAGGAGTGGGGAAGG - Intergenic
1169155628 20:3327364-3327386 GAGTGGGGAAAGATGGGGGAGGG + Intronic
1169241620 20:3986265-3986287 GAGTGAGGAGGGAGGGAGGAAGG - Intronic
1169357187 20:4917225-4917247 GGGTGCAGCAGGAGAGTGGATGG + Intronic
1169395336 20:5224071-5224093 GAGTGAAGTAGGAGGGGGCAGGG - Intergenic
1169509906 20:6252209-6252231 GAGAGGGGAAGGAGGGAGGCAGG + Intergenic
1169673734 20:8132208-8132230 GGGGGGAGGAGGAGGGAGGAGGG + Intronic
1169708067 20:8529696-8529718 GGCTGGAGAAGGAGGGTGTGAGG - Intronic
1169791364 20:9413863-9413885 GAGGGGTGGAGGAGGGAGGATGG - Intronic
1169964142 20:11196438-11196460 GGGTGGAAAAGGTGGGAGGAAGG + Intergenic
1170055763 20:12200908-12200930 AGCTGGAGAAGGAGGGTGGGTGG + Intergenic
1170142513 20:13139090-13139112 AGGAGGAGAAGGAGGGAGGATGG - Intronic
1170475876 20:16713969-16713991 GGGTGGGAATGGAGGGTGGAAGG + Intergenic
1170633915 20:18088464-18088486 AAGGAGAGAAGGAGGGAGGAAGG - Intergenic
1170721427 20:18883222-18883244 GAGAGGAAAAGGATGGTTGAGGG - Intergenic
1170743989 20:19081905-19081927 GTGAGGAGAAGGGGGGTGGGAGG - Intergenic
1171249524 20:23637713-23637735 GCGTGGAGGAGGAGGGTGTGCGG - Exonic
1171338278 20:24407743-24407765 GAGGGGAAAAGGAGGGAGCATGG + Intergenic
1171370900 20:24661416-24661438 GAGTTAGGAAGGAGGGAGGAAGG + Intronic
1171486389 20:25489456-25489478 GTAAGGAGAAGGAGGGGGGATGG - Intronic
1172020633 20:31911358-31911380 GGAGGGAGCAGGAGGGTGGAGGG + Intronic
1172057376 20:32164036-32164058 GACTGGAGCAGAAGGGAGGAAGG - Intronic
1172113937 20:32562925-32562947 GAGTGGAGAAGGAGGGTGGAGGG + Intronic
1172113950 20:32562954-32562976 GGGTGGGGAGGGAGAGTGGAGGG + Intronic
1172460285 20:35112956-35112978 GAGTGGGAAAGGAGGGAGGGAGG + Intergenic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172891222 20:38266941-38266963 GAATGGAGACAGAGAGTGGAAGG + Intronic
1172967304 20:38846091-38846113 GATCGGAGTAGGAGGGAGGAGGG + Intronic
1173380487 20:42535322-42535344 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1173438846 20:43057305-43057327 GAATGGAGGAGGAGGGGGGAAGG + Intronic
1173517643 20:43676255-43676277 GAGGGTGGGAGGAGGGTGGAGGG - Intronic
1173631618 20:44520602-44520624 GAGTGGGGAAGGACGGTGGGGGG + Intronic
1173822652 20:46029271-46029293 GAGCGGCGAAGGCGGGTAGAGGG + Intronic
1173912611 20:46681440-46681462 AAGAGGGGAAGGAGGGAGGAGGG + Intronic
1174166372 20:48586452-48586474 GAGTGGAGCAGGAGGGTGCGGGG - Intergenic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1174298970 20:49568356-49568378 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
1174308986 20:49635762-49635784 GGGTGGGGATTGAGGGTGGAGGG - Exonic
1174533779 20:51235640-51235662 AAGGGGACAAGGAGGCTGGAGGG + Intergenic
1174753125 20:53131960-53131982 GAGTGGTGAAGGAGAGTAGAGGG + Intronic
1174896065 20:54451504-54451526 GCGTGGAGAAGGAAGGGAGAAGG - Intergenic
1175043723 20:56081811-56081833 GGGAGGAGAAGGAAGGTGCAGGG + Intergenic
1175052299 20:56166889-56166911 GACTGGAGGAGGTGGGGGGATGG - Intergenic
1175237790 20:57525784-57525806 GAATGGATAAGGAGGGTAGGAGG + Intergenic
1175238077 20:57526578-57526600 GAAAGGATAAGGAGGGAGGAGGG + Intergenic
1175238098 20:57526640-57526662 GAATGGATAAGGAGGGGAGAAGG + Intergenic
1175238116 20:57526692-57526714 GAATGGATAAGGAGGGAGGAGGG + Intergenic
1175315200 20:58042411-58042433 GAGTGAAGCAGGAGAGAGGAGGG - Intergenic
1175316766 20:58054140-58054162 GAGTAGAGAGGGAGGGAGGGAGG + Intergenic
1175385640 20:58593206-58593228 GTGTGAAGAAGAAGGCTGGAAGG - Intergenic
1175667941 20:60876386-60876408 GATTGGAGGATGATGGTGGAGGG - Intergenic
1175790319 20:61736592-61736614 AAGGGGAGAGGGAGGGAGGAAGG + Intronic
1175872194 20:62213748-62213770 GAGTGGGGATGGGGGTTGGAGGG + Intergenic
1175891485 20:62317934-62317956 GAGGGAAGGAGGAGGATGGAGGG + Intronic
1176274477 20:64255941-64255963 GGGTGGGGAAGGAGGAGGGAAGG - Intronic
1176383985 21:6127875-6127897 GAGAGGAGAAAGAGGAGGGAGGG + Intergenic
1177167854 21:17623178-17623200 GAGAGGCCAAGGTGGGTGGATGG - Intergenic
1177462715 21:21433806-21433828 GAGAGAAAAAGGAGGGTGGTAGG + Intronic
1177664826 21:24141176-24141198 GAGTGGGGAGGGAAGGAGGAGGG + Intergenic
1177886418 21:26751231-26751253 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1178407948 21:32339916-32339938 GAGTGAGGAAGGAGGGAGGCCGG - Intronic
1178561360 21:33642406-33642428 GGGCGGAGATGGATGGTGGATGG + Intronic
1178568909 21:33716399-33716421 GAGTGAAGAAGGAAGGAGGTAGG - Intronic
1178687717 21:34724271-34724293 GTGTGGAGAAGGGGTGGGGAAGG + Intergenic
1179084983 21:38207958-38207980 GAGTGGAGGAGGAGAGAGGAGGG - Intronic
1179116686 21:38499745-38499767 GAGAGGAGGAGGAGGAGGGAGGG + Intronic
1179261659 21:39763437-39763459 GAGATGAAAAGGAGGGAGGAGGG - Intronic
1179315647 21:40241996-40242018 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1179438452 21:41377654-41377676 GAGGTGAGAAGGTGGATGGAGGG - Intronic
1179496471 21:41774987-41775009 GAGTTGAGGAGGAGGATGTATGG + Intergenic
1179547430 21:42122176-42122198 CACTGCTGAAGGAGGGTGGAGGG + Intronic
1179563796 21:42234160-42234182 CAGAAGGGAAGGAGGGTGGAGGG + Intronic
1179583990 21:42363476-42363498 CATTGGAGAAGGAAGCTGGATGG - Intronic
1179667488 21:42922786-42922808 GAAGGGAGCAGAAGGGTGGAGGG + Intergenic
1179739489 21:43410363-43410385 GAGAGGAGAAAGAGGAGGGAGGG - Intergenic
1179834251 21:44018982-44019004 GAGTGGAGCACGGGGGTGGGAGG - Intronic
1179912250 21:44456453-44456475 GAGCGGAGAGGGAGGGAGGGTGG - Intronic
1180104258 21:45607589-45607611 GAGGGGAGAAGGGAGGTGAAAGG + Intergenic
1180151526 21:45950648-45950670 TGGTGGAGAAGGTGGGTGCATGG - Intergenic
1180157715 21:45986209-45986231 GAGTGGAGGCTGAGGGTGGCAGG - Intronic
1181382868 22:22520856-22520878 TAGTGAAGGAGGAGGGAGGAGGG - Intergenic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181521109 22:23449281-23449303 GGATGGAGAAGGAGGGAGAAGGG - Intergenic
1181527879 22:23500487-23500509 GGGAGGAGAAGGAAGGTGGAGGG + Intergenic
1181528482 22:23502871-23502893 GATTGGGGATGGAGGGTGGAGGG - Intergenic
1181661334 22:24351360-24351382 GGGTGGAGAATGGGTGTGGAAGG + Intronic
1181950195 22:26548332-26548354 GAGGGGAGAGGGAGGGGGAAAGG + Intronic
1181958326 22:26604599-26604621 GAGAAGGGAAGGAGGGTTGAGGG + Intronic
1181984367 22:26789387-26789409 GTCTGGAGGATGAGGGTGGATGG - Intergenic
1182244545 22:28945450-28945472 GAGAGGCCAAGGAGGGTGGATGG + Intronic
1182560087 22:31152862-31152884 GTGTGGAGAGGGAGGGAGGTGGG - Intergenic
1182694445 22:32187254-32187276 GATTGGAGAAAGAGAGTGAAGGG + Intergenic
1182819349 22:33201677-33201699 GAGTAAAGAAAGAGAGTGGAGGG + Intronic
1183084457 22:35478056-35478078 GAGAGGAGAAGGAGGGAAGTGGG - Intergenic
1183085378 22:35483693-35483715 GAGGGAAGAAAGAGGGAGGAAGG + Intergenic
1183112121 22:35658139-35658161 GAAGTGAGTAGGAGGGTGGAGGG - Intronic
1183231354 22:36584107-36584129 GAGTGGAGAGTGATGGGGGAGGG - Intronic
1183381247 22:37491592-37491614 AGGGGGAGAAGGAGGGGGGAGGG + Intronic
1183381494 22:37492560-37492582 GAGTGGAGAGGGAGAGATGAAGG + Intronic
1183468549 22:37993058-37993080 GAGTGGGGAAGGTGGAGGGAAGG + Intronic
1183483047 22:38075337-38075359 GGGAGGGGAGGGAGGGTGGAGGG - Exonic
1183510585 22:38232462-38232484 GTGTGGAGAAGGCGGGGGAAGGG + Intronic
1183526737 22:38327564-38327586 GAGTGGAGCAGGAGGACAGAGGG - Intronic
1183726498 22:39592859-39592881 GTGTGGGGTAGGAGGGTGGCGGG - Intronic
1184017016 22:41793968-41793990 GGCTGGAGCAGGAGGGTGGAAGG - Intronic
1184092507 22:42299902-42299924 GGGTGGAGGAGGAGGGGGAAAGG + Intronic
