ID: 1172115160

View in Genome Browser
Species Human (GRCh38)
Location 20:32569363-32569385
Sequence TTTTGAACAGAGAAGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 516}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172115160 Original CRISPR TTTTGAACAGAGAAGGAACA TGG Intronic
900690240 1:3976475-3976497 TTTCGAGCAGAGGAGTAACATGG + Intergenic
900964721 1:5949981-5950003 TTTTAAACACAGAAGAAAAATGG + Intronic
901382780 1:8885929-8885951 TTTTGAACAGAAAAGCAAGTGGG + Intergenic
901898026 1:12331411-12331433 TTTTGAACAATGAAGAAATAAGG - Intronic
902661345 1:17906140-17906162 TTTTGAGGAGAGAATGAAGAGGG - Intergenic
902710423 1:18235742-18235764 GTTTAAGCAGAGAAGTAACAGGG + Intronic
904950580 1:34235291-34235313 TTCTTAACAAAGAAAGAACAAGG + Intergenic
905234444 1:36536277-36536299 TCTTGAGCAGACAGGGAACAGGG + Intergenic
906544362 1:46611031-46611053 TGTTGAAAAGAGGAGGGACATGG - Intronic
906866523 1:49427073-49427095 TTTTGAAGTAAGAAGGAAAAAGG + Intronic
907085742 1:51672119-51672141 TTTTGAGCAGAGGAGTGACATGG + Intronic
907271591 1:53294574-53294596 TTATGAACTGAGAAGCAAAAAGG + Intronic
908103990 1:60822146-60822168 TTTTGAGCAGAGGAGTAACATGG + Intergenic
908344953 1:63222615-63222637 TTATGAATAGAGAGGGAAAAGGG - Intergenic
908933644 1:69346880-69346902 TTTTGAAAAGAGAAGAAAGGAGG + Intergenic
909679404 1:78275158-78275180 ATTTAAACATAGAAGGGACAGGG - Intergenic
909738692 1:79000470-79000492 CTTTGAAAAGAGAAGGAAAGGGG - Intronic
909828557 1:80156446-80156468 TTTTGCACTTAGAAGGTACATGG - Intergenic
909944681 1:81650228-81650250 TGGAAAACAGAGAAGGAACATGG + Intronic
910179951 1:84471833-84471855 TTCTGAGCAGAGAAAGAGCAGGG - Intergenic
910332537 1:86090902-86090924 TTTTGCTCAGAGAAGCCACAGGG + Intronic
910665986 1:89726402-89726424 TTTTGAGCAGAGGAGCAATAAGG - Intronic
910712146 1:90193217-90193239 TTTGTGACAGAGAAGGAAAAAGG + Intergenic
911166837 1:94731755-94731777 CTATGAACAGAGAAGAAACTGGG - Intergenic
911295592 1:96110993-96111015 ATTTGAAAGGAGAAGGTACAAGG + Intergenic
911924073 1:103804700-103804722 TCAGGAACAGAGAATGAACATGG + Intergenic
912185713 1:107273505-107273527 TTTTTTAAATAGAAGGAACAGGG + Intronic
912632322 1:111256466-111256488 ATCTGAAGAGAGAAGGAAAATGG - Intergenic
913018049 1:114759098-114759120 TTTTGAACAGAAATGGGACACGG - Intergenic
913552384 1:119928242-119928264 TTGGGAACAGAGTAGGAACATGG + Intronic
914420793 1:147526871-147526893 TTTTGATTACAGAAGCAACATGG + Intergenic
915075082 1:153301427-153301449 TTTTGAAAAGTCAAGGAACGGGG + Intronic
915457418 1:156050160-156050182 TTTTGAACACTGGAGGTACAGGG - Intronic
915510705 1:156385532-156385554 CTCTGAGCAGAGAAGGAAGAGGG + Intergenic
915716218 1:157947564-157947586 GTTTTGACAGAGAAGGAACAAGG + Intergenic
916170638 1:161999147-161999169 TTTTGAGCAGAGATGGAATATGG + Intronic
916270576 1:162937302-162937324 TTAGGAAGAGAGAAGCAACAGGG - Intergenic
916453596 1:164946563-164946585 TTTTGAAGAGAGAAACAAAATGG - Intergenic
916882967 1:169039241-169039263 TTTTGAAAAGAAAAGCAAAATGG + Intergenic
917269174 1:173254750-173254772 TTTTGAACAGAGACTGAAAGTGG + Intergenic
917827123 1:178835130-178835152 ATTTGAGGAGAGAAGGAATAGGG + Intronic
918515692 1:185360054-185360076 TTCTGAAGAGAGAAGATACAAGG - Intergenic
918555060 1:185789229-185789251 TTCTGTTAAGAGAAGGAACAAGG + Intronic
919958627 1:202443113-202443135 TTTGGTGCAGAGAAGGTACATGG + Intronic
920807778 1:209251240-209251262 ATTAGTTCAGAGAAGGAACATGG + Intergenic
921223530 1:212993590-212993612 TTTTGTAGACAGTAGGAACAAGG - Exonic
921252398 1:213310226-213310248 TTATGAGCAGAGGAGGAATAAGG - Intergenic
921891925 1:220362064-220362086 TTTAAAACAGAGAAAAAACAAGG - Intergenic
922490332 1:226011485-226011507 TTTTGAACAGAAAGGAGACATGG + Intergenic
923370895 1:233311283-233311305 TGTTGAACAACTAAGGAACAAGG + Intergenic
923422771 1:233835514-233835536 TATTGAAAAGATAAGGAAGAGGG - Intergenic
923810246 1:237307395-237307417 TCTTAAACTGAAAAGGAACAAGG + Intronic
924725782 1:246669271-246669293 TTTTGAAGATAGAGGCAACAGGG - Intergenic
1063854524 10:10233796-10233818 TTTTTAACTGAGAGGGAAAATGG - Intergenic
1064095951 10:12424631-12424653 TTTTAAACAGAGGAATAACATGG - Intronic
1064270918 10:13865160-13865182 TCTTGTACAGACAAGGAACAAGG - Intronic
1064275231 10:13899470-13899492 TTTTCTACAGACAAGGAACTTGG + Intronic
1064305039 10:14157930-14157952 TTTTCAGCAGACAAGGAAAAGGG + Intronic
1065473545 10:26109510-26109532 TTTTGAACTGATAACCAACAGGG - Intronic
1066227152 10:33394386-33394408 TCTTTAAGAGAGAAGGAACAAGG + Intergenic
1066470648 10:35694463-35694485 TTTAGATGAGAGAAGGAAGAAGG - Intergenic
1067718203 10:48705543-48705565 ATTTGAAAAGAGAAGGAAACAGG - Intronic
1068008934 10:51423411-51423433 TTTTGGAAAAAGGAGGAACAAGG - Intronic
1068251773 10:54452325-54452347 TGTTGAATAGAGAAAGAAAAAGG - Intronic
1069083004 10:64108114-64108136 TTTTGCACAGAGGAGTAATATGG - Intergenic
1069104281 10:64363843-64363865 TTGAGTACACAGAAGGAACAAGG + Intergenic
1069273239 10:66557452-66557474 TTTTGACCAGAGACTGAACATGG - Intronic
1070338604 10:75476576-75476598 TTTTGAGCAGGGAAGCAACTTGG - Intronic
1070932105 10:80268334-80268356 GTTTGGAGAAAGAAGGAACAAGG - Intergenic
