ID: 1172122184

View in Genome Browser
Species Human (GRCh38)
Location 20:32604938-32604960
Sequence GGCTCCTGAAGGTCCCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 187}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172122171_1172122184 20 Left 1172122171 20:32604895-32604917 CCTTTCTCACCCACCTGAGGCCC 0: 1
1: 0
2: 1
3: 34
4: 343
Right 1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 187
1172122169_1172122184 26 Left 1172122169 20:32604889-32604911 CCAGGACCTTTCTCACCCACCTG 0: 1
1: 0
2: 4
3: 33
4: 253
Right 1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 187
1172122174_1172122184 10 Left 1172122174 20:32604905-32604927 CCACCTGAGGCCCCACCTTTGGA 0: 1
1: 0
2: 1
3: 23
4: 197
Right 1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 187
1172122175_1172122184 7 Left 1172122175 20:32604908-32604930 CCTGAGGCCCCACCTTTGGACCT 0: 1
1: 0
2: 2
3: 20
4: 202
Right 1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 187
1172122179_1172122184 -2 Left 1172122179 20:32604917-32604939 CCACCTTTGGACCTACTTAAGGG 0: 1
1: 0
2: 1
3: 2
4: 49
Right 1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 187
1172122168_1172122184 27 Left 1172122168 20:32604888-32604910 CCCAGGACCTTTCTCACCCACCT 0: 1
1: 0
2: 4
3: 25
4: 251
Right 1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 187
1172122177_1172122184 -1 Left 1172122177 20:32604916-32604938 CCCACCTTTGGACCTACTTAAGG 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 187
1172122181_1172122184 -5 Left 1172122181 20:32604920-32604942 CCTTTGGACCTACTTAAGGGCTC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 187
1172122172_1172122184 11 Left 1172122172 20:32604904-32604926 CCCACCTGAGGCCCCACCTTTGG 0: 1
1: 0
2: 3
3: 21
4: 193
Right 1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 187
1172122176_1172122184 0 Left 1172122176 20:32604915-32604937 CCCCACCTTTGGACCTACTTAAG 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172122184 Original CRISPR GGCTCCTGAAGGTCCCCTGA AGG Intronic
900212226 1:1461776-1461798 GGCTCCTCATGGTCCACTGCTGG + Intronic
900224898 1:1528434-1528456 GGCTCCTCATGGTCCACTGCTGG + Intronic
900247417 1:1643505-1643527 GGTTCCTGAAAATCACCTGACGG + Intronic
900258641 1:1710637-1710659 GGTTCCTGAAAATCACCTGACGG + Intronic
900925604 1:5704324-5704346 TGCTCCAGCAGGTCCCCGGAGGG - Intergenic
910673943 1:89799022-89799044 GGTTCCAGAAGGTCTCCTGCAGG - Intronic
912383228 1:109258722-109258744 CGCTCCTGCAGGTCCTCAGAGGG - Exonic
912734854 1:112141668-112141690 GGCTGCTGGAGGACACCTGAAGG - Intergenic
916957829 1:169858443-169858465 ACCTCCTGAAGGACCCCTGGAGG + Intronic
922335928 1:224617941-224617963 GACTCCTGAAGACCCCCTGCAGG + Intronic
1063127371 10:3147591-3147613 GTCTCCTGCAGGTCCCCTGCGGG + Exonic
1063421484 10:5915963-5915985 GGCTCCAGAAGGTCCCCGGAGGG - Intronic
1069160122 10:65083290-65083312 GGCTGGTGAAGGACACCTGAAGG - Intergenic
1070794158 10:79207308-79207330 TCCTCCTGAAGGACCCCTGGAGG - Intronic
1071529075 10:86375400-86375422 GGCTTCTGAAGGTCACAGGACGG - Intergenic
1074823120 10:117196382-117196404 GTCTCCTGGAGGTTCCTTGAGGG + Intergenic
1075420623 10:122297868-122297890 TGCTCCTGAAGGCCCCCCCAAGG - Intronic
1075585067 10:123651559-123651581 GGCTCATGATGGGCCCCTCATGG + Intergenic
1077184262 11:1229318-1229340 GGGACCTGAAAGCCCCCTGAGGG - Intronic
1078662136 11:13296174-13296196 GGGTCCTGAGGGTTCCCAGAAGG - Intronic
1079459386 11:20667074-20667096 GGCTCCTGAAGAACCCATGGAGG + Intergenic
1080871000 11:36236925-36236947 GGCTCCTGATGGTTCTCTGATGG - Intergenic