1184147010 22:42617690-42617712 GAGTGGGGAAGAAGAGGGGACGG - Intergenic
1184208103 22:43018016-43018038 GACTGAAGGAGGAGGCTGGATGG - Intergenic
1184612448 22:45613397-45613419 AAGGGGAGGAGGATGGTGGACGG - Intergenic
1184691320 22:46118612-46118634 GCGGGAGGAAGGAGGGTGGATGG - Intergenic
1184708937 22:46236464-46236486 GAGTGGAGCAGGAAGCTGGCGGG - Exonic
1184745124 22:46451650-46451672 TTGTGGAGAAGGAGGTTGTAGGG - Intronic
1185151744 22:49167674-49167696 GAGTGCAGAGGGGGTGTGGAGGG + Intergenic
1185187647 22:49412184-49412206 GAGTGGAGGAGGAGGAGGGCGGG + Intergenic
949327870 3:2887384-2887406 GTGTGGAGAGTGAGGGTGGGGGG + Intronic
949433111 3:3999694-3999716 GAGTGGGAAAGGTGGGAGGAGGG + Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949722528 3:7007230-7007252 TGATGGAGAAAGAGGGTGGAAGG - Intronic
949723008 3:7012544-7012566 CAGGGGAGAAGGATGGGGGAAGG - Intronic
949797160 3:7863837-7863859 CATTGGAGAAGGAAGATGGAGGG + Intergenic
950120382 3:10478558-10478580 CAGGGGAGCAGGAGGTTGGATGG - Intronic
950158826 3:10743753-10743775 CAGTGGCGGGGGAGGGTGGAGGG - Intergenic
950289074 3:11769029-11769051 GAGCAGAGACAGAGGGTGGAGGG + Intergenic
950465796 3:13153079-13153101 GAGGGGAGAAGGAGGGGAGAGGG - Intergenic
950465803 3:13153097-13153119 GAGAGGAGAGGGAGGGGAGAGGG - Intergenic
950792881 3:15487558-15487580 GGGAGGAGAAAGAGGGTGTAAGG - Intronic
951046182 3:18041069-18041091 GAGAGGACAAGGAGGGAAGAGGG - Intronic
951398301 3:22199202-22199224 GGATGGAAAAGCAGGGTGGAGGG - Intronic
951453959 3:22870112-22870134 GAGGGGAGAATTAGGATGGAGGG - Intergenic
951720547 3:25693216-25693238 GAGGGTAGAAGGTGGGAGGAGGG - Intergenic
952569233 3:34694467-34694489 GAAGGGAGAAGGAGGGAGGGAGG - Intergenic
952619816 3:35324215-35324237 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
952741373 3:36738062-36738084 AAGTGGGGAGGAAGGGTGGAAGG - Exonic
952755039 3:36858507-36858529 GAGTGGTCAGGGAGGGTTGATGG - Intronic
952767284 3:36965260-36965282 GGGAGGACAAGGAGGGAGGATGG + Intergenic
952882409 3:37992951-37992973 GAGTGGAGGGGGAGGAGGGAAGG + Intronic
952913096 3:38207897-38207919 GAGGGGAGGGGGAGGGGGGAGGG - Intronic
953227694 3:41035441-41035463 GAGTGGGGAAGAAGGGGAGAAGG - Intergenic
953744801 3:45566214-45566236 GAATAGAGAAGGAGAGAGGAAGG - Intronic
953961711 3:47271172-47271194 AAGCTGAGAAGGAGGGTGGCAGG + Intronic
954264490 3:49461846-49461868 AGGAGGAGAAGGAGGGTGGGAGG - Intergenic
954290576 3:49647854-49647876 GAGTGGGGAAGAAGGGTACAGGG - Intronic
954436286 3:50498102-50498124 GAGTGGGGTAGGTGGCTGGAAGG + Intronic
954447964 3:50556865-50556887 GAGGGCAGAAGGTGGGTGGAAGG + Intergenic
954456123 3:50600780-50600802 GAGTAGAGTCGGGGGGTGGAGGG - Intergenic
954593066 3:51800813-51800835 GAGAGGTGAAGGAGGGAGGGAGG + Intergenic
954694656 3:52415529-52415551 GACTGGAAAAGGAGGCAGGAGGG - Intronic
955072439 3:55583442-55583464 GAGAGGGGAAGGAGGGAGGGAGG - Intronic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
955228784 3:57081153-57081175 AAGGGGAGAAAGAGGCTGGAGGG + Intergenic
955512484 3:59695370-59695392 TAGGGGAAATGGAGGGTGGAGGG - Intergenic
955537999 3:59944668-59944690 GAGTGTAGAAGGTGGGTGAAGGG - Intronic
955554391 3:60120097-60120119 GACTGGAAAAGGTTGGTGGAAGG - Intronic
955770231 3:62378145-62378167 GAGGGAAGAAGGAGGGAGGGAGG - Intergenic
955778821 3:62462336-62462358 GAGAGGAGCTGGAGGGAGGAGGG - Intronic
955972120 3:64445806-64445828 GAGTGGAGATGGAAGGATGAGGG + Intergenic
956147836 3:66210112-66210134 AAAGGGAGAAGGAGGGAGGAAGG - Intronic
956350765 3:68333475-68333497 GAGTGTAGAGGGTGGGTGGAGGG + Intronic
956781508 3:72606669-72606691 GACTGGGGTAGGAGGGAGGAGGG + Intergenic
956828755 3:73024650-73024672 GAAAGGAGAAGGAGGGAGGGAGG - Intronic
956906110 3:73767058-73767080 ACTTGGCGAAGGAGGGTGGAGGG - Intergenic
957287077 3:78230765-78230787 CAGAGGAGAAGGAGGATGGAAGG + Intergenic
957416935 3:79917465-79917487 GGGAAGAGAAGGAGGGAGGAAGG + Intergenic
957523774 3:81354155-81354177 GAATGGAGATGGAGGGATGATGG + Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
958054752 3:88394881-88394903 GAGAGGAGAGGGTGGGAGGAGGG + Intergenic
958256696 3:91333000-91333022 GACTGGAGCAGGAGGAAGGAAGG - Intergenic
958530328 3:95321570-95321592 GAGTGTAGTAGGCTGGTGGAAGG - Intergenic
958870950 3:99558333-99558355 GATGGGGGAAGGAGGGAGGAAGG + Intergenic
959087599 3:101868105-101868127 GAGGGGAGAGGGAGGGAAGAAGG - Intergenic
959134278 3:102397423-102397445 GCTTGGAGAAGGAGGATTGATGG + Intronic
959993661 3:112656841-112656863 GAGTGGAGAGGGAGGGAGAAAGG - Intergenic
960356180 3:116656185-116656207 GAAGGGAGAGGGAGGGAGGAAGG - Intronic
960422371 3:117462881-117462903 GATTGAAGGAGGAGGGTGGTGGG + Intergenic
960431902 3:117579727-117579749 GAGTGGAGAGGGAGGTGAGAGGG + Intergenic
960684209 3:120280690-120280712 AAGGAGAGAAGGTGGGTGGATGG - Intronic
960708453 3:120504353-120504375 GAGTGGAGAAGGGTGGAGCAAGG - Intergenic
960719246 3:120609579-120609601 GAGGGAGGGAGGAGGGTGGAGGG - Intergenic
960810666 3:121624474-121624496 GGGTGGAGAAGGATGGAGAATGG - Intronic
960854645 3:122090743-122090765 GGGTAGTGAAGGAGGGAGGAGGG + Intronic
961247957 3:125473179-125473201 GAGCGGGGAGGGAGGGTGGAAGG - Intronic
961329001 3:126128018-126128040 CAGTGGGGCATGAGGGTGGAGGG + Intronic
961339017 3:126204973-126204995 GAGAGGAGAGGGAGAGTTGAGGG + Intergenic
961340114 3:126212250-126212272 GAGAGAAGAAGGAGGGAGGAAGG + Intergenic
961347723 3:126274882-126274904 GAGGGAAGAAAGAGGGAGGAAGG - Intergenic
961395031 3:126580586-126580608 GGGTGGAGAACCAGGGTGGGTGG - Intronic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961826612 3:129602453-129602475 AAAGGGAGAATGAGGGTGGAGGG - Intronic
961994383 3:131226096-131226118 GAGTGGGGAAAGAGGGAGAATGG + Intronic
962072303 3:132044874-132044896 GAGGGGAGGGGGAGGGGGGAGGG + Intronic
962769691 3:138600905-138600927 AGGAGGAGAAGGAGGGAGGAGGG + Intergenic
962769701 3:138600930-138600952 AGGAGGAGAAGGAGGGAGGAGGG + Intergenic
962816054 3:139001845-139001867 GGCTGGAGGAGGAGGGTGGATGG - Intergenic
962834414 3:139174376-139174398 GAGTGGAATCGGAGGGTGGTAGG - Intronic
962890223 3:139665346-139665368 GAGGGAAGAAGGAGGGAGGGAGG - Intronic
962922380 3:139962438-139962460 GAGTGAAGAATGAGGTTGGAAGG - Intronic
963094464 3:141521242-141521264 GAGTGGATAAGGAGGGTTTCAGG + Intronic
963108411 3:141665609-141665631 GAAAGGAGAGGGAGGGAGGAAGG + Intergenic
963256797 3:143152998-143153020 GACTGGGGCAGGAGGGAGGAGGG - Intergenic
963284223 3:143417486-143417508 GGGGGGAGAGGGAGGGAGGAGGG + Intronic
963509655 3:146231010-146231032 GAGGGCAGAAGGTGGGAGGAGGG - Intronic
963764004 3:149314922-149314944 GACTCCAGAAGGAGGGAGGAAGG + Intergenic
963839723 3:150093103-150093125 AAGTGGGGAGGGAGCGTGGAAGG + Intergenic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
963931797 3:151011127-151011149 AAGTGGAGAAGGTGGGAGGAGGG + Intergenic
964527492 3:157630912-157630934 GAGAGGAGTAGAAGGGGGGAAGG - Intronic
964907350 3:161733750-161733772 GACTGGGCAAGGAGGGTGGGAGG - Intergenic
964979680 3:162664521-162664543 GAGTGTAGGAGGTGGGAGGAGGG + Intergenic
965211630 3:165797277-165797299 GAGGGAGGAAGGAGGGAGGAAGG - Intronic
965359191 3:167716278-167716300 GGGTGGAGAAGAAGTGAGGATGG + Intronic
965473793 3:169129293-169129315 GAGTGGAAAATGAAGCTGGAGGG + Intronic
966042019 3:175503073-175503095 GAGGGTAGATGGTGGGTGGAAGG - Intronic
966140657 3:176752504-176752526 GAGCGGGGAGGGAGGGAGGAAGG + Intergenic
966300746 3:178476869-178476891 TAGAGGAGAAGGAGAGTGGAAGG + Intronic