1071920738 10:90347187-90347209 TTATTAACAGACAAGGAAGAAGG + Intergenic
1071925452 10:90402995-90403017 TCTTGAATACAGAAGGAAAAAGG - Intergenic
1072071594 10:91923584-91923606 TATTTGACAGAGAAGGAAAAAGG - Intergenic
1073016254 10:100401977-100401999 TTTGGAACAGCTAAGGAAAAAGG + Intergenic
1073499030 10:103919215-103919237 TATTTATCAGAGAAGGAACTTGG + Intergenic
1074738598 10:116462075-116462097 TTTTGAGCAGAGAAGAGACGTGG + Intronic
1074835409 10:117287648-117287670 ATCTGAACAGGGAAGGAAAATGG - Intronic
1075866533 10:125726385-125726407 TTTAGAAAAGAGAATGAACTAGG + Intronic
1076828342 10:132981692-132981714 TTTAGAACCGAGGTGGAACATGG + Intergenic
1077743703 11:4877034-4877056 TTTTGATGAGAAAAGGCACAGGG - Intronic
1078281631 11:9908319-9908341 TTGTGAATAGAGAAGGCAGATGG + Intronic
1078702120 11:13696355-13696377 TTTTTAAGAGGGAAGGAAGAGGG + Intronic
1078969953 11:16397645-16397667 TTATGAAGGTAGAAGGAACAGGG + Intronic
1079532020 11:21465666-21465688 TTCTGAAGAGAAAAGGACCAAGG + Intronic
1079566160 11:21885930-21885952 TTTTGAACAGGAAAATAACAGGG + Intergenic
1079938641 11:26649856-26649878 TTTTGAACTAAGAAAAAACAGGG - Intronic
1080247307 11:30194366-30194388 TTTTGAACAGAGAAATGACAAGG - Intergenic
1080819400 11:35790883-35790905 TAGTAAACAGGGAAGGAACAAGG + Intronic
1081474335 11:43410881-43410903 TTTTGAAAACAGAATCAACAAGG - Intronic
1081820101 11:45984624-45984646 TTGTCAACAGAGAAGGGAGACGG + Intronic
1082011396 11:47452156-47452178 TGGTGAACAGAGAAGGAATTAGG - Intergenic
1082740616 11:56906968-56906990 TTGTGAACTGAGTAAGAACATGG + Intergenic
1083063757 11:59901540-59901562 GTTTGGACAAAGAAGGAAAAGGG - Intergenic
1085654995 11:78305950-78305972 TTTTGCTCAGAGAAGGATTAAGG - Intronic
1086018139 11:82192255-82192277 ATTTGAACATAGAAGGATGAAGG - Intergenic
1086161580 11:83727610-83727632 TTTTGAACAGAATAGGAAGCAGG - Intronic
1086729763 11:90233971-90233993 GTGTAATCAGAGAAGGAACAGGG + Intergenic
1086837164 11:91639052-91639074 TTCTGAGCAGAGAAGAAAAAGGG + Intergenic
1086934932 11:92734711-92734733 TATTCCAGAGAGAAGGAACAAGG + Intronic
1087159030 11:94931297-94931319 TTTTGAACAGATAATGAATTCGG + Intergenic
1087654435 11:100905302-100905324 TTTGGAACAGAGATGGAGCAAGG + Intronic
1087767585 11:102173011-102173033 TTTTGAACAGAGGAGTGACATGG + Intronic
1088465504 11:110132592-110132614 TCTTGAACACAAAAGGAACTGGG - Intronic
1088834832 11:113568754-113568776 GATTAAGCAGAGAAGGAACACGG + Intergenic
1089006537 11:115096200-115096222 TCTGGAACAGAGAAGAAACATGG + Intergenic
1089059297 11:115613212-115613234 TTTTGAACAGAGGAGTGACATGG - Intergenic
1089568202 11:119383802-119383824 TTTTGAGCAGAGGAGGGACACGG + Intergenic
1090102208 11:123810886-123810908 TTTTCAACAGGGAAAGGACAGGG - Intergenic
1091126989 11:133109285-133109307 TTTTGAAGAGCAAAAGAACAAGG + Intronic
1091239273 11:134041732-134041754 GGCTGAACAGAGAAGAAACAAGG - Intergenic
1091620350 12:2083069-2083091 GCTTGAACATAGAAGGAACAGGG + Intronic
1092559448 12:9595528-9595550 TATTAAACAAAGAAGGCACACGG + Intronic
1093309933 12:17567582-17567604 GTTTGAAAAGAGTAGGAACGTGG + Intergenic
1093572778 12:20687225-20687247 TTTTAAAAAGAAAAGGGACAAGG - Intergenic
1093746455 12:22747160-22747182 TTTTCAAAAGAAAAGGAAAATGG - Intergenic
1096165504 12:49420104-49420126 TTTGGAACTGAGAAGAGACAAGG + Intronic
1096415516 12:51408854-51408876 TTTAGAACAGAGAAGGAGCGGGG + Intronic
1096732327 12:53624528-53624550 TTCTGTACAGAAAAGGGACAGGG - Intronic
1096792800 12:54055336-54055358 TTTGGAACTGACAAGGGACAAGG - Exonic
1097353957 12:58580252-58580274 TTTTAACAAGAGAAGGCACAGGG + Intronic
1097806376 12:63969071-63969093 GTTTTCACAGAGAAGGAAGATGG + Intronic
1097949717 12:65414143-65414165 TTTTGAATAGAGGAGTGACATGG + Intronic
1098211641 12:68172399-68172421 TGGTCAACAGAGAAGAAACATGG - Intergenic
1098215222 12:68209071-68209093 TTTTGAACACATAAGGAAATTGG - Intronic
1098227786 12:68342600-68342622 CTTTGACCAGAGGAGGAAAAAGG - Intergenic
1098301669 12:69060477-69060499 TTTTGGACAGAACAGGTACAAGG + Intergenic
1098366227 12:69706092-69706114 TTTTGAGCAGAGGAGTGACATGG - Intergenic
1099136462 12:78909982-78910004 ATGTGAACAGAGGAGGAAGAAGG - Intronic
1099886583 12:88538496-88538518 GTTTCAGCAGAGAAGGAACCTGG + Intronic
1099951222 12:89306587-89306609 TTTAATAGAGAGAAGGAACAGGG + Intergenic
1100580245 12:95932116-95932138 CTTTGAACAGAGAAGGAATGTGG + Intronic
1100828756 12:98498826-98498848 TTTTGAACAGAGTAGTGATATGG - Intronic
1101167256 12:102051242-102051264 TTTTGAACTGAGAGTGAACTGGG - Intronic
1102248691 12:111371063-111371085 TTTTGAGCAGAGGAGGGACATGG + Intergenic
1102663416 12:114549195-114549217 TTTTTAGCAGAGAGGGGACATGG + Intergenic
1102761122 12:115386123-115386145 TTTTGAATAGAGTAGTGACATGG - Intergenic
1102762870 12:115404198-115404220 TTTTGAACAGAGGAGTGCCATGG + Intergenic
1104066042 12:125306773-125306795 TTTTGAGCAGAGGAAGAACATGG - Intronic
1104820159 12:131672481-131672503 CTTTGAGCAGGGAAGGGACAAGG - Intergenic
1105951664 13:25234727-25234749 TTTAGAACTGTAAAGGAACATGG + Intergenic
1106022692 13:25930233-25930255 TTTGAAAGAGAGAAGGAACATGG - Intronic
1107216378 13:37924405-37924427 TTTTAAACAGACAAGTATCAGGG + Intergenic