1082179177 11:49098171-49098193 GGCTGCTGGAGGACCTCTGAGGG + Intergenic
1083268052 11:61556077-61556099 GGCTCCTGAGGGCCCCTTGGAGG - Intronic
1084430715 11:69109409-69109431 AGCTCCTCGAGGTTCCCTGAAGG + Intergenic
1084431640 11:69114583-69114605 GGCCCCAGAAGGACCCCTGTAGG - Intergenic
1086436135 11:86782711-86782733 TTCTCATGCAGGTCCCCTGAAGG + Intergenic
1086686109 11:89734751-89734773 GGCTGCTGTAGGACCTCTGAGGG - Intergenic
1086690761 11:89787062-89787084 GGCTCCTGGAGCGCCCCTGCCGG + Intergenic
1086700428 11:89895585-89895607 GGCTGCTGGAGGACCCCTGAGGG + Intergenic
1086705741 11:89948941-89948963 GGCTGCTGGAGGACCCCTGAGGG - Intergenic
1086715039 11:90052597-90052619 GGCTCCTGGAGCGCCCCTGCCGG - Intergenic
1088610562 11:111572266-111572288 GGCTCCAGCAGGTCCGCTGTGGG + Intergenic
1088884674 11:113997496-113997518 CACTCCTAAAAGTCCCCTGAAGG + Intergenic
1089848779 11:121479579-121479601 GGGTCCTGGACGTCCCCTGCTGG + Intronic
1090335574 11:125960955-125960977 GGCTGCTGAAGGACCTCTGTCGG + Exonic
1095079736 12:37985101-37985123 GGCTCCCAAATGTCCCCTCATGG - Intergenic
1096112777 12:49039195-49039217 GGCTCCAGGAGGTTCCCTGGGGG - Intronic
1098029830 12:66242305-66242327 GGCTCCTGGAGATGCCCTGAGGG - Intronic
1098817107 12:75181507-75181529 GGCTGCTGAGGGTTCCCTAATGG + Intronic
1102260121 12:111438328-111438350 GGCTCCTGATGGTGCCCTTGCGG + Intronic
1103932482 12:124457944-124457966 GGCTCCTGAAGGTGGCTTCATGG + Intronic
1104073060 12:125363312-125363334 GGCTTCAGAAGGTCTCATGAAGG - Intronic
1104844689 12:131840872-131840894 GGCTCCTGACTCTGCCCTGAGGG - Intronic
1106568446 13:30906435-30906457 GGCACCTGATGGTCCCCAGGAGG - Exonic
1112504688 13:99968846-99968868 GGCTCCTGCGGGCCGCCTGATGG - Intronic
1114269599 14:21092636-21092658 GGCTCCCGAGCGTCCCCTGGCGG - Exonic
1117825820 14:59702686-59702708 GGTTCCTGAAGAGCCTCTGATGG + Intronic
1122945539 14:105006962-105006984 GGGTGCTGAAGGGTCCCTGAAGG + Intronic
1123011289 14:105350741-105350763 GGTCCCTGCAGGTCCTCTGAGGG + Intronic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1124578262 15:30928098-30928120 GCCTCCGGGAGGTCCCCTTAGGG + Intronic
1125513232 15:40303857-40303879 GGCTCCAGAGGCTCCCCTGTAGG - Intronic
1126433279 15:48609538-48609560 GTCTCCTGAAGTTCCCCAGTGGG - Intronic
1129662004 15:77558137-77558159 GGCTCCAGAAGGGTCCTTGAAGG + Intergenic
1130300994 15:82679982-82680004 GGATCCTGAGGGGCCGCTGAGGG - Intronic
1130948728 15:88568837-88568859 TGCTGCTTAATGTCCCCTGAGGG - Intergenic
1132211701 15:100028672-100028694 GCCTGCTGCAGGTCCCCTGCTGG + Intronic
1132559273 16:585779-585801 TGCTTCTGAGGGTGCCCTGAGGG - Intergenic
1132846400 16:2002871-2002893 GGCCCCGGATGGCCCCCTGAGGG - Intronic
1132882108 16:2167065-2167087 GGCCCCTGGAGAGCCCCTGAGGG - Intronic
1133050607 16:3115412-3115434 GACTCCTGAGTGTCCCCTGAAGG - Exonic
1133295875 16:4752047-4752069 GGCTCCTGAAGGGCCTGGGAGGG - Exonic
1136546786 16:30958905-30958927 GGCGCCTGGAGCTCCCCGGATGG - Intronic
1139470594 16:67176185-67176207 AGCTCCTGAAGGTTCCGTGGGGG - Exonic
1142363500 16:89638109-89638131 GGCTCCTGCAGGACCCATTACGG + Exonic
1143278948 17:5736130-5736152 GGCTCTTGAAGCTCACCTAATGG + Intergenic
1144672104 17:17138686-17138708 GGGACCTTAAGGTTCCCTGATGG + Intronic
1145795751 17:27654436-27654458 GCCTGCTGAAGGTCCCCAGCAGG - Intergenic
1145810199 17:27759769-27759791 GCCTGCTGAAGGTCCCCAGCAGG - Intronic
1146666796 17:34710498-34710520 GGCTTCTGAAGGTCCTCTCTGGG - Intergenic
1147624825 17:41893215-41893237 GGCCCCTGCAGGTCTCCTGGGGG - Intronic
1147885001 17:43678468-43678490 GTCTCCTGACAGTCCCCAGAGGG - Intergenic
