ID: 1172120594

View in Genome Browser
Species Human (GRCh38)
Location 20:32596488-32596510
Sequence TAAGGTTATAGAGATGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172120594_1172120598 21 Left 1172120594 20:32596488-32596510 CCACCAGCATCTCTATAACCTTA No data
Right 1172120598 20:32596532-32596554 CACACTGAGCCTTGACATCTTGG 0: 1
1: 0
2: 0
3: 27
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172120594 Original CRISPR TAAGGTTATAGAGATGCTGG TGG (reversed) Intronic
No off target data available for this crispr