1107256318 13:38431765-38431787 ATTAGGACAGAGAAGGACCAGGG - Intergenic
1109148150 13:58808660-58808682 TTTTCAGTAGAGAATGAACAGGG - Intergenic
1109246585 13:59961660-59961682 TTTTAATCAGAGAAGCAGCATGG + Intronic
1109442705 13:62395691-62395713 AATTGAACAGAGAGGGATCATGG - Intergenic
1109601171 13:64630350-64630372 TTGATAACAGAGAAAGAACACGG - Intergenic
1109720499 13:66269508-66269530 ATTAGAACTGAGAAGGAAAATGG + Intergenic
1110085368 13:71372531-71372553 TCTGGAGCAGAGAAGGAATATGG + Intergenic
1110333950 13:74304365-74304387 TTCTGAACAGGGAGGCAACATGG - Intergenic
1112470016 13:99679698-99679720 TTTTGGAAAGAGAAGAAATATGG - Intronic
1112528484 13:100176784-100176806 GTTTTAACAGAGGAGCAACATGG + Intronic
1114374577 14:22130703-22130725 TTTCTAAAAGAGAAGGAAAAAGG - Intergenic
1115540753 14:34418419-34418441 TTTTGAAAAGAAAAGTAAAATGG + Intronic
1115657577 14:35458886-35458908 TTTGGGACTGAGAATGAACAGGG - Intergenic
1116063291 14:39951071-39951093 TATTGCACAGAGAAGGCACTCGG - Intergenic
1116377513 14:44222350-44222372 TTTGGGAAAGAGAAGAAACAGGG + Intergenic
1116732616 14:48643701-48643723 TTTTGTAAAGATAAGGCACAAGG - Intergenic
1117183106 14:53212862-53212884 TTTTGGGAGGAGAAGGAACAGGG + Intergenic
1117717413 14:58595087-58595109 TTTTGAAAAAAGAAAGAAAAAGG - Intergenic
1118790322 14:69085731-69085753 TTTTGTAAAGAGAAGGTAGAGGG - Intronic
1119137199 14:72231954-72231976 TTTTGAACACAGAAGTGACAAGG + Intronic
1119185823 14:72641735-72641757 TCTTGAAAAGAGGAGGACCAAGG - Intronic
1119636651 14:76278789-76278811 TTTTTTACAGATAAGGAACTTGG + Intergenic
1119711945 14:76828774-76828796 TTTTCAACAGAAGAGGAACTGGG + Intronic
1120053825 14:79899173-79899195 TTTTGATGAGAGAAGCATCAGGG - Intergenic
1121072229 14:91034692-91034714 TTGTGAAGAGTGAAAGAACAAGG - Intronic
1121398363 14:93648315-93648337 TTTTCAACAGAGAAGCCAGAGGG - Intronic
1121575368 14:94980637-94980659 TTTTAAACAGAGAAGCAATGTGG + Intergenic
1121757517 14:96415317-96415339 TTTTGAAAAGAAAAGAAAAAAGG + Intronic
1121889774 14:97578672-97578694 TTTTGAGCAGAGTAGTAACATGG + Intergenic
1124034141 15:26038701-26038723 TTTTGAAGAGAGAGGGAAAGAGG - Intergenic
1125085473 15:35724540-35724562 TTTTGATAAGAGAAGGGAAAGGG + Intergenic
1125107038 15:35984153-35984175 TTTACTACAGAGAAGTAACATGG + Intergenic
1125479641 15:40071152-40071174 TTTTGAACAGATAAGAGGCATGG + Intergenic
1126491348 15:49240253-49240275 TTTTGAGAAGAGAAGAAGCAAGG + Intronic
1127250065 15:57225135-57225157 TTTTGATTACCGAAGGAACAAGG + Intronic
1127359126 15:58229468-58229490 ATGGGAACAGACAAGGAACAAGG + Intronic
1127581770 15:60345381-60345403 CTTTGCAAAGAGAAGGAAAAGGG - Intergenic
1127583064 15:60355195-60355217 GTTTGAACAGAGGAGTAAAATGG + Intronic
1127667913 15:61167076-61167098 TTTTGAACAGAGAAGCATTAGGG - Intronic
1128861927 15:71081417-71081439 TTTTGAACCAGGAAGGAACCTGG + Intergenic
1129236286 15:74225644-74225666 TGTTGTACAGAGATGGAACCAGG - Intergenic
1129238631 15:74239004-74239026 TGTTGAAACTAGAAGGAACATGG + Intronic
1129423274 15:75447135-75447157 TTTTAAGCAGAGAAGTGACACGG + Intronic
1130186306 15:81687059-81687081 TTTTAAAAAGAAAAGGAAGAAGG + Intergenic
1130551244 15:84891132-84891154 TTTTGAACAGGGAAGCGTCAAGG + Intronic
1131338742 15:91575848-91575870 TTTTGGAGAGAGATGGATCAAGG - Intergenic
1131686375 15:94772441-94772463 TTTAGAGCTGAGAAGGAGCAGGG + Intergenic
1132911961 16:2318358-2318380 TTTTGGTCAGTGAAGGAACTGGG - Intronic
1132918905 16:2372074-2372096 TGGGGAACAGAAAAGGAACACGG - Intergenic
1133456591 16:5947657-5947679 TTTACAATAGAGAAGGAAGATGG - Intergenic
1133920642 16:10149989-10150011 TTATGGACAGAGAAGGAAAGTGG + Intronic
1134038544 16:11050447-11050469 TTCTGAAAAGAGAAGACACAAGG + Intronic
1134157750 16:11857546-11857568 TTTTTAAAAGATAAGTAACATGG + Intergenic
1134361803 16:13537922-13537944 TTTTGGACAGAGGAGAAAAATGG + Intergenic
1134447278 16:14340345-14340367 TTTTGACCAGAAGAGTAACATGG + Intergenic
1134603970 16:15555504-15555526 TTGGGAACAGAGTGGGAACAAGG + Intronic
1135853119 16:25982514-25982536 TTTTAAACAGGGAAGCACCATGG - Intronic
1135874805 16:26188643-26188665 TTTTACTCAGAGAAAGAACAAGG - Intergenic
1136546988 16:30960467-30960489 TTTTGTACAGAGTATGATCAGGG - Intronic
1139988701 16:70921404-70921426 TCTCAAACAGAGAAGGACCATGG - Intronic
1140314215 16:73878910-73878932 TTTTGAACAGTGAAGGATGTAGG - Intergenic
1140379292 16:74471784-74471806 TTTTAAGAAGAGATGGAACAGGG - Intronic
1140982030 16:80119663-80119685 TATGGAATAGAGAAGGAAGAAGG - Intergenic
1141497560 16:84420372-84420394 TTTGGAAGAGAGGAGGCACATGG - Intronic
1142472000 17:169851-169873 ATTTACACAGAGAAGGAACTGGG + Intronic
1143097431 17:4485952-4485974 TCTTGAACTGGGAAGGAACCAGG - Intronic
1144052826 17:11511749-11511771 CTTTGCACACAGAAGGAACGTGG - Intronic
1144317603 17:14077891-14077913 TTGAGAGCAGAGAAGGATCAGGG + Intronic
1144759953 17:17701485-17701507 TTTTGCAGAGGGAAGGAAAACGG + Intronic
1146393096 17:32440915-32440937 CTTTGAAGTGAGAAGGAACGTGG + Intergenic
1146533031 17:33626881-33626903 TTTTGAGCAAAGAAGTCACATGG - Intronic
1146628839 17:34455603-34455625 TTTTAAGCAAAGAAGGGACATGG + Intergenic
1146903914 17:36605940-36605962 TTTTGAGCAGAGAAGTAACATGG - Intronic