966588215 3:181650995-181651017 GAGGGGAGAGGGAAGGAGGAAGG + Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
966946503 3:184780672-184780694 GGTTGGAGAAGGAGGATAGATGG - Intergenic
967116483 3:186344590-186344612 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
967317338 3:188161707-188161729 GAGTGGGGAAGGAAGGTGTGAGG - Intronic
967498866 3:190174740-190174762 GAGAGAAGAAGGAGGGAGGGAGG - Intergenic
967986690 3:195100559-195100581 GAGAGGAGGAGGAGGCTGGCAGG - Intronic
968045913 3:195623890-195623912 GGGTGGGGTTGGAGGGTGGATGG + Intergenic
968274357 3:197428553-197428575 GAGTGGTGATGGAGGTGGGAGGG + Intergenic
968308741 3:197666197-197666219 GGGTGGGGTTGGAGGGTGGATGG - Intergenic
968383285 4:112817-112839 GAGCTGAGAAAGAGGGTGTAAGG - Intergenic
968481135 4:833542-833564 GAATGGGGAAGCGGGGTGGAAGG + Intergenic
968538261 4:1148776-1148798 GACTGAGGCAGGAGGGTGGAAGG - Intergenic
968902789 4:3439177-3439199 CAGTGGGGAAGCAGGGTGGTAGG + Intronic
968923090 4:3532642-3532664 AACTGGAGAATGAGGGTGGCCGG + Intergenic
968952006 4:3700217-3700239 GAGTGGAGGGGGAGGGGGGGAGG + Intergenic
969143873 4:5102930-5102952 GAGAGGAGGGGGAGGGGGGAGGG - Intronic
969256769 4:6007753-6007775 GAGTGGACACGGTTGGTGGATGG + Intergenic
969327352 4:6451728-6451750 GCCGGGAGGAGGAGGGTGGAAGG - Intronic
969426479 4:7127367-7127389 GGGTGGAGAAGCAGGCTGGCAGG + Intergenic
969450217 4:7268723-7268745 GAGTGGAGGAGGAGCAGGGAGGG + Intronic
969493345 4:7512374-7512396 GAGGGAAGAAGGAGGGAAGAAGG + Intronic
969565030 4:7972256-7972278 GAGTGGAGAAGAGGCGTGCAAGG - Intronic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
969626608 4:8308931-8308953 GCAGGGAGAAGGAGGGTGGTGGG - Intergenic
970173543 4:13313245-13313267 GAGTGTGGAAGGTGGGAGGAGGG + Intergenic
971004721 4:22360059-22360081 GACTAGAGAGGGAGGGAGGATGG + Intronic
971439331 4:26663030-26663052 GATTGGAGCAGGAGGTTGGAAGG + Intronic
971542690 4:27840854-27840876 GAGGGGAGAGGGCGGGTGGAGGG - Intergenic
971664331 4:29462184-29462206 GAGGGGGGATGGAGGGAGGAGGG + Intergenic
972217111 4:36909712-36909734 GATGGGAGACGGAGGCTGGATGG - Intergenic
972335673 4:38105582-38105604 GGGTGGAGAGGGAGGGAGGAAGG - Intronic
972445983 4:39144383-39144405 GAAAGGGGGAGGAGGGTGGAAGG - Intergenic
973088501 4:46100321-46100343 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
973826794 4:54715548-54715570 GAGAGGAGAAGAAGGGTGCCAGG + Intronic
973865469 4:55108696-55108718 GAGTGGAGAGGGAGGGAGGGAGG - Intronic
974168455 4:58235033-58235055 GAAGGGAGAAGGAGTGTTGATGG - Intergenic
974482972 4:62470271-62470293 GAGGGGAGGGGGAGGGGGGAAGG - Intergenic
974716163 4:65670530-65670552 GAGGAGGGAAGGAGGGTGGGAGG - Intergenic
974769250 4:66389451-66389473 GTATGGAGAAGGAGGGTGCGAGG - Intergenic
975197418 4:71541746-71541768 GAGTGGAAAGGGAAGGTGGGTGG + Intronic
975322358 4:73023187-73023209 AAATGGAGAAGGAGGGAGGGAGG - Intergenic
975536922 4:75460707-75460729 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
975568546 4:75788015-75788037 GATTGGAGTAGGAGAATGGAGGG - Intronic
976018965 4:80596082-80596104 GATTGGAGAAGGAGGGAGAGAGG + Intronic
976380497 4:84393132-84393154 AAGAAGAGAAGGAGGGAGGAAGG + Intergenic
976466245 4:85372039-85372061 GAGTGGGGAGGGAGGGTTGAAGG + Intergenic
976512530 4:85928300-85928322 GAGGGAAGGAGGAGGGAGGAAGG - Intronic
977086847 4:92610545-92610567 AAGTGGAAAAGGAGGGGGAAGGG - Intronic
977290554 4:95160579-95160601 GAGGGAGGAAGGAGGGAGGAAGG - Intergenic
977482985 4:97602351-97602373 GATTGGAGCAGGAGGATGGATGG - Intronic
977578762 4:98702279-98702301 GAGTGTAGCAGGAGGGTATAAGG - Intergenic
977837312 4:101660356-101660378 GATTAGAGGAGAAGGGTGGAAGG - Intronic
977842627 4:101727376-101727398 GACTGAAGAGGGTGGGTGGAAGG - Intronic
978234575 4:106443265-106443287 GAGAAGAGAAGGAGGGAGGGAGG - Intergenic
978268564 4:106859049-106859071 GAGGGGAGGGGGAGGGTGAAGGG + Intergenic
978297283 4:107220570-107220592 GAGTGGGGAAGGAGGGAGGGAGG + Intronic
979046042 4:115866484-115866506 GAGTGAGGAAGGAAGGAGGAAGG + Intergenic
979195647 4:117917152-117917174 GGGTGGGGAAGGTGGGTTGAGGG - Intergenic
979198555 4:117949427-117949449 CAGTGGAGTAGGTGGGTGAAGGG + Intergenic
979853234 4:125599605-125599627 GAGGGGAGAAAAAGGGAGGACGG - Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980113645 4:128658720-128658742 GAAGGGAGAAGGAGGGGAGAAGG + Intergenic
980113651 4:128658738-128658760 GAAGGGAGAAGGAGGGGAGAAGG + Intergenic
981280938 4:142957799-142957821 CAGAGGAGATGGAGGGCGGATGG - Intergenic
981344077 4:143655008-143655030 GTGTGGAAATGGAGGATGGAGGG - Intronic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
981694454 4:147546156-147546178 GTGTGGAGAAGGGGGGAGAAAGG - Intergenic
981814006 4:148807660-148807682 GGAAGGGGAAGGAGGGTGGAAGG + Intergenic
981950482 4:150400612-150400634 GGGAGGACAAGGAGGGAGGATGG + Intronic
982117055 4:152106624-152106646 GAATGGACATGGAGGATGGATGG - Intergenic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
982415260 4:155123885-155123907 GAGAGGAGATAGAGGATGGATGG - Intergenic
983457038 4:167978139-167978161 GATTGTAGAAGGTGGGAGGAGGG + Intergenic
983534162 4:168839575-168839597 GAGGGGTGAGGGAGGGGGGATGG + Intronic
983595130 4:169457700-169457722 GAGGGGAGAAGGAGGGGAGAGGG + Intronic
983603295 4:169554652-169554674 GAGTTGGGAGGGAGGTTGGAGGG + Intronic
983613098 4:169671748-169671770 GTGTGGGGAAGGTGTGTGGAGGG + Intronic
984559954 4:181256563-181256585 GAGTGGAGAAGGGTGGGGAAAGG - Intergenic
984703742 4:182833885-182833907 GAGAGGAGAAGGAGGAGGGGAGG - Intergenic
984720791 4:182970844-182970866 GAGTGGGGATGTAGGGAGGAAGG + Intergenic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
985100062 4:186450070-186450092 GACTGGAGAAGGAGTCTGGCGGG - Intronic
985211864 4:187604074-187604096 GAGGGGAGGAGGAGAGGGGAGGG - Intergenic
985324145 4:188748704-188748726 GAGGGGGGAAGGTGGGAGGAGGG - Intergenic
985747380 5:1654952-1654974 GGGTGGAGTTGCAGGGTGGATGG - Intergenic
985933479 5:3077713-3077735 GAGTGGGAAAGGAGGGAGGCTGG + Intergenic
985938899 5:3118479-3118501 AACTGCAGAAGGAGGGTGGAGGG - Intergenic
986004029 5:3652607-3652629 GGGGTGACAAGGAGGGTGGAGGG + Intergenic
986193393 5:5516832-5516854 GAGGAGAAATGGAGGGTGGAAGG - Intergenic
986240350 5:5954881-5954903 GAGGGAAGGAGAAGGGTGGAAGG - Intergenic
986240372 5:5954947-5954969 GAGGGAAGGAGAAGGGTGGAAGG - Intergenic
986313344 5:6571044-6571066 GAGGAGAGAAGGAGGGAGGGAGG + Intergenic
986313408 5:6571227-6571249 GAGGAGAGAAGGAGGGAGGGAGG + Intergenic
986313432 5:6571297-6571319 GAGGAGAGAAGGAGGGAGGGAGG + Intergenic
986313453 5:6571363-6571385 GAGGAGAGAAGGAGGGAGGGAGG + Intergenic
986313513 5:6571534-6571556 GAGGAGAGAAGGAGGGAGGGAGG + Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
986636479 5:9827154-9827176 GACTGGAGGAGGAAGGAGGAAGG - Intergenic
987133294 5:14879106-14879128 TACAGGAGAAGGAGGGTGAAAGG - Intergenic
987445379 5:18011260-18011282 GTGAAGAGAAGAAGGGTGGATGG - Intergenic
987702985 5:21425960-21425982 GAGTGGGGAGGGTGGGAGGAAGG - Intergenic
988444942 5:31275345-31275367 GAGTGGGGAGGGAGGTGGGAGGG - Intronic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
989122050 5:38014719-38014741 GAAAGGAGAAGGAAGGTGCAAGG - Intergenic
989200763 5:38760594-38760616 GAGCGGAGAGGGAGAGAGGAAGG + Intergenic
989664049 5:43832024-43832046 AAGTGGGGTAGGTGGGTGGATGG - Intergenic
990275522 5:54191957-54191979 GAGTGGGGGAGGAAGGAGGAAGG - Intronic
990382725 5:55232586-55232608 GGGTGGAGAGGGACTGTGGAAGG + Intronic