1146995019 17:37312614-37312636 TTTTGAACAGATGTGAAACAGGG + Intronic
1147032195 17:37647880-37647902 TTTTAAGCAGAGAAGCAACATGG - Intergenic
1147488545 17:40842052-40842074 TTTAGAACTGGGAAGGATCACGG + Intergenic
1148535047 17:48431693-48431715 TTTTTTACAAAGAAGGAAAAAGG - Intergenic
1148749509 17:49936459-49936481 TGTTGAGCAGAGAAGTGACATGG - Intergenic
1150241736 17:63639516-63639538 TTATGAACAAAGAAGGAACATGG + Intronic
1150974344 17:70066790-70066812 TTTTAAACAGATAAGGACCTTGG - Intronic
1151250662 17:72831747-72831769 TCTTTAAGAGAGAATGAACAAGG - Intronic
1152106304 17:78331134-78331156 TTATGAACAGATCAGGAAAAGGG - Intergenic
1152221130 17:79067435-79067457 TTTTGAACAGACGAGTAACATGG + Intergenic
1152982052 18:287695-287717 TTTTGAACACAGAATTAACTAGG - Intergenic
1153986262 18:10353277-10353299 CTTTGATCAGAGAAGGACCTGGG + Intergenic
1154047699 18:10922344-10922366 TTTTAAAAAGAGAAGTATCAGGG - Intronic
1154131895 18:11744347-11744369 TTATGTACAGAAAAGGAAAATGG + Intronic
1154939001 18:21092170-21092192 TTTTGACAGGTGAAGGAACAAGG + Intronic
1155835636 18:30580531-30580553 TTTTGAAAATAGAAGGTGCATGG + Intergenic
1155995928 18:32331754-32331776 GTTAGAACAGAGAAGAAACTGGG + Intronic
1156860736 18:41833468-41833490 TGGTTAACAGAGAGGGAACATGG - Intergenic
1157615499 18:48985086-48985108 GGTTGAACAGTGAAGGTACAAGG + Intergenic
1158035572 18:53025436-53025458 TGTTGAACAGGGAAGGGCCAAGG - Intronic
1158587627 18:58755408-58755430 TTATGAGCACAAAAGGAACACGG + Intergenic
1158665970 18:59433109-59433131 TTTTGCAGAGAGAAGGAGGAAGG + Exonic
1159097561 18:63921663-63921685 TTTTGAGTAGAGAAGTGACATGG - Intronic
1159407351 18:68021819-68021841 TTTTTAACTGAGGAGGAAAATGG + Intergenic
1159762110 18:72440283-72440305 TTGTGTACAGAGGAGGAATATGG - Intergenic
1160591075 18:79944991-79945013 TTATCAACAGAACAGGAACAGGG + Intronic
1161619728 19:5291756-5291778 TTTAGAGCAGAGGAGGAACGGGG - Intronic
1162144887 19:8607524-8607546 TTTTGCACAGAGGAGGAGGAGGG - Intronic
1162892675 19:13745335-13745357 TTTAGAACAGAGATGGAACCTGG + Intronic
1163122089 19:15224054-15224076 TTTTCAGCAGGGAAGGGACATGG - Intergenic
1164479262 19:28598784-28598806 TTTTCAAGAGAGAAAGGACATGG - Intergenic
1165209107 19:34218316-34218338 TTTTTAAGACAGAAGGATCATGG + Intronic
1165671087 19:37679908-37679930 TTTTCCACAGAGTAGGGACAGGG + Intronic
1165773414 19:38390791-38390813 TTTTGAGCAGAGGAGGGACATGG - Intronic
1166275490 19:41750606-41750628 TTGTGAACAGAGAGAGGACAGGG + Intronic
1166280485 19:41789281-41789303 TTGCGAACAGAGCCGGAACAAGG + Intergenic
1166345159 19:42161195-42161217 TTTTAATCAGAGAAAGAACCAGG + Intronic
1166396229 19:42443377-42443399 TTGTGAACAGAGAGAGGACAGGG - Intergenic
1166658129 19:44627172-44627194 TTCTGAGCAGGGGAGGAACAGGG + Intronic
1166695555 19:44849454-44849476 TGATGAACACAGAAGGGACAGGG + Intronic
1166990983 19:46692596-46692618 TTGTGAGCAGAGGAGGGACAGGG - Intronic
1167531867 19:50022831-50022853 TTTTGAGTAGAGGAGGGACAGGG - Intronic
1167744493 19:51342574-51342596 TTTGGAGCAGAGGAGGAGCAGGG - Intergenic
1167760802 19:51447477-51447499 TTCTGAACAGTGAAAGAACAAGG + Intergenic
1168192324 19:54748241-54748263 TTTTCAAAAGATAAGGAAGAAGG - Intronic
1168202429 19:54825933-54825955 TTTTCAAAAGATAAGGAAGAAGG - Intronic
1168584008 19:57578361-57578383 TTGTGAACAGACGAGGCACATGG - Intronic
925691576 2:6529442-6529464 TGTTGAGCAGAGAAGGGACGAGG + Intergenic
925876688 2:8317326-8317348 TTTTCAGGAGAGAGGGAACATGG + Intergenic
927378161 2:22443126-22443148 TTTTAAGCAGAGAAGTTACATGG + Intergenic
928416590 2:31097593-31097615 TTTGTTACAGAGAAGGACCAGGG + Intronic
929056372 2:37880392-37880414 TGTTTCACATAGAAGGAACATGG + Intergenic
929440734 2:41964249-41964271 CTTTGAACTGAGAAGGAAATGGG - Intergenic
929486888 2:42362609-42362631 TTCTGAAAAGAGGAGGATCAAGG + Intronic
929836602 2:45406913-45406935 TTCTGCACAGAAAAGTAACAGGG - Intronic
930234257 2:48873828-48873850 GTTTGAACAAAGAAGTGACATGG + Intergenic
930568229 2:53050075-53050097 TTTTGAACAGATAAAGCACAGGG + Intergenic
930581018 2:53211868-53211890 TTAAGAAAAGAGAAGGAAAAAGG + Intergenic
930722415 2:54650066-54650088 TTTTGAAGAGCCAAGGAACAGGG - Intronic
931091443 2:58890924-58890946 TTTTGAAGACAGAATTAACAAGG - Intergenic
931132763 2:59356444-59356466 TTTTGGACAGAGAAGAAGAAAGG + Intergenic
931577607 2:63735560-63735582 TTTTGAGCAGGGAAGTAATAGGG + Intronic
932085198 2:68751517-68751539 TTTGGAACAGAAAGGGAAAATGG - Intronic
932838593 2:75060672-75060694 TTTTAAACAGAGAATGAACATGG + Intronic
932883447 2:75525748-75525770 ATTTGAACATAAAAGGACCAGGG + Intronic
933403491 2:81828315-81828337 TTATGAAAATAGAAGGAACTAGG + Intergenic
933448377 2:82412625-82412647 TTTTGAAGTGAAAAGGAAAAAGG + Intergenic
933887225 2:86729859-86729881 TTTTGAATAGGGAGGGGACAGGG + Intronic
933922951 2:87066854-87066876 TTTTGAATAGGGAGGGGACAGGG - Intergenic
936281955 2:111149330-111149352 TTTTGAAAGGAGAAGAAAGAGGG - Intronic
936593689 2:113827608-113827630 TGTTGAACAGGAAAGGAATAAGG + Intergenic
937009872 2:118552774-118552796 TTCTGAAAAGAAAAGGAAGAAGG - Intergenic
937443754 2:121938826-121938848 TCTTGAACAGAGAATAAACTGGG + Intergenic
937924581 2:127157973-127157995 TTCTGAACTGGGAAGGAACTGGG - Intergenic
939183682 2:138834389-138834411 TTTTGAAAAGAGAAGGAAGAAGG + Intergenic
940334882 2:152515707-152515729 TATTTAACAGAGAAGGAAATCGG - Intronic
940355043 2:152731571-152731593 TTTTGAACAGAGGAGCAGCAAGG - Intronic
940367585 2:152865382-152865404 TTTTGTAAAGATAAGAAACAAGG + Intergenic
940381692 2:153022071-153022093 TAATGAACTGAAAAGGAACAGGG + Intergenic
940799983 2:158122890-158122912 TAATGAGAAGAGAAGGAACAAGG + Intronic
941118035 2:161494111-161494133 TTTTGAACAGGAAAGTGACATGG + Intronic
941155720 2:161975737-161975759 ATTTGAACAAAGAAGGGGCAAGG + Intronic
941429238 2:165392460-165392482 TGGTGAACAGAAAAGAAACAAGG - Intergenic
941460199 2:165761595-165761617 TTTTTAACAGAAAAGAAACATGG + Intronic
941639257 2:167969825-167969847 TTTTGAATAGATAAGTAACATGG - Intronic
942003202 2:171671400-171671422 CTTTGAAGATAGAAGGAACACGG + Intergenic
944478048 2:200126985-200127007 TTTTCAACAGAGATGGCAGATGG + Intergenic
945155078 2:206829700-206829722 TTGTGAAGATAGAAGGAAAAAGG + Intergenic
945649863 2:212543644-212543666 TCTTAAACAAAGAAGAAACAGGG - Intergenic
945897091 2:215495866-215495888 TTTTGTACTGAGAAGAAAAAAGG - Intergenic
945986199 2:216355819-216355841 TTTTTAACACAGAAGAAAAAAGG - Intronic
946984343 2:225255526-225255548 ATTTGAACAGAGCTGGAACTAGG + Intergenic
947032835 2:225817542-225817564 TTTTGGAGAAAGAAGTAACAGGG + Intergenic
947051654 2:226051129-226051151 TCTTCAACAGAGATGGGACAAGG - Intergenic
947824191 2:233093159-233093181 TTTTGGACAGAGAAGGATTACGG + Intronic
947997146 2:234537627-234537649 TTTTAAATTGAGAACGAACATGG + Intergenic
948763043 2:240204402-240204424 AATTGAACAGAGCTGGAACAGGG + Intergenic
1168797674 20:622402-622424 TTTTGAGCAAAGGAGGGACATGG - Intergenic
1169100754 20:2946536-2946558 TTTTAAACAGAGAAATAAGATGG - Intronic
1169249632 20:4050427-4050449 TTTCCAGCAGAGGAGGAACATGG - Intergenic
1170301563 20:14890020-14890042 TTTTGAAGATAGAACCAACAGGG + Intronic
1170577549 20:17675808-17675830 TCTTGAACAGAGGAGTGACATGG + Intronic
1170962362 20:21036716-21036738 TTTTGAAGCAAGAAGGAAAATGG + Intergenic
1171155226 20:22865892-22865914 TTCTCAACAGAGGATGAACAGGG + Intergenic
1172115160 20:32569363-32569385 TTTTGAACAGAGAAGGAACATGG + Intronic
1172328635 20:34057947-34057969 CTTTGGACAGAGACAGAACAAGG - Intronic
1172739237 20:37152474-37152496 TCTTGAGCAGAGAAGGGACATGG + Intronic
1173401226 20:42727772-42727794 TTTTAAACACAAAAGTAACAAGG - Intronic
1174206994 20:48847347-48847369 TTTTTATAAGAGAAGGAAGAGGG - Intergenic
1174774920 20:53334649-53334671 TTTTGAACAGAGGAGTGACGTGG + Intronic
1175206391 20:57315025-57315047 TATTGAACAGAGGAGGAATCTGG - Intergenic
1175425308 20:58861280-58861302 TTTTCAAGAGAGAAGGGACAGGG + Intronic
1178726732 21:35059289-35059311 TTTTAAAAAAAGCAGGAACAAGG - Intronic
1178761291 21:35405206-35405228 GATTGTTCAGAGAAGGAACATGG - Intronic
1179414150 21:41184871-41184893 TTTGTAAAAGAGAAGGAAAATGG - Intronic
1181753392 22:25005778-25005800 TTCTCAACAGAGAAGACACAGGG - Intronic
1181904861 22:26186274-26186296 TCCTGAACAGAGAAGGAAGTGGG + Intronic
1182256856 22:29045398-29045420 TTTAGAACAGAGAAGGCACTGGG - Intronic
1182723399 22:32422926-32422948 TTTTTAACACAGAAGGACAATGG - Intronic
1183970164 22:41470991-41471013 TTTTGAACCGAAAAGGATCTTGG + Intronic
1184077659 22:42193146-42193168 ATTTCAACAGAAAAGGAAAAAGG + Intronic
949320140 3:2800635-2800657 TTCTGAACAGAGGAGTGACATGG - Intronic
949896414 3:8770139-8770161 TTTAGAATAGAGAAGGGGCAGGG - Intronic
949952097 3:9237832-9237854 TTTTAAACAGGGAAGTGACATGG + Intronic
950987055 3:17384649-17384671 TTTTTAGGAGAGGAGGAACATGG + Intronic
951089348 3:18554109-18554131 GTTAGAGAAGAGAAGGAACAGGG - Intergenic
951380617 3:21979897-21979919 TTTTGAAGAGAGGAGTATCAAGG - Intronic
951465331 3:22994675-22994697 TTTTGAAAACAGAAATAACAAGG + Intergenic
951781180 3:26364448-26364470 TTTTGGAGAGAGAGGCAACAGGG - Intergenic
951816257 3:26758455-26758477 CTTTGGAGAGAGACGGAACATGG + Intergenic
952614181 3:35249687-35249709 TTTTTATCAGAGAAATAACATGG + Intergenic
952710636 3:36428855-36428877 TTTTGAGCAGAGTAGTAAAATGG + Intronic
953480199 3:43244826-43244848 TAATGACCAGAGCAGGAACATGG - Intergenic
956619972 3:71212056-71212078 TATTTAACAAAGAAAGAACATGG - Intronic
958041476 3:88231195-88231217 TTATGAACAGAAAAAGACCAAGG - Intergenic
958122512 3:89309838-89309860 TTGTGAAAAGAGAAGAAAGAAGG - Intronic
959112749 3:102141666-102141688 TTTTGAACAGAGGAGAAAAATGG + Intronic
959313865 3:104777192-104777214 TATGGAAGAGAGAAAGAACAGGG + Intergenic
959572525 3:107900289-107900311 TTTTGAACACGGAAGTACCATGG - Intergenic
960130545 3:114051363-114051385 TCTGGAACAGCCAAGGAACAAGG - Intronic
961232824 3:125334475-125334497 TTTTCAAAAGAAAAGGAAGAAGG + Intronic
961338503 3:126200551-126200573 TTATGAACAGAAAACCAACATGG + Intergenic
961960446 3:130849007-130849029 TTTTAAAAAGAGAAGCAAAAGGG + Intergenic
962200379 3:133396457-133396479 TCATGCACAGAGAAGGAAAAGGG + Exonic
962322587 3:134404193-134404215 TTTGGAGCAGAGAAGTGACATGG + Intergenic
962778932 3:138692795-138692817 TTTTGAACCTAGAAAGAAAATGG + Intronic
962942557 3:140138937-140138959 TTTAGAACAGAGAAAGATCCAGG + Intronic