990460126 5:56023816-56023838 AAGTACAGAAGGAAGGTGGAGGG + Intergenic
990528536 5:56651983-56652005 GAGTAGAGAAGGAGGGAGAAGGG + Intergenic
990634025 5:57703371-57703393 GAGGAGAGAGGGAGGGTGGAAGG - Intergenic
990762023 5:59140052-59140074 GAGAGGAGTAGGATTGTGGAAGG + Intronic
990782254 5:59378280-59378302 GAGGGTAGAAGGTGGGAGGAGGG + Intronic
990849695 5:60188594-60188616 GAGTGGAGATGGAGGGGAAATGG + Intronic
991216325 5:64160523-64160545 GTCTGGAGATGGAGGCTGGATGG - Intergenic
991408096 5:66321061-66321083 GAGGGGAGGATGAGGGGGGAAGG + Intergenic
991483001 5:67103509-67103531 GAGGGGAGGAGGAGGGAGGAAGG + Intronic
991643507 5:68777516-68777538 GAGGGGAGGAGGAGGGAGAAAGG - Intergenic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
991964860 5:72080701-72080723 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
991977654 5:72198919-72198941 GCCTGGAGAAGGACAGTGGAGGG + Exonic
992621114 5:78593892-78593914 GAGGCAAGAAGGAGGGGGGATGG + Intronic
993467785 5:88269152-88269174 GAGGGGAGAGGGAGGGGGGCGGG + Intronic
993499661 5:88651115-88651137 GCTAGAAGAAGGAGGGTGGAAGG - Intergenic
994608160 5:101997549-101997571 GAGTTGGGAAGGAGGGAGGGAGG - Intergenic
994626796 5:102230190-102230212 GGGTGGAGCAGGAGGGTGGAAGG + Intergenic
995123785 5:108560124-108560146 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
996017468 5:118556662-118556684 GAGGGCAAAAGGAGGGCGGAAGG - Intergenic
996038805 5:118787721-118787743 CAGTGTGGAAGGAGGGTGGTTGG + Intergenic
996652369 5:125895271-125895293 GAGTGAAGGAAAAGGGTGGAAGG + Intergenic
996810109 5:127506951-127506973 GGTGGGAGCAGGAGGGTGGAGGG + Intergenic
997454714 5:134007926-134007948 GGGTGGAGAAGGAGGTTTGTGGG + Intergenic
997677057 5:135720776-135720798 GAGTGGAGCAGGGTGGTGTAGGG + Intergenic
997820501 5:137061741-137061763 GAGTGGAGGGGGCGGGTGGGAGG + Intronic
998124239 5:139605685-139605707 GAGGGGAGGAGGAGGGGGAAAGG - Intronic
998127004 5:139631038-139631060 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
998227196 5:140336156-140336178 TAGAGGAGAAGGATGGAGGATGG - Intronic
998398268 5:141833735-141833757 GAGGAGTGAAGGAGGGAGGAAGG + Intergenic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
998470328 5:142378746-142378768 GAGTGAAGATGGAATGTGGAGGG - Intergenic
998490161 5:142539587-142539609 AAGAGGAGAAGGAGGAGGGAGGG - Intergenic
998548799 5:143056341-143056363 GAGGGGAGGAGGATGTTGGAGGG + Intronic
998595669 5:143527328-143527350 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
998804058 5:145901146-145901168 GAGGGGGGAAGGAGGGAGGGGGG + Intergenic
998892102 5:146757172-146757194 GAGTGGAGAGGGAGGGAGGTAGG + Intronic
998985921 5:147756639-147756661 GAGAAGAAAAGGAGGGTGGATGG + Intronic
999210215 5:149881812-149881834 GGGAGGCCAAGGAGGGTGGATGG + Intronic
999275124 5:150325099-150325121 GAGTGGGGAGGGAGGGAGAAAGG + Intronic
999279503 5:150355725-150355747 GAGTGTAGAAGGTGGGCAGAGGG - Intergenic
999449703 5:151668791-151668813 GAGTAGAAAAGGAGGGTTGGGGG - Intronic
999659604 5:153846495-153846517 GATTGGAGAGGGAGAGCGGAAGG - Intergenic
999729049 5:154462059-154462081 GAGAGGAGAAGGATGTGGGAAGG - Intergenic
999889372 5:155960141-155960163 AAGAGGAGAAGGAAGATGGAAGG - Intronic
1000193749 5:158938329-158938351 GAGGGGAGGAGGGGGGTGAAAGG - Intronic
1000731435 5:164838786-164838808 GAATGAAGAGGGAGGGGGGAAGG - Intergenic
1000990151 5:167903529-167903551 GGGTGGGGGTGGAGGGTGGAAGG + Intronic
1001210173 5:169803681-169803703 GTGTGGAGTAGGATGGTGGTAGG + Intronic
1001254150 5:170170936-170170958 GAGAGGAGAGGGAGGGAGAATGG - Intergenic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001624301 5:173117626-173117648 GAGGAGAGAAGGAGGGAGGGAGG - Intronic
1001866108 5:175106953-175106975 GAGTGGACATGGTGGGTAGAGGG - Intergenic
1001897175 5:175392598-175392620 TAGTGGAGAAAGGGGATGGAAGG - Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1002042882 5:176527619-176527641 GCGAGGAGAACGAGGGTGGTTGG + Exonic
1002058534 5:176612469-176612491 CAGTGGAGAAGCGGGGTGGAAGG + Intergenic
1002255430 5:177954769-177954791 GAGGGGGGAGGGAGGGAGGAGGG + Intergenic
1002435347 5:179227873-179227895 GAGCCAGGAAGGAGGGTGGAAGG + Intronic
1002490032 5:179569234-179569256 GGGTGGGGAAGGAGTGGGGATGG + Intronic
1002888926 6:1317285-1317307 GAGAGGAGCAGGCGGGGGGAGGG - Intergenic
1003060414 6:2858281-2858303 GAAGGGAGAAACAGGGTGGAAGG - Intergenic
1003153134 6:3569912-3569934 GAGGGGAGAGGGAGGGAGGATGG - Intergenic
1003406352 6:5829922-5829944 GAATGGAGAAGGGGGATTGAAGG + Intergenic
1003848510 6:10198379-10198401 AAATGGAGAAAGTGGGTGGAAGG - Intronic
1004002070 6:11604864-11604886 GAGAGGAGAAGGGGGGTAGGGGG + Intergenic
1004225613 6:13781879-13781901 GAGAGGCCAAGGTGGGTGGATGG - Intergenic
1004335585 6:14761660-14761682 GAGGGGGGAAGGTGGGAGGAGGG + Intergenic
1004571551 6:16850551-16850573 GGGGGCAGATGGAGGGTGGAGGG - Intergenic
1004607279 6:17206432-17206454 GAGGGGGGAGGGAGGGTGCAGGG + Intergenic
1004751445 6:18566048-18566070 GAAGGAAGAAGGAGGGAGGAAGG - Intergenic
1004942765 6:20578332-20578354 GAAGGGAAAAGGAGGGTTGATGG - Intronic
1005425864 6:25701876-25701898 TGGTGGAGAAGGAGAGTGAAGGG + Intergenic
1005429719 6:25742418-25742440 GAGAGGTCAAGGAGGGAGGATGG + Intergenic
1005535248 6:26749017-26749039 GAGTGGAAAAGAAGGAAGGATGG + Intergenic
1005826274 6:29633137-29633159 GAGGGAAGAAGGAGGGTGCAAGG + Exonic
1006320708 6:33317742-33317764 GAGCGGAGGCGGAGGGCGGAGGG - Intronic
1006371923 6:33650142-33650164 GCAGAGAGAAGGAGGGTGGATGG - Intronic
1006522288 6:34578014-34578036 GAGTGTACAGGAAGGGTGGAGGG + Intergenic
1006798319 6:36744530-36744552 GAGGAGAGAGGGAGGGTGGCAGG + Intronic
1007378028 6:41469559-41469581 GAGGGGTGAGGGAGGCTGGAAGG + Intergenic
1007409865 6:41655252-41655274 GCGTGGAGATGGAGTGGGGAGGG - Intergenic
1007476131 6:42121354-42121376 GAGTTGAGAAGGAGGAAGAAAGG + Intronic
1007521032 6:42452050-42452072 GAGCGGATAAGGAGGGTTAAGGG - Intronic
1007610498 6:43145863-43145885 GAGAGGAGAAGGCTGGTGGCTGG - Intronic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1007927823 6:45663895-45663917 GAGCGGAGGAGGAGGGTGTGAGG - Intronic
1007934441 6:45720741-45720763 GATTGGACATGGAGGGTGGCAGG - Intergenic
1008081558 6:47200086-47200108 GAGTGGGGAAGGAGGGAGTGGGG - Intergenic
1008395414 6:51000884-51000906 AAGTGGAGAAGGAGGGACAAAGG - Intergenic
1008449058 6:51628219-51628241 GAGTGGGGAAGGTGGGAGGGGGG - Intronic
1008920934 6:56843696-56843718 GAGGGAGGGAGGAGGGTGGAGGG + Intronic
1008998642 6:57688160-57688182 GACTGGAGCAGGAGGAAGGAAGG + Intergenic
1009006287 6:57792651-57792673 GAGTGGAAAAGAAGGGAGGATGG + Intergenic
1009008269 6:57813308-57813330 GAGTGGAAAAGATGGGAGGATGG + Intergenic
1009060455 6:58392287-58392309 GAAGGGAGAAGGAGGGTGGTGGG + Intergenic
1009187128 6:60587539-60587561 GACTGGAGCAGGAGGAAGGAAGG + Intergenic
1009230456 6:61055047-61055069 GAAGGGAGAAGGAGGGTGGTGGG - Intergenic
1009284429 6:61798010-61798032 GAGAGGAGAAGGTGGGAGGAGGG - Intronic
1009835901 6:69001491-69001513 GAGTAGAGAAAGAGTGGGGAAGG + Intronic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1010131347 6:72497364-72497386 AACTGGAGTCGGAGGGTGGAGGG - Intergenic
1010252612 6:73723741-73723763 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1010259506 6:73798971-73798993 GAGAGGAGAAGGAGAGGAGAGGG - Intronic
1010507219 6:76675401-76675423 GAGGGTAGAGGGAGGGAGGAGGG - Intergenic
1010704367 6:79090021-79090043 GAGGGGGGAAGAAGGGAGGAAGG - Intergenic
1011371078 6:86637177-86637199 GAATTGACAATGAGGGTGGAAGG + Intergenic