964179004 3:153860853-153860875 TGGAGAACTGAGAAGGAACAAGG + Intergenic
964301723 3:155294603-155294625 TTTTGAGCAGTGATGGAACATGG - Intergenic
964680417 3:159331824-159331846 CTTTAAGCAGAGAATGAACATGG - Intronic
965230373 3:166043563-166043585 TTTTGATGAGAAAAGGAAAATGG - Intergenic
965307224 3:167081414-167081436 GTGGGAAAAGAGAAGGAACAGGG + Intergenic
965904106 3:173681726-173681748 TTATGGTCAGTGAAGGAACACGG - Intronic
966657403 3:182374781-182374803 TTTTGGAGAGAAAAGGAAGAGGG - Intergenic
967415403 3:189211947-189211969 TTTTGTTCAGAGAAGGCACTAGG - Intronic
968015570 3:195329378-195329400 TTTAAAACACAGAAGGACCAGGG - Intronic
968978487 4:3834263-3834285 TTTTGCTCAGCAAAGGAACACGG - Intergenic
969170639 4:5359926-5359948 TTTTCAGCAGTGAAGAAACATGG + Intronic
970086312 4:12350579-12350601 TTTTGAACATATAAAAAACATGG - Intergenic
970203925 4:13637044-13637066 ATTTCAACAGAGAAGGGAGAAGG + Intergenic
970602916 4:17654503-17654525 TTTTCAACAGAGCAGGAAACTGG + Intronic
970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG + Intergenic
971637929 4:29087382-29087404 TTAAGAACAGAAAAGAAACAGGG + Intergenic
971816300 4:31494981-31495003 ATTTGAACAGAAAAGAATCATGG - Intergenic
972876343 4:43365686-43365708 TTTTGATCTGAGAAGAAACTAGG - Intergenic
972925245 4:43997607-43997629 GTTTGTACAGAGAAGGTACTAGG - Intergenic
973275465 4:48302289-48302311 TTCTGAACAGCAAAGGAAAAAGG + Intergenic
973342876 4:49024254-49024276 TTTTGAAGACAGCAGGAACTTGG + Intronic
973598691 4:52519501-52519523 TTCCCACCAGAGAAGGAACATGG - Intergenic
974356417 4:60818544-60818566 TTTTGAACAGAGAGGGAATATGG - Intergenic
974444372 4:61960534-61960556 TTTTGAGCAGAGGAGCAGCATGG + Intronic
975074930 4:70194298-70194320 TTATGGACAGAAAAGGAAAACGG + Intergenic
975319837 4:72997451-72997473 TTTTGACCATAGTAGGGACATGG - Intergenic
976136932 4:81947699-81947721 TTTTAAAGAGAGAAGAATCATGG - Intronic
976212715 4:82687838-82687860 TTTTGAACATAAAAGGAAGCTGG - Intronic
977141225 4:93375022-93375044 ATTTGTACAGGGAAGGACCAGGG + Intronic
977706955 4:100082118-100082140 TTTTGAGCAGATAAGAAACATGG + Intergenic
979562982 4:122120975-122120997 TCTGGAACAGAGAAAGTACAAGG + Intergenic
979652847 4:123156236-123156258 TTTTGAACAGAAAAAAAAAATGG + Intronic
980218956 4:129889994-129890016 TTTTTAAAAAAGAAGGAAGAGGG - Intergenic
980998173 4:139801612-139801634 ATTTGAAAAGAGCAGGAACAGGG + Intronic
981089626 4:140719444-140719466 TTTTCTACAGAGAAGGAAGCTGG + Intronic
981677055 4:147354393-147354415 TTTTGGACAGAGTTTGAACAGGG - Intergenic
984588337 4:181588136-181588158 TTTTGAAGCCAGCAGGAACAGGG + Intergenic
984739562 4:183147170-183147192 TTCTGAAAAGAGAAGGAAATAGG + Intronic
985044942 4:185931154-185931176 TGCTAAACAGAGAAGGAAAAAGG + Intronic
986526222 5:8680242-8680264 TTTTGGGAAGAGAAGGAAGAAGG - Intergenic
986567857 5:9133148-9133170 TTTTTAACTGAAATGGAACAAGG - Intronic
986921516 5:12689214-12689236 GTTTGAACAGAAAAGTACCATGG - Intergenic
987119588 5:14754218-14754240 TTTAAAATAGAGAAGGAAAATGG + Intronic
989760277 5:45007433-45007455 TTATGAAGAGCGAAAGAACACGG - Intergenic
990194563 5:53300045-53300067 TTTGGATCAAAGAAGAAACAAGG + Intergenic
990550150 5:56867688-56867710 TTTTGAAGAAAAAAGGAATATGG + Intronic
990622221 5:57571852-57571874 TTTGGAAAACAGAAGGAATATGG + Intergenic
990632633 5:57687378-57687400 TATTGAACTGAAAAGGAAAAGGG - Intergenic
990664743 5:58059657-58059679 TATTGTACAGAAAAGGAACATGG + Intergenic
990996725 5:61739559-61739581 TTTGAAACACGGAAGGAACAGGG + Intronic
991123709 5:63045705-63045727 TGTTGAACAGCAAAGGTACATGG + Intergenic
992366172 5:76092467-76092489 TTTTGAATGAAAAAGGAACATGG + Intronic
992900200 5:81287170-81287192 TTTTTAACAGAGAAGGCAAATGG + Intergenic
992962318 5:81968402-81968424 TATTGCAAAGACAAGGAACAAGG - Intergenic
994029007 5:95119594-95119616 TTTTGAAAAGATAAAGAAAATGG + Intronic
994251290 5:97540549-97540571 TTTTGGGCAGAAAAGGAAAAAGG - Intergenic
994547701 5:101187588-101187610 CTTTTATCTGAGAAGGAACATGG + Intergenic
994888049 5:105592019-105592041 TTTTGAACAGAGGACAAAGAAGG - Intergenic
995563460 5:113408326-113408348 TTTTGAAAATAGAACAAACATGG - Intronic
996138266 5:119872259-119872281 ATATGCACAGAGAAGGATCAAGG - Intergenic
997273475 5:132562240-132562262 TTTTGAGCAGGGAAAGGACATGG + Intronic
997538061 5:134638086-134638108 TTTTGAGCAGAACAGAAACATGG + Intronic
997863866 5:137443872-137443894 TTTTAAACAACGAAGGGACAGGG - Intronic
998235134 5:140392177-140392199 TTTTAAATAGAGGAGTAACAAGG - Intergenic
998761856 5:145440878-145440900 TTGTGACCACAGGAGGAACATGG - Intergenic
999229819 5:150055141-150055163 TTTTGGACAGGGAAAGATCAGGG + Intronic
999369210 5:151042989-151043011 AGATGAGCAGAGAAGGAACAAGG + Intronic
999649893 5:153755221-153755243 TTTTAAGCAGAAAAGCAACATGG + Intronic
1000076375 5:157791427-157791449 CTTTGCACAGAGGAGGAACATGG - Intronic
1000347652 5:160328251-160328273 TTTTAAACACAGGAGGAACAGGG + Intronic
1000842565 5:166239067-166239089 TTTTGCAAAAAAAAGGAACAAGG + Intergenic
1001584489 5:172824150-172824172 TTCTGAGCAGAGGAGGCACATGG + Intergenic
1001697756 5:173684956-173684978 TTGTGAAAAGCGAAAGAACAAGG - Intergenic
1002386499 5:178871102-178871124 TTTTGAGCACAGAAGCAATATGG - Intronic
1002849461 6:980652-980674 TTTTGCACATAGAAGGGACCTGG - Intergenic
1003082078 6:3028827-3028849 TTTTCTACCGAGAAGGAAAAAGG - Intergenic
1003611285 6:7617112-7617134 TTCTGAGCAGAGAAGTGACATGG - Intergenic
1004462235 6:15848404-15848426 TTCTGAGCAGGGAAGGAACAGGG - Intergenic
1004529072 6:16436802-16436824 TTTTGATCAGAGGAGGTACAGGG + Intronic
1006691018 6:35885507-35885529 ATTTGAACAGAGAAGCAGGAAGG - Intronic
1006843771 6:37048912-37048934 TTTTGAACAGAACAGCATCACGG + Intergenic
1007136094 6:39523361-39523383 TTTTTAACAGAAAAGTAGCATGG - Intronic
1007740745 6:44008170-44008192 TTATAAACAGAGAAGTAGCAGGG + Intergenic
1008386073 6:50892079-50892101 TTTTGAAAAAAGAAGCAAAAGGG + Intergenic
1008701491 6:54105946-54105968 TTTTGCCTAGAGAAGTAACATGG + Intronic
1008768660 6:54951654-54951676 TTTTCAACAGAGATGTAAAATGG + Intergenic
1009555261 6:65155946-65155968 TTTTTAACAGAAGAGTAACAAGG + Intronic
1009576096 6:65463097-65463119 TTTTGAGCAGAGGGGTAACATGG - Intronic
1010581937 6:77610007-77610029 TTTTCAGCAGAGAGGTAACATGG + Intergenic
1011482246 6:87806580-87806602 TTGTTAAAAGAGAAGGAACAGGG + Intergenic
1011708557 6:90027752-90027774 TTTTGTACATAGAAAGACCAAGG - Intronic
1012546522 6:100425460-100425482 TTTTGAACAGAGAAGCAGGAAGG - Intronic
1012772021 6:103450129-103450151 TATAGAACAGACAAGGCACATGG + Intergenic
1012792817 6:103720672-103720694 GTTTGAACAGTGAAGAAAAAAGG - Intergenic
1013346103 6:109262244-109262266 CTCGGAAGAGAGAAGGAACAAGG - Intergenic
1013458269 6:110351862-110351884 TGTGGAATAGAGAAGGAATAGGG - Intronic
1014215900 6:118752453-118752475 TAGTGAAGAGAAAAGGAACAAGG + Intergenic
1014302407 6:119698970-119698992 TTTTGAACATGGAAGAAAAAAGG - Intergenic
1014468145 6:121781691-121781713 TTTTAATCAGAGAAAAAACAAGG + Intergenic
1014649704 6:124020098-124020120 ATTTGAACAGAGAAGGCAGCTGG + Intronic
1014782216 6:125577220-125577242 TTTTGAACAGAGGAGTAGAATGG + Intergenic
1015391873 6:132691524-132691546 TTGTGAACATATAAGGAAAATGG + Intronic
1015427812 6:133092627-133092649 TTTGGAAGAGAGAAGTAAAAAGG - Intergenic
1015641075 6:135332833-135332855 TTATAGACAGAGAAGGAACGGGG - Intronic
1015819821 6:137248887-137248909 TTATGAACAGAAAGAGAACAGGG + Intergenic
1016435072 6:144027948-144027970 TTTTGAAAAGAGAGAGAACAAGG + Intronic
1016974907 6:149797865-149797887 TTTTAAACAGATAATCAACAGGG - Intronic
1017197943 6:151722316-151722338 CCTTGAACAGGGAAGAAACACGG + Intronic
1017409176 6:154150708-154150730 ATCTTGACAGAGAAGGAACAAGG - Intronic
1018637929 6:165881049-165881071 TTTTGAACAAAAAAGAAAAATGG + Intronic
1018943620 6:168329146-168329168 TTTTGAGCAGAGAAGTGACAAGG - Intergenic
1019076855 6:169394841-169394863 TCTTCAGCAGAGAGGGAACATGG + Intergenic
1019302242 7:311714-311736 TTTTTAGCAGACAAAGAACAGGG + Intergenic
1019596165 7:1859380-1859402 TTCTGCACAGGGAAGGATCAGGG + Intronic
1019764613 7:2841441-2841463 TCTTTAACAGAGAAGTTACAGGG + Intronic
1021018844 7:15570358-15570380 TTTTGAACAGAAGAGTCACATGG + Intergenic
1021258823 7:18428708-18428730 TTCTGAGCAGAGAAGAGACATGG - Intronic
1022039767 7:26569453-26569475 TTTTGAACATTTAAAGAACATGG + Intergenic
1024019935 7:45359593-45359615 TTTTCAGGAGAGAAGGAAGAGGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024924762 7:54601063-54601085 TATTGACCAGAAAAGAAACAAGG - Intergenic
1025247150 7:57326031-57326053 TTTTGAGGAGAGGAGGCACAGGG - Intergenic
1026372164 7:69711275-69711297 TTTAGAACTGGGTAGGAACAGGG + Intronic
1027567330 7:79812328-79812350 TTATGAATAGAGCAGTAACATGG - Intergenic
1027721354 7:81745772-81745794 TTTTAAAAAGAGTGGGAACATGG - Intronic
1028842219 7:95440962-95440984 TTTTAAAAAGAGAAAAAACATGG + Intergenic
1029327106 7:99819244-99819266 TATTGACCAGAGAAGGAGGAGGG - Intergenic
1029974987 7:104825348-104825370 CTGTGAAAAGAGAAGCAACATGG + Intronic
1030045164 7:105488837-105488859 TTTTCAACACAGAAAGAACTAGG - Intronic
1030152087 7:106417636-106417658 TCATGAATAGAGAAGGAAAAAGG + Intergenic
1030463602 7:109872130-109872152 TTTTGAACTGAGAAGGGGAAGGG + Intergenic
1030675777 7:112384145-112384167 TTTTGAGCCGAGAAGAAAAAAGG - Intergenic
1031085798 7:117300483-117300505 TTTTAAAGAGTGAAGAAACATGG - Intronic
1031247590 7:119336538-119336560 TTTTAAAGAAAGAAGGAATAAGG + Intergenic
1031321244 7:120331315-120331337 TTTGTAACAGAAAAGGATCAAGG + Intronic
1031644448 7:124206561-124206583 ATGTATACAGAGAAGGAACAAGG - Intergenic
1031952681 7:127908488-127908510 TTTTTCACAGAGTAGGAACTGGG + Intronic
1032309403 7:130769348-130769370 CTTTAAACAGAAAAGTAACATGG + Intergenic
1032790501 7:135238990-135239012 TTTGGAACAGGGCAGGAAGATGG - Intronic
1032856029 7:135834315-135834337 TCATGAGCAGAGAAGGAAGAAGG + Intergenic
1033009616 7:137606625-137606647 TTTTGAACAGAGGAATAATATGG - Intronic
1033595981 7:142857973-142857995 TTTGAAACATAGAAGGAAAATGG + Intronic
1033605421 7:142924480-142924502 ATATGCACAGAGAAAGAACAGGG - Intronic
1033610466 7:142959607-142959629 TTTAGCAAAGAGAAGAAACAGGG + Intronic
1033890811 7:146011068-146011090 TTTTGAACAAAGAAGTGACAAGG - Intergenic
1036697531 8:10987655-10987677 CTTTGAGCAGAGAAGAGACAGGG - Intronic
1036734709 8:11301863-11301885 TATGGAACAGAGAAGGAAGATGG + Intronic