1011501067 6:87990677-87990699 AAGTAGAGAAGTAGGCTGGAGGG + Intergenic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1011628156 6:89299990-89300012 CAGGGGAGAAGGAGGGCTGAAGG + Intronic
1011632362 6:89339597-89339619 GAGGGGGGAAGGAGAGGGGAGGG + Intronic
1012183492 6:96185048-96185070 GAGTGGGGAAGGAAGGTTGGTGG - Intronic
1012222335 6:96664120-96664142 GAGAAGAGAGGGAGGGTGGGGGG + Intergenic
1012398282 6:98824505-98824527 AAGTGGAGAGGGAGCGTGGGAGG + Intergenic
1012427637 6:99131762-99131784 GAGGGCAGAGGAAGGGTGGATGG - Intergenic
1012813101 6:103985888-103985910 AAGTTAAGCAGGAGGGTGGAAGG - Intergenic
1013253876 6:108363365-108363387 GAGTGTAGAGGGTGGGAGGAGGG - Intronic
1013491222 6:110647375-110647397 GAGTTGTGAAGGGGGGTGGGGGG + Intronic
1013819227 6:114135054-114135076 GATTGGTGAACCAGGGTGGAAGG + Intronic
1014214388 6:118738726-118738748 GAGTGGAGGAGGAGGGGGAAAGG - Intergenic
1014416423 6:121190312-121190334 GAGAGGAGGAGGAGGGAGCATGG - Intronic
1014838183 6:126183824-126183846 ACGTGGGGAAGGAGGGTGGGAGG + Intergenic
1015715940 6:136191886-136191908 GAGGGCAGAAGCAGCGTGGAGGG + Exonic
1015821954 6:137270917-137270939 GAGGGGGGAAGGTGGGAGGAGGG + Intergenic
1016132016 6:140485697-140485719 AAGTGGAGAGGGAAGGTGGAAGG - Intergenic
1016261936 6:142182331-142182353 GAGATGAGAATGAGGGTGGTGGG + Intronic
1016548411 6:145249482-145249504 CAGTGGAGGATGAGGGTGGTAGG - Intergenic
1016764679 6:147778696-147778718 GAATGGAGAGGGAGGGAGCAGGG - Intergenic
1016798434 6:148143120-148143142 GGCTGGGGAAGGAGGATGGAGGG + Intergenic
1016830095 6:148425687-148425709 GAGGGGAGAAGGGGAGGGGAGGG - Intronic
1016863722 6:148746892-148746914 GAGCGGAGAGGGAGGGGAGAGGG + Intergenic
1017032725 6:150238376-150238398 GAGAGGAGAGGGTGGGAGGAAGG + Intronic
1017293255 6:152765634-152765656 GAGAGGGGAAGGAGAGGGGAGGG - Intergenic
1017637303 6:156456075-156456097 GAGTGGAGGAGGGGGGAGGAGGG - Intergenic
1017646412 6:156543492-156543514 GAGAGGAGGAGGAGGAGGGACGG - Intergenic
1017652078 6:156593141-156593163 GAGGGGAGAAGAGGGGAGGAGGG + Intergenic
1017931910 6:158963402-158963424 GAAGGGGGAAGGAGGGGGGAGGG - Intergenic
1018063182 6:160106227-160106249 GCGTGGAGGAGGAGGGAGGCCGG + Exonic
1018429728 6:163713482-163713504 GAGAGGAGAAGGTGGGGGTAGGG - Intergenic
1018816811 6:167339002-167339024 GAGTAGAAAAGGAGGAAGGAGGG - Intronic
1018844710 6:167547513-167547535 GGGTGAAGAAGGAGGAGGGATGG - Intergenic
1018921294 6:168177704-168177726 GCGTGGGGAAGGAGGCAGGAGGG - Intergenic
1018956746 6:168415506-168415528 GAAGGGGGAATGAGGGTGGAGGG + Intergenic
1019191624 6:170254497-170254519 GACCGGCGATGGAGGGTGGAGGG + Intergenic
1019224569 6:170499645-170499667 GCGTGGAGAGGGAGCGAGGAAGG + Intergenic
1019323597 7:426469-426491 GAGTGTTGGTGGAGGGTGGAGGG - Intergenic
1019438579 7:1034766-1034788 AGGAGGAAAAGGAGGGTGGAGGG - Intronic
1019472534 7:1229035-1229057 GAGTAGAGAAGGAGGTGGGGGGG - Intergenic
1019517552 7:1446535-1446557 GAGGGGAGGAGGCGGGAGGAGGG + Intronic
1019576395 7:1739681-1739703 GAGTGGAGAGGGCGGCAGGAGGG + Intronic
1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG + Intronic
1019709389 7:2511386-2511408 GAGTGAGGCAGGAGGCTGGAGGG - Intergenic
1019830296 7:3321737-3321759 GGGAGGGGAAGGAGGGGGGAGGG - Intronic
1019920035 7:4157514-4157536 GAGCGGGGAGGGAGGGAGGAAGG + Intronic
1019935019 7:4249124-4249146 GATAGGGGAAGAAGGGTGGAGGG + Intronic
1020011488 7:4807998-4808020 GAGAGGAGAGGGAGGAGGGAGGG - Intronic
1020852113 7:13367495-13367517 GAGGGGAGAAGGTGGGAGGGAGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021451364 7:20785806-20785828 GAGAGGAGAAGGAGTGGGGGAGG + Intronic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021734149 7:23626649-23626671 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1021797224 7:24268461-24268483 GAGTGGAGAAAGAGGCAAGAAGG - Intergenic
1021912232 7:25397555-25397577 GTTTGGTGAAGGAAGGTGGAGGG - Intergenic
1022470886 7:30681442-30681464 GAGGGGAGGAGGAGGGTAGGAGG - Intronic
1022473496 7:30695529-30695551 GACTGGAGTAGGAGGGGGAAGGG + Intronic
1022703756 7:32784556-32784578 GAATGGTGAATGAGGGAGGAAGG + Intergenic
1022795351 7:33727433-33727455 GAGTGAAGGAGGGGGGTGGGGGG + Intronic
1022907997 7:34874682-34874704 GAATGGTGAATGAGGGAGGAAGG + Intronic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023156374 7:37256509-37256531 GGGAGGAGAAGGAGGAAGGAAGG + Intronic
1023191214 7:37585056-37585078 TAGTGGAGAAGGAAGTTGCAAGG + Intergenic
1023337122 7:39181810-39181832 GAGAAGAGAATGAGTGTGGATGG - Intronic
1023354041 7:39349543-39349565 GGGTGGAGAATGAGGGTGCCAGG - Intronic
1023504887 7:40889078-40889100 GAATGGGGCAGGAGGGTGGTAGG + Intergenic
1023558042 7:41443643-41443665 CAGTGAGGAAGGAGGGTGGTGGG + Intergenic
1023736059 7:43237060-43237082 GGGAGGAGAAGGAGGGAGGGAGG + Intronic
1023743321 7:43300478-43300500 GAGGGTGGAAGAAGGGTGGAAGG + Intronic
1023869531 7:44255585-44255607 CAGTGGAGCAGGCGGGGGGATGG - Intronic
1024024826 7:45401196-45401218 CAGTGCAGGAGGATGGTGGAGGG + Intergenic
1024159891 7:46663427-46663449 GAGTGGGGAAGGGGAGTGGAAGG - Intergenic
1024404601 7:48963612-48963634 AAGTGGAAAAAGAGGCTGGAGGG - Intergenic
1024573765 7:50747525-50747547 AAATGGAGAAGCGGGGTGGAGGG - Intronic
1024597631 7:50953517-50953539 CAGTGGAGAAGAATGGTGCAGGG + Intergenic
1024997980 7:55289280-55289302 GAGGGGAGAGGGAGAGGGGATGG - Intergenic
1025709024 7:63890868-63890890 GAGAGGAGGAGGAGGGCTGAAGG + Intergenic
1025945150 7:66099389-66099411 GAGAGGAGAAGGAGGGGAGGAGG + Intronic
1026011880 7:66642809-66642831 GAGTGGGGAAGGATGGGGGTTGG + Exonic
1026078930 7:67199930-67199952 GAGAAGAGAGGGAGGGAGGATGG + Intronic
1026112096 7:67466440-67466462 GAGAGAAGAAGGAGGGAGGGAGG - Intergenic
1026205668 7:68255317-68255339 GAGGGGAGAAGGAGGAGGGGAGG - Intergenic
1026591724 7:71702128-71702150 GAGTAGAGAGAGAGGGAGGAGGG + Intronic
1026697890 7:72612009-72612031 GAGAAGAGAGGGAGGGAGGATGG - Intronic
1026762580 7:73137801-73137823 GAGAGGAGAAGGGGAGGGGAAGG + Intergenic
1026762588 7:73137823-73137845 GAGAGGAGAAGGGGAGGGGAAGG + Intergenic
1026762596 7:73137845-73137867 GAGAGGAGAAGGGGAGGGGAAGG + Intergenic
1026762604 7:73137867-73137889 GAGAGGAGAAGGGGAGGGGAAGG + Intergenic
1026776035 7:73231638-73231660 GGATGGAGCAGGAGGGTGGAGGG + Intergenic
1026814688 7:73501368-73501390 GACTACAGAAGGAGGGAGGATGG - Intronic
1026955054 7:74371755-74371777 GGGAGGAGAAGGAGAGAGGAGGG + Intronic
1027016892 7:74785009-74785031 GGATGGAGCAGGAGGGTGGAGGG + Intronic
1027039043 7:74947577-74947599 GAGAGGAGAAGGGGAGGGGAAGG + Intergenic
1027039051 7:74947599-74947621 GAGAGGAGAAGGGGAGGGGAAGG + Intergenic
1027039059 7:74947621-74947643 GAGAGGAGAAGGGGAGGGGAAGG + Intergenic
1027039067 7:74947643-74947665 GAGAGGAGAAGGGGAGGGGAAGG + Intergenic
1027053151 7:75032219-75032241 GAGTGGGGACGGTGGGGGGAAGG + Intronic
1027071135 7:75160927-75160949 GGATGGAGCAGGAGGGTGGAGGG - Intergenic
1027084584 7:75254745-75254767 GAGAGGAGAAGGGGAGGGGAAGG - Intergenic
1027084592 7:75254767-75254789 GAGAGGAGAAGGGGAGGGGAAGG - Intergenic
1027084610 7:75254811-75254833 GAGAGGAGAAGGGGAGGGGAAGG - Intergenic
1027084618 7:75254833-75254855 GAGAGGAGAAGGGGAGGGGAAGG - Intergenic
1027084626 7:75254855-75254877 GAGAGGAGAAGGGGAGGGGAAGG - Intergenic
1027084634 7:75254877-75254899 GAGAGGAGAAGGGGAGGGGAAGG - Intergenic
1027217626 7:76194196-76194218 GAGAAGAGAAGGAGGCTGCATGG + Intergenic
1027372888 7:77525213-77525235 GAATGAAGAAGCAGGGTGTAGGG + Intergenic
1027389643 7:77692172-77692194 AGGTGGAGAAGCAGGGTGTAGGG + Intergenic
1027397178 7:77767845-77767867 GAAAGGAGAGGGAGGGGGGAGGG - Intronic
1027605567 7:80294307-80294329 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1027754139 7:82189017-82189039 GAGTGTAGAGGGCGGGAGGAGGG + Intronic
1027941781 7:84691479-84691501 GAGTGGAGAAGGAGGGAGAATGG - Intergenic
1028051537 7:86193946-86193968 GTGAAGAGAAGGAGGGAGGAAGG + Intergenic
1028067536 7:86406070-86406092 GAATGTAGAAGGTGGGAGGAGGG + Intergenic
1028143971 7:87301129-87301151 GAGTGTAGAGGGAAGGAGGAAGG + Intergenic
1028913400 7:96232441-96232463 GAGGGTAGAAGGTGGGAGGAGGG + Intronic
1029067978 7:97871808-97871830 GAGGGGAGGAGGAGGGTGAGCGG + Exonic
1029123917 7:98284826-98284848 GGGTGAAGCAGGAGGGTGGGAGG - Intronic
1029232376 7:99081092-99081114 GAGTGGAGAAGGATGGCGCAGGG + Intronic
1029480550 7:100809872-100809894 GGGAGGCCAAGGAGGGTGGATGG + Intronic
1029548341 7:101223025-101223047 GATTGGAGAATTGGGGTGGAGGG + Intronic
1029595953 7:101537788-101537810 GGGTGGAGGAGGAGGGAGCAGGG - Intronic
1029620610 7:101688078-101688100 GAGTGCAGCAGGGGGGTGGCGGG - Intergenic
1029634188 7:101772972-101772994 GAGTGGAGACAGATGATGGACGG + Intergenic
1029746099 7:102516612-102516634 GCCTGGAGGAGGAGGGTGGGAGG - Intronic
1029764037 7:102615591-102615613 GCCTGGAGGAGGAGGGTGGGAGG - Intronic
1029942262 7:104492876-104492898 GAGTGGCAATGGATGGTGGAAGG - Intronic
1030161980 7:106518495-106518517 GAGTAGAGGAGGGGAGTGGAGGG - Intergenic
1030305727 7:108017402-108017424 GAGAGAAGAAACAGGGTGGAGGG + Intergenic
1030566048 7:111157581-111157603 TATTGGAGAAGGAGTGGGGATGG + Intronic
1031068509 7:117135095-117135117 CAGTGGGGAAGGAGAGTGAAAGG + Intronic
1031077320 7:117225468-117225490 GTGTGGGGAAGGAAGATGGATGG + Intronic
1031329787 7:120450450-120450472 GAGTGGAAAAGGAGAGGGGATGG + Intronic
1031422836 7:121569829-121569851 GAGTGGGGAAAGAGGTTGGAGGG - Intergenic
1031556444 7:123182466-123182488 CAGTGGAGGAAGTGGGTGGAGGG - Intronic
1031562837 7:123258749-123258771 GAGAGGAGAATGAGGGAAGAAGG + Intergenic
1031667574 7:124503803-124503825 GAGAGGAGATGGGGGGTGGGTGG + Intergenic
1031999280 7:128254275-128254297 AAGTGGTGAGGGAGGGTGGAAGG + Intronic
1032056496 7:128688784-128688806 GTGGGGAGAGGGAGGGGGGAGGG - Intergenic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032447666 7:131998627-131998649 GCATGGAGAAGGAGAGGGGAGGG + Intergenic
1032625003 7:133582118-133582140 GAGGGTAGAGGGAGGGAGGAAGG - Intronic
1033225621 7:139559938-139559960 TAGGGGAAAAGGTGGGTGGAGGG + Intergenic
1033573768 7:142659659-142659681 GATGGGAGAAGGAGGGAGCAGGG - Intergenic
1033802776 7:144920350-144920372 GAGGGGAGGGGGAGGGGGGAGGG + Intergenic
1033856956 7:145574589-145574611 GCTTGGTGAAGGAGGGTTGAGGG - Intergenic
1033885600 7:145941170-145941192 GAGGGGAACAGCAGGGTGGAGGG - Intergenic
1034014401 7:147566365-147566387 AAGGGGAGAAGGGGGGTGGGGGG + Intronic
1034117474 7:148596791-148596813 GAGTGGGGAAGGAGGAAGGGAGG - Intronic
1034252438 7:149703154-149703176 GAGGGAAGATGGAGTGTGGATGG + Intergenic
1034263890 7:149772484-149772506 GAGGGGAGACGGAGTGGGGAGGG - Intronic
1034275920 7:149823844-149823866 GAGTGGTGAGTGATGGTGGAAGG + Intergenic
1034281818 7:149859847-149859869 CACTGGAGAAGGAGGGAGAAGGG - Intronic
1034350801 7:150413616-150413638 GAGATGAGAAGATGGGTGGATGG + Intergenic
1034757391 7:153635534-153635556 GAGGGGGGAGGGAGGGGGGAGGG - Intergenic
1035056268 7:156038832-156038854 GGGTGGAGGTGGAGGCTGGAGGG + Intergenic
1035249175 7:157585748-157585770 GAGGGGAGGAGGAGTGGGGATGG + Intronic
1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035574331 8:695478-695500 GAGAGGAGAGGGAGGGAGGCGGG - Intronic
1035732058 8:1860318-1860340 GAGAGGAGGAGGAGGGGGGAAGG - Intronic
1035732080 8:1860385-1860407 GAGAGGAGGAGGAGGGGGGAAGG - Intronic
1035776256 8:2191160-2191182 GAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1035994883 8:4534579-4534601 GAATGGGGAAAGAGGGAGGAGGG - Intronic
1036135853 8:6160976-6160998 GAGGGGAGCAGGAGGTGGGAGGG - Intergenic
1036206061 8:6806383-6806405 GGGTGGGGATGGAGGGTGGTTGG + Intergenic
1036217104 8:6889883-6889905 GAGGGGAGGGGGAGGGGGGATGG - Intergenic
1036282156 8:7409527-7409549 GAGTGGAGCGAGAGGGTGCAAGG - Intergenic
1036339312 8:7902044-7902066 GAGTGGAGCGAGAGGGTGCAAGG + Intergenic
1036661240 8:10710482-10710504 GACTGCAGAAGGAGATTGGAAGG + Intronic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1036756500 8:11474807-11474829 GAGAGGAAAAGGAGGGGGTAAGG + Intergenic
1036776766 8:11618016-11618038 GAGTTGGGAAGGAAGGTGTAGGG + Intergenic
1036939668 8:13039400-13039422 GCATGGAGAAGAAGGCTGGAAGG - Intergenic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1036975387 8:13405287-13405309 GAGGGGAGAAGGAGGGAGGGAGG - Intronic
1037098021 8:15008717-15008739 GAGGGGAGGAGGGGGGAGGAGGG + Intronic
1037157917 8:15728447-15728469 GTGTGGAGAGGGAGGGAGGGAGG + Intronic
1037169413 8:15873908-15873930 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1037568863 8:20141622-20141644 GGGAGGAGGAGGAGGGGGGAGGG + Intergenic
1037584736 8:20268691-20268713 GAGTGGAGGAGGAAGGGGGTGGG + Intronic
1037752841 8:21693781-21693803 GAGAGGGGAAGGAGAGAGGAAGG + Intronic
1037767432 8:21780767-21780789 GAGAGGAGAAGGGGAGGGGAGGG - Intronic
1037838535 8:22228536-22228558 GGCTGGAGAAGGATGATGGAGGG + Intronic
1037886586 8:22599213-22599235 GAGGGGAGAGGGAGGGGAGAGGG - Intronic
1037903571 8:22702519-22702541 GAGAGGAGAGGAAGGGTGGGGGG + Intergenic
1038150948 8:24942114-24942136 GGGAGGAGGAGGAGGGAGGAGGG - Intergenic
1038311561 8:26449485-26449507 GAGTGGAGAGGGAGGTTGTAGGG + Intronic
1038531341 8:28320288-28320310 GAATGGGGAAGGAGGGTGGGGGG - Intronic
1038542609 8:28402211-28402233 GAGGGGAGGAGGAGGGAGGGAGG + Intronic
1038650848 8:29401998-29402020 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1038659675 8:29486330-29486352 GAGTGGAGAAGGATGGAGAATGG + Intergenic
1038934764 8:32236732-32236754 GAGAGGAGAAAGAGGCAGGAAGG + Intronic
1038949779 8:32401733-32401755 GAGGGCAGAAGGTGGGAGGAGGG + Intronic
1039044420 8:33436904-33436926 GAGGGGAGAAGGAGGGAGGGGGG - Intronic
1039133078 8:34289949-34289971 GAGTGCAGAGGGAGGGAGGTGGG + Intergenic
1039172957 8:34769498-34769520 GAGAGGAGAAGGGGGGAGAAAGG - Intergenic
1039436267 8:37561371-37561393 GGGAGGAGAAAGAGGGTGGGGGG + Intergenic
1039586917 8:38714549-38714571 GAGTGAAGAAGGAGCCTTGAGGG - Intergenic
1040500718 8:48002620-48002642 GAGAGGAGAAGGGGAGGGGAGGG + Intergenic
1040629260 8:49190797-49190819 GAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1040681918 8:49820776-49820798 GAAGGGAGACGGAGGGAGGAAGG + Intergenic
1040823853 8:51596042-51596064 GAGTGGAGAGGAAGGGAGGGTGG - Intronic
1040917213 8:52574557-52574579 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
1040993561 8:53378305-53378327 GAGAGGAGAAAGAGAGTGGCAGG - Intergenic
1041421476 8:57671717-57671739 GGGTGGAGAAGCAGCTTGGAGGG + Intergenic
1041514861 8:58689464-58689486 GAGAGGAAAAGGAGGGGTGAGGG - Intergenic
1041846154 8:62331126-62331148 GGGTGGAAGAGGAGGGAGGAAGG - Intronic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042523020 8:69734248-69734270 TAGTGGCAAAGGAGGGTGGAGGG - Intronic
1042564573 8:70099074-70099096 GAGGGGAGAAGGAGGGAGGGGGG + Intergenic
1042576041 8:70219671-70219693 AAGGGCAGGAGGAGGGTGGAGGG + Intronic
1042637755 8:70897004-70897026 GGGTGAAGAAGAAGGGGGGATGG - Intergenic
1042654213 8:71077777-71077799 GTGAGGAGAAGGAGGGTCTAGGG + Intergenic