1037020494 8:13964403-13964425 TTATGAACAGAGCAGGAAGAAGG - Intergenic
1037177435 8:15963543-15963565 GTTTGAAAAGACAAGGAAAAGGG - Intergenic
1037641895 8:20752170-20752192 TTTAGTACAGAGCAGGAACTTGG - Intergenic
1037848465 8:22305904-22305926 CTTTGAAGAGAGAACGAAGAGGG - Intronic
1038040366 8:23718988-23719010 TTCTGAAGAGTGAGGGAACAGGG + Intergenic
1039741295 8:40385304-40385326 TATGTAACAGAAAAGGAACATGG + Intergenic
1039797876 8:40930886-40930908 CTTTGAGCAGAGAAATAACATGG - Intergenic
1039978608 8:42387901-42387923 TTTTTAACAGATAAGGATCTTGG + Intergenic
1040698103 8:50027112-50027134 TTTTAAACACAGAAATAACATGG - Intronic
1042209554 8:66366297-66366319 TTTTAAGCAGAGGAGTAACATGG - Intergenic
1042942906 8:74125595-74125617 TTTTCAAAAGAGAAGAAACATGG - Intergenic
1043248853 8:78043173-78043195 TTTTAATCAGAGAAGGATAAAGG - Intergenic
1043302237 8:78748000-78748022 CTTTGAAGAGAGAGGGATCATGG + Intronic
1044050926 8:87502911-87502933 TTCTGAACTGAGAGGGAGCAGGG - Intronic
1045740284 8:105350319-105350341 TTTTGAAAAGGAAAGGAACATGG + Intronic
1046116137 8:109786081-109786103 TTTTAAAATGAAAAGGAACATGG - Intergenic
1046570031 8:115951569-115951591 TTCTGAACAGAAAAGAAAAATGG + Intergenic
1046647109 8:116797661-116797683 TTTTGAAAAGAGAAACAAAATGG - Intronic
1048227738 8:132605667-132605689 TTTAGAATACAGCAGGAACAGGG + Intronic
1050513153 9:6414817-6414839 TTTTAAAGAGAGAAGGAAAGGGG - Intronic
1050515511 9:6439865-6439887 TTTTGAACAGAAAAGGGAGGAGG + Intronic
1050734609 9:8748666-8748688 TTTTGAACAGCCAAGGCAGACGG + Intronic
1051223834 9:14878121-14878143 TTTTGAGCAGAGCAGTGACATGG - Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1052278755 9:26708401-26708423 TTTTGAGCAGACAAGCACCATGG + Intergenic
1052597731 9:30582088-30582110 TTTTTAAGACAGAAGGAATACGG + Intergenic
1053244777 9:36525781-36525803 TTTTGAATTGAAAAGGAAAAGGG + Intergenic
1053708669 9:40782482-40782504 TTTTGTAGAGAAAAGGAAGAGGG - Intergenic
1054418578 9:64903277-64903299 TTTTGTAGAGAAAAGGAAGAGGG - Intergenic
1054703641 9:68439280-68439302 TCTTGAACACAGGAGGGACAAGG + Intronic
1054884031 9:70176075-70176097 GGTTGAACATTGAAGGAACAGGG + Intronic
1054959698 9:70954210-70954232 TCCTGAACAGGGAAGGAAGAGGG - Intronic
1055157114 9:73077743-73077765 TTTAGAAAAGAGAATGAACCTGG + Intronic
1055933384 9:81582361-81582383 TTTTGAATATATAAAGAACAAGG + Intergenic
1056067538 9:82952728-82952750 TTGTGAACAGAGTAGGAAATGGG + Intergenic
1056550591 9:87650238-87650260 TTTGGAACAGAGAAGAGACGGGG - Intronic
1056750188 9:89344885-89344907 TTTAAAGAAGAGAAGGAACAAGG + Intronic
1056824548 9:89867795-89867817 TTTTGAAGAGATAGAGAACATGG + Intergenic
1056904195 9:90631417-90631439 TTTTGAGCAGAGAAGTGATACGG + Intronic
1057800435 9:98187832-98187854 TTTTGAATTGGGTAGGAACATGG - Intronic
1057926538 9:99156547-99156569 TTTTGTAGGGAGAGGGAACAGGG - Intergenic
1058664855 9:107303034-107303056 TTTAAAGCAGAGAATGAACATGG + Intronic
1059464274 9:114457521-114457543 TAATAAACATAGAAGGAACATGG + Intronic
1059914617 9:119085160-119085182 TCTTGATCAGAGAAGAATCAAGG + Intergenic
1059946584 9:119414751-119414773 ATTTTAACAGAGAAGACACATGG - Intergenic
1060857212 9:126924458-126924480 TGTTGAACAGAGAAGCAGCCTGG + Intronic
1061904266 9:133688565-133688587 TGCTGAGCAGAGGAGGAACATGG - Intronic
1062631634 9:137465626-137465648 TTCTGAACAGAGAGGGGAGAAGG + Intronic
1186119464 X:6343728-6343750 TTGTGAACAGTGAAGGAAGTTGG + Intergenic
1186397797 X:9227274-9227296 ATTTGAACAGAATAGGAAGAAGG + Intergenic
1187470518 X:19565422-19565444 GTTTTTACAGTGAAGGAACAGGG - Intronic
1187739079 X:22335661-22335683 TTTTGAACAAAGAAAGAATGGGG - Intergenic
1187998722 X:24957777-24957799 TTTTAAGCAGAGAAGGGGCATGG + Intronic
1188578136 X:31678363-31678385 TTTTGAGCAGGGAAGTAACATGG - Intronic
1189459572 X:41228290-41228312 TTTTTAACACAAAAGAAACAAGG + Intronic
1190170329 X:48107351-48107373 TTTTGTAGAGATAAGGGACAGGG + Intergenic
1190738604 X:53272460-53272482 TGTTTAACAGATAAGGAACTAGG + Intronic
1191058050 X:56263881-56263903 TTTGGAAGAGAGGAGTAACAAGG - Intronic
1192680779 X:73251474-73251496 TTTTGGATGGAGAAGGAAAATGG - Intergenic
1195614342 X:106900909-106900931 CTGTGGACAGAGAAGAAACATGG + Intronic
1195994455 X:110717753-110717775 TTTTGAACAGGGGTGTAACACGG + Intronic
1196040889 X:111202483-111202505 TTTGGCAAAGAGAAGGAACAAGG - Intronic
1196194872 X:112829063-112829085 TATTGAACAGACCTGGAACAGGG - Intronic
1196201909 X:112896079-112896101 TCTTGGACAGATAAGCAACATGG - Intergenic
1196712293 X:118775396-118775418 TTTTGAGCAGAGTAGGCACATGG + Intronic
1197378112 X:125707194-125707216 TTTTAAACAAGGAAGAAACATGG + Intergenic
1197777334 X:130127170-130127192 TTTTAAACAGGGAGGGGACATGG + Intergenic
1198432796 X:136584629-136584651 GTTTGGACACAGAAAGAACAGGG - Intergenic
1198977376 X:142351902-142351924 TTGTGAAGAGTGAAAGAACAAGG - Intergenic
1199456705 X:148037351-148037373 TTTTGAGCAGAGGAGGGGCAGGG + Intergenic
1199798912 X:151230294-151230316 TTTTGAGCAGAGAAGGGATTTGG + Intergenic
1200946972 Y:8852261-8852283 TTGTGAAGAGTGAAAGAACAAGG + Intergenic
1201538784 Y:15083707-15083729 CTGTCAACAGAGAACGAACAAGG - Intergenic
1201705402 Y:16930945-16930967 TTCAGAACAGAGAATTAACAAGG + Intergenic