1043260497 8:78188519-78188541 GAGGGGAGAAGGAGAAGGGAAGG + Intergenic
1043336605 8:79183697-79183719 AAGTGGAGAAAGAGAGTAGAGGG - Intergenic
1043918685 8:85955259-85955281 GAGTGGAGAAGGAGGGAGGGGGG + Intergenic
1043924970 8:86026472-86026494 GAGTGCAGAAGGAGAGTGAGTGG - Intronic
1044065870 8:87699643-87699665 GGGTGGAAAAGGGGAGTGGATGG - Intergenic
1044119951 8:88382473-88382495 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1044462240 8:92458827-92458849 GAGGGTAAAAGGTGGGTGGATGG + Intergenic
1044720361 8:95139713-95139735 AACTGGAGAAAGGGGGTGGAGGG - Intronic
1045007556 8:97929413-97929435 GAGTAGAGAATGGGGGAGGAGGG + Intronic
1045636878 8:104201122-104201144 GAGGGGAGAGGGTGGGAGGAGGG - Intronic
1045813257 8:106249343-106249365 GAGGGGAGAGGGTGGGAGGAGGG + Intergenic
1046048198 8:108987982-108988004 GAGGGTAGAGGGAGGGAGGAGGG + Intergenic
1046166405 8:110442145-110442167 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
1046719974 8:117608420-117608442 GAGGGGGGAAGGAGGAAGGAAGG - Intergenic
1047300766 8:123612089-123612111 GAGGGGAGGGGGAGGGGGGAAGG - Intergenic
1047329013 8:123868107-123868129 GAGGGGAGAAGGAGCGGGGAAGG - Intronic
1047551567 8:125878487-125878509 TAGTGGAGAGGGAGAGGGGAGGG + Intergenic
1047827043 8:128588113-128588135 GGGGGTGGAAGGAGGGTGGATGG - Intergenic
1047928599 8:129704405-129704427 GAGGAGAGAAGGAGGTAGGAAGG - Intergenic
1048260099 8:132937988-132938010 GAGTGGAGGAGGAGGGGAGGAGG + Intronic
1048294925 8:133206978-133207000 GAGTGGAGCAGGAAGGCGGGGGG + Intronic
1048314879 8:133354479-133354501 GAGTGGAGAAGCAGTTTGGCTGG - Intergenic
1048665296 8:136654649-136654671 GAGGGGAGAGGTAGGGAGGAAGG - Intergenic
1048690385 8:136955955-136955977 GAGAGGGGAGGGAGGGAGGAAGG - Intergenic
1048824340 8:138409249-138409271 GAGAGGAGAAAGATGGGGGAAGG + Intronic
1048837863 8:138538310-138538332 GAGTGGAGAAGAAGGAAGGAAGG + Intergenic
1048887872 8:138923112-138923134 GAGGGGAGAGGGAGGTTGGATGG + Intergenic
1049047204 8:140162220-140162242 GAGGGAAGAAGCAGGGTGGCAGG - Intronic
1049083134 8:140457917-140457939 GGGAGGAGGAGGAGGGAGGAGGG + Intronic
1049096604 8:140551864-140551886 GGGTGGATAAGGTGGGTGGGTGG + Intronic
1049253577 8:141602329-141602351 GAGAGGAGGAGGAGGGAGGGAGG + Intergenic
1049306578 8:141907211-141907233 GCGTGGAGGAGGAGAGGGGAGGG + Intergenic
1049343946 8:142128583-142128605 GAAAAGAGCAGGAGGGTGGATGG + Intergenic
1049708640 8:144053976-144053998 GAGTGGAGAGCGAGGGCGGGGGG - Intronic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050309627 9:4339810-4339832 GAGGGGAGGGGGAGGGGGGAGGG + Intronic
1050610437 9:7346867-7346889 GGATGGAGGAGGAGGATGGAAGG - Intergenic
1050794765 9:9524278-9524300 GACTGGAGAGGGAGGAAGGAAGG - Intronic
1051164754 9:14249686-14249708 GAGGGGAGAAGAAGAGAGGAAGG + Intronic
1051366739 9:16326631-16326653 CGGTGGGGAAGGAGGGTGGCTGG + Intergenic
1051387544 9:16525067-16525089 GAGTGGGGGAGGGGGGGGGAAGG + Intronic
1051853425 9:21535605-21535627 GAGGGAGAAAGGAGGGTGGAGGG + Intergenic
1052074749 9:24127396-24127418 AAGTGGAGGAGGAACGTGGAGGG + Intergenic
1052492244 9:29184714-29184736 GAAGGGAGAGGGAGGGAGGAGGG - Intergenic
1052989213 9:34508979-34509001 GAATGAATAAGGAGGGAGGAAGG - Intronic
1053329341 9:37188888-37188910 GAGGGGAGAAGGGAGGGGGAGGG - Intronic
1053411991 9:37921940-37921962 GCCTGGAGAAGGGGTGTGGAAGG + Intronic
1053674162 9:40405263-40405285 GAGTGCAGAAGTTGGGAGGAGGG + Intergenic
1053923965 9:43031632-43031654 GAGTGCAGAAGTTGGGAGGAGGG + Intergenic
1054385267 9:64545332-64545354 GAGTGCAGAAGTTGGGAGGAGGG + Intergenic
1054510461 9:65971027-65971049 GAGTGCAGAAGTTGGGAGGAGGG - Intergenic
1054770488 9:69078794-69078816 GAGTGGAGGAGGAGTTTGCAAGG - Intronic
1054821620 9:69527077-69527099 GAGTGGGGAAGGACAGAGGAGGG + Intronic
1054877167 9:70109023-70109045 GACTGGATAAGGAAGGAGGATGG + Intronic
1055139868 9:72864379-72864401 GGGTGGAGGAGGGGCGTGGAGGG - Intergenic
1055150933 9:72998746-72998768 CTGTGGAGAAAGAGGGTGTATGG - Intronic
1055276324 9:74621256-74621278 GAGTGGAGGAAGAGGATGAAGGG - Intronic
1055277944 9:74640873-74640895 TATTGGAGGAGGAGGGTGAATGG + Intronic
1055356993 9:75447936-75447958 GAGAAGAGAAGGAGGGAGGATGG - Intergenic
1055381323 9:75710098-75710120 GAGAGGAGAGGGAGGGAGGGAGG - Intergenic
1055505817 9:76948047-76948069 GGCTGGGGAAGGAGGGTGGATGG - Intergenic
1055600899 9:77917357-77917379 GAGGGCGGAAGGAGGGTGGGGGG + Intronic
1055652419 9:78419335-78419357 AAGTGGCAAAGGAGGATGGATGG + Intergenic
1055718584 9:79146163-79146185 GTGAGGAGAAGGTGGGTAGAGGG - Intergenic
1055829665 9:80363122-80363144 GAAGGGAGAGGGAGGGGGGAGGG - Intergenic
1055969442 9:81897156-81897178 GACTCCACAAGGAGGGTGGAAGG + Intergenic
1056253043 9:84770271-84770293 GAGTGGTGAAGGAGTATGAAAGG + Intronic
1056367273 9:85918259-85918281 GAGGGGAGAGGGAGGAAGGAAGG - Intergenic
1056531561 9:87492765-87492787 CAGTGGAGGGTGAGGGTGGAGGG - Intergenic
1056840796 9:89996662-89996684 GAGTGGGATGGGAGGGTGGAGGG + Intergenic
1056959993 9:91114752-91114774 GAGAAGAAAAGGAGGCTGGAGGG - Intergenic
1056965179 9:91159418-91159440 GAGGAGCGAAGGAGGGAGGAAGG + Intergenic
1056965190 9:91159467-91159489 GAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1057163695 9:92909556-92909578 GAGTGGAGAGGAAGTATGGAAGG - Intergenic
1057172562 9:92971948-92971970 GTGTGGGGGAGGGGGGTGGATGG - Intronic
1057236726 9:93367012-93367034 GAGAGGACAAGGGGGGTAGAAGG - Intergenic
1057901791 9:98954906-98954928 GAGTGGAGAGGGAGGGTGGGAGG - Intronic
1058227454 9:102383094-102383116 GGGTGGGGGAGGAGGGGGGAGGG - Intergenic
1058341665 9:103904788-103904810 GAGGGGAGAAGGAGGGAGGGAGG + Intergenic
1059077785 9:111212861-111212883 GACTTGAGGAGGAGGGTGGGAGG - Intergenic
1059145191 9:111893713-111893735 TAGTGGAGGAGGCTGGTGGAGGG - Intergenic
1059235557 9:112758022-112758044 GGGTGGAGTAGAAGGGTAGAGGG - Intronic
1059340428 9:113594732-113594754 GGGTGGAGATGGGGGCTGGAAGG + Intronic
1059410085 9:114126436-114126458 AAGAGGAGAGGGAGGGAGGAAGG - Intergenic
1059428495 9:114236133-114236155 GTGTGGAGAGGCTGGGTGGAGGG - Intronic
1059509164 9:114827970-114827992 AAGTGGGGAAGGAAGGAGGAAGG - Intergenic
1059672323 9:116503171-116503193 GAAGGAAGAAGGAGGGAGGAAGG + Intronic
1059970122 9:119658635-119658657 GTATGGAGAAGGAAGGAGGATGG + Intergenic
1060050857 9:120377134-120377156 GAGTGGAGAAGGAGGGGAGAAGG + Intergenic
1060124034 9:121024294-121024316 GAGGGGAGCGGGAGGGGGGAGGG + Intronic
1060124067 9:121024349-121024371 GAGGGGAGCGGGAGGGGGGAGGG + Intronic
1060225362 9:121786930-121786952 GGGTGGAGAATGAGAGAGGAAGG - Intergenic
1060351600 9:122866371-122866393 GTGGGGAGAGGGAGGGGGGAGGG - Intronic
1060384889 9:123216080-123216102 GAATGCAGAATAAGGGTGGAGGG - Intronic
1060467724 9:123922171-123922193 GGGAGGCCAAGGAGGGTGGATGG - Intronic
1060498169 9:124133071-124133093 GAGTGGAGATGGAGGCGGAAGGG + Intergenic
1060735740 9:126065568-126065590 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1061054966 9:128217730-128217752 GAGTGGGGAAGGAGGTGGCAAGG - Intronic
1061196500 9:129109900-129109922 GGGTGGGGAAGGGGGCTGGAGGG + Intronic
1061196514 9:129109936-129109958 GGGTGGGGAAGGGGGCTGGAGGG + Intronic
1061339221 9:129965794-129965816 GAGGGGGGAAGGAGGGAGGGAGG + Intronic
1061900226 9:133668815-133668837 GAGGGGAGAGGGAGGGTGAGGGG - Intronic
1061900378 9:133669252-133669274 GAGGGGAGAGGGAGGGTGAGGGG - Intronic
1061942547 9:133891398-133891420 GAGGGGAGATGGAGGGGGGATGG + Intronic
1061942553 9:133891409-133891431 GAGGGGGGATGGAGGGGGGACGG + Intronic
1061947165 9:133914785-133914807 GAGAGGAGGAGGAGAGGGGAAGG + Intronic
1061986233 9:134131791-134131813 GAATGGAGAACGAGGCTGGTGGG + Intergenic
1062143959 9:134978790-134978812 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062143966 9:134978817-134978839 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062144003 9:134978929-134978951 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062194130 9:135263876-135263898 GAGAGGGGAAGGAGGGGAGAGGG - Intergenic
1062328247 9:136023061-136023083 GAGGGAAGAGGGAGGGAGGAGGG + Intronic
1062328259 9:136023091-136023113 GAGGGAAGAGGGAGGGAGGAGGG + Intronic
1062370449 9:136236117-136236139 GAGTGGAGGTGGTGGGTGGCAGG - Intronic
1062449139 9:136608259-136608281 GAGAGGAGAAGGGGGAAGGAGGG + Intergenic
1062449195 9:136608413-136608435 GAGGTGAGAGGGAGGGAGGAGGG + Intergenic
1062588673 9:137263350-137263372 GAAGGGAGAAGGAGGGAGGGAGG - Intronic
1185449521 X:275096-275118 GGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1185459824 X:328859-328881 GAGAGGAGGGGGAGGGGGGAGGG - Intergenic
1185459869 X:328948-328970 GAGGGGAGGGGGAGGGGGGAGGG - Intergenic
1185511569 X:668097-668119 GAGTGGGAAAGGAGAGGGGAGGG - Intergenic
1185627578 X:1493356-1493378 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1185648016 X:1628801-1628823 GAGAGGAGAAGGAGAGAGGCAGG - Intronic
1185688290 X:1948339-1948361 GAGGGGAGGAGGAGGGGAGAGGG + Intergenic
1185688298 X:1948357-1948379 GAGGGGAGGAGGAGGGGAGAGGG + Intergenic
1185887122 X:3792736-3792758 GAGGGGAGGAGGAGGAAGGAAGG + Intergenic
1186641781 X:11463247-11463269 GTGTGGAGAGGGAGGATGGAGGG + Intronic
1186757288 X:12685348-12685370 GAGAGAAGAAAGAGGGAGGAAGG - Intronic
1187049115 X:15678647-15678669 GGGTGAAGAAGGAGGGAGGGAGG + Intergenic
1187378977 X:18783130-18783152 GAAGGCAGAGGGAGGGTGGAGGG + Intronic
1187492028 X:19761098-19761120 GAGTGGAACAGGAGGTTGGAAGG + Intronic
1187529714 X:20085256-20085278 AAGAGGAGAAGAAGGATGGATGG + Intronic
1187552955 X:20324201-20324223 GAGAAGAGAAGGAGGGAGGGAGG - Intergenic
1187553110 X:20325785-20325807 GAAGGGAGAAGGAGTGAGGATGG + Intergenic
1187756432 X:22532179-22532201 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1187796472 X:23008941-23008963 GATGGGAGAGGGAAGGTGGAAGG - Intergenic
1187882915 X:23862948-23862970 GAAGGGAGAAGGAGGGAGGGAGG + Intronic
1187891170 X:23936150-23936172 TAGGGGAGGAGTAGGGTGGAGGG + Intronic
1188004853 X:25010222-25010244 GAGGGAAGAGGGAGGGAGGAGGG - Intronic
1188239864 X:27772777-27772799 GAGTGGGGAAGCACGGTGGAAGG + Intergenic
1188303465 X:28533043-28533065 GGGAGGGGAAGAAGGGTGGAAGG + Intergenic
1188574903 X:31636190-31636212 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1188969130 X:36591682-36591704 GAGGGTAGAAGGTGGGAGGAGGG - Intergenic
1189157533 X:38773844-38773866 GAGGGGGAAAGCAGGGTGGAGGG + Intergenic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189236593 X:39491748-39491770 GAGTGGAGAATGAGGCTGCATGG - Intergenic
1189322551 X:40095708-40095730 GAGCGAAGAAGGAAGGAGGAGGG - Intronic
1189335242 X:40167093-40167115 CAGTGGAGAAGGTAGATGGAGGG - Intronic
1189571415 X:42301924-42301946 GAGAGGAGAAAGAGGGAGGAGGG - Intergenic
1189624685 X:42883898-42883920 GAGTAAAGAAGGAGGGAGAATGG - Intergenic
1189814917 X:44814948-44814970 TGGTGGAGAATGAGGGTGCAAGG + Intergenic
1190066063 X:47242527-47242549 GACTGCAGAAGGAGGCTGGATGG + Intronic
1190220335 X:48508870-48508892 GAGGGGAGCAGGAGGATTGAGGG - Intergenic
1190260386 X:48793501-48793523 GAATGGAGAAGGAAGGAGGGAGG - Intronic
1190430758 X:50375935-50375957 AAGTGGAGCCGGAGGCTGGACGG - Intronic
1190444017 X:50504933-50504955 GAGTGGAGGAGGAGGGAAAAGGG - Intergenic
1190812202 X:53895629-53895651 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1191088102 X:56590825-56590847 GAGGGTAGAAGGTGGGAGGAGGG - Intergenic
1191724328 X:64263183-64263205 TTGTGGAGAAGGAGGTGGGAAGG - Intergenic
1191977879 X:66893849-66893871 GGGTGGAGAAGGAGGGTTACAGG + Intergenic
1192020332 X:67384465-67384487 GAGTGGGGAAGGAGTGGTGATGG - Intergenic
1192177108 X:68893029-68893051 GAGTGGAGAAGCATGGGGGAGGG + Intergenic
1192180754 X:68914345-68914367 GAGGGGAGCGGGAGGGGGGATGG - Intergenic
1192838499 X:74828113-74828135 GAGTAGAGAAAGAAGGTGGATGG + Intronic
1193449834 X:81652044-81652066 GAGTGTGGAAGGTGGGAGGAGGG + Intergenic
1193570442 X:83134963-83134985 GAGTGTGGAGGGAGGGAGGAGGG + Intergenic
1193819416 X:86144083-86144105 GAGGGGAGAAGGGAGGCGGAGGG + Intergenic
1194209015 X:91046386-91046408 GACAGGAGAAGCAGGGAGGATGG + Intergenic
1194320433 X:92440300-92440322 GAGTGGGGAGGGAGGGAGGGAGG - Intronic
1194690283 X:96976024-96976046 GAGTGGAAAAGAAGGAAGGAAGG - Intronic
1194746745 X:97636590-97636612 GAGTGGAGTTGGAGTGTGCATGG - Intergenic
1195029110 X:100909192-100909214 GTGAGGAGAAGGATGGTAGAGGG - Intergenic
1195229722 X:102834026-102834048 GAGTGGAGATGGGGGGAAGAGGG - Intergenic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1195880991 X:109592443-109592465 GAATGGAGAAGGAGGGTTGCAGG - Intergenic
1195882912 X:109611327-109611349 GAGTAGAGGAGGAGGGAGAAAGG + Intergenic
1195927242 X:110038371-110038393 GGGTAGAGAATGAGGGTGGCTGG - Intronic
1195980187 X:110568992-110569014 GAGTGGAGAGGGAGGAAGGTAGG + Intergenic
1196039736 X:111189065-111189087 GAGTGAGGAAGGAGGGAGGAGGG - Intronic
1196049001 X:111285157-111285179 GAGTGAGGAAGGAGGTTTGAAGG + Intergenic
1196481589 X:116156648-116156670 GTGTGGAGAAGGGTGGTGGGTGG + Intergenic
1196729195 X:118924061-118924083 GAGAGTAGAAGGATGGTGGCCGG - Intergenic
1196834450 X:119801723-119801745 GAGAGAAGAGGGAGGGAGGAAGG - Intergenic
1196885800 X:120244515-120244537 CAGAGGCGAAAGAGGGTGGAGGG + Intergenic
1196933228 X:120702731-120702753 GAGTGGAAAGGGTGGGAGGAGGG + Intergenic
1196942693 X:120793006-120793028 GAGAGGCCAAGGCGGGTGGATGG - Intergenic
1197700742 X:129597745-129597767 GAAAGAAGAAGGAGGGAGGAAGG + Intergenic
1197705470 X:129631534-129631556 GAGTGGAAGAGGAGGGTACAGGG + Intergenic
1197827241 X:130602809-130602831 GAGGAGAGAAGGAGGGAGAAAGG + Intergenic
1198089883 X:133318131-133318153 GAGTGGGGAAGGGGTGAGGATGG - Intronic
1199074174 X:143510859-143510881 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199093168 X:143714120-143714142 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199215167 X:145254040-145254062 AGGTGGAGAAGGAAGGGGGATGG + Intronic
1199507919 X:148586944-148586966 GAAGGGGGAAGGAGGATGGAGGG - Intronic
1199552322 X:149073859-149073881 GAGGGGAGAGGGTGGATGGAGGG - Intergenic
1200182440 X:154158973-154158995 GGATGGAGAAGGAGGGGGAAAGG - Exonic
1200188094 X:154196087-154196109 GGATGGAGAAGGAGGGGGAAAGG - Intergenic
1200193744 X:154233227-154233249 GGATGGAGAAGGAGGGGGAAAGG - Exonic
1200199499 X:154271031-154271053 GGATGGAGAAGGAGGGGGAAAGG - Exonic
1200229845 X:154438401-154438423 CAGTGGGGATGGTGGGTGGAAGG + Intronic
1200828095 Y:7663673-7663695 GAGTGGGGATGGAGTGGGGAGGG + Intergenic
1201256345 Y:12111992-12112014 GAAGGGGGAAGGAGGGAGGAAGG - Intergenic
1201300226 Y:12498705-12498727 AAGAGGAGAAGGAGGGGGAAGGG - Intergenic
1201517641 Y:14835327-14835349 GAGGGAGGAAGGAGGGAGGAGGG + Intronic
1202273896 Y:23096266-23096288 GAGAAGAGAAGGAGGGGAGAAGG + Intergenic
1202292130 Y:23324411-23324433 GAGAAGAGAAGGAGGGGAGAAGG - Intergenic
1202426892 Y:24730011-24730033 GAGAAGAGAAGGAGGGGAGAAGG + Intergenic
1202443899 Y:24940083-24940105 GAGAAGAGAAGGAGGGGAGAAGG - Intergenic