1148238143 17:45983066-45983088 GGCTCCTGAGGGCCTCCTGTTGG - Intronic
1149864501 17:60143234-60143256 GGCTGGTGAAGGTCCCTTGGCGG - Intergenic
1150602976 17:66666508-66666530 AGCTTCTCAAAGTCCCCTGAAGG - Intronic
1151188132 17:72378873-72378895 GGCTCCTGGAGGACTCCTGCTGG + Intergenic
1151379763 17:73717586-73717608 GGATACTGAATGTCCCCTGTGGG - Intergenic
1152757416 17:82092779-82092801 TGCTCCTGGATATCCCCTGAGGG + Exonic
1155353146 18:24926009-24926031 GGCCACTGAAGCTGCCCTGAAGG + Intergenic
1155663767 18:28282410-28282432 TCCCCCTGCAGGTCCCCTGATGG - Intergenic
1157148273 18:45188575-45188597 GGATCCTGGAGGTCCTGTGATGG - Intergenic
1158830619 18:61273895-61273917 GGCACTTGAAGGTCATCTGAAGG + Intergenic
1160610759 18:80083329-80083351 GCCCCATGAAGATCCCCTGAGGG + Intronic
1161356664 19:3822976-3822998 GGCTCCGCAGGGTCCCCTGTTGG + Intronic
1161647912 19:5465701-5465723 GGCTCCCCAAGGTCCCCAGTGGG - Intergenic
1164388510 19:27795977-27795999 TGCTCTTAAAGGACCCCTGAAGG - Intergenic
1167721177 19:51181641-51181663 GGCTCCTGGTGATCTCCTGAGGG + Intergenic
1167736324 19:51296592-51296614 GGCTCCTCAAGATTCCCTGTAGG + Intergenic
1168403033 19:56097042-56097064 GGCTCCTGAAGATCTCAGGAGGG - Intronic
925600863 2:5607612-5607634 GGCTCCAAAAGGTCCACTGAAGG - Intergenic
926704158 2:15825074-15825096 GGCTTCTGAAGGTACACTGCAGG - Intergenic
928411499 2:31057887-31057909 CCCTCCTGAAGGTCTCCTGCAGG - Intronic
929229788 2:39547739-39547761 GGCTTTTGAAGCTCCCCAGATGG - Intergenic
929536445 2:42787207-42787229 GGTGCCTGAGTGTCCCCTGAGGG - Intronic
933168199 2:79097293-79097315 GGGGCCTGCAGGGCCCCTGATGG + Intergenic
934580880 2:95436729-95436751 AGCTGCTGGAGGACCCCTGAGGG - Intergenic
934588461 2:95526450-95526472 GGCTCCTGGAGCGCCCCTGCCGG + Intergenic
934598571 2:95639986-95640008 AGCTGCTGGAGGACCCCTGAGGG + Intergenic
934614813 2:95764367-95764389 GGTTCCGGAAGATCCCATGAGGG - Intergenic
934646090 2:96060127-96060149 GGTTCCGGAAGATCCCATGAGGG + Intergenic
934839493 2:97616210-97616232 GGTTCCGGAAGATCCCATGAGGG + Intergenic
935589734 2:104835440-104835462 AGCTCCTGAAAGCCCTCTGAAGG - Intergenic
935732322 2:106074237-106074259 GCCTCCTGAATGTACCCTGGTGG - Intronic
935785467 2:106544755-106544777 GACTCCTGAAGGTCCCCTCCCGG - Intergenic
938364819 2:130726602-130726624 GGCTCTTGAAGGGCCACGGATGG + Intergenic
938449161 2:131401030-131401052 GGCTCCTGAGTGTCCCCTCCTGG - Intergenic
946076246 2:217076168-217076190 AGATGCTGGAGGTCCCCTGATGG + Intergenic
947597984 2:231426020-231426042 GACTCATGATGGGCCCCTGAGGG + Intergenic
1171091543 20:22290163-22290185 GGATGCTGAAAGCCCCCTGAAGG + Intergenic
1171107522 20:22449221-22449243 GGCTCCTAGAGGTCCCCAGCAGG + Intergenic
1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG + Intronic
1173158036 20:40631444-40631466 GGCACCTGAATTTCCCCTGAAGG - Intergenic
1174369550 20:50077454-50077476 GGCTCCCTAAGGTTCTCTGAGGG + Intergenic
1177259292 21:18708296-18708318 GAGTCCTGAAGGTGCCCTGATGG + Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1180831491 22:18909219-18909241 GGCCCCTGAGGCTCCCCTGCAGG - Intronic
1181030402 22:20146737-20146759 GGTTCCTGAGAGTCCCCTGTGGG - Intronic
1181068361 22:20317148-20317170 GGCCCCTGAGGCTCCCCTGCAGG + Intronic
1181529912 22:23511555-23511577 GGTGCCTGAAGGTCCCCTCTTGG + Intergenic
1184747337 22:46464042-46464064 TGCTCCTGCAGGTCCTCCGACGG + Exonic
1203281575 22_KI270734v1_random:134490-134512 GGCCCCTGAGGCTCCCCTGCAGG - Intergenic
950563868 3:13752716-13752738 GCATCCTGCAGGTCCCTTGATGG + Intergenic
952341376 3:32450503-32450525 GGCTCCTGGAATTCCACTGAGGG + Intronic
952885931 3:38010967-38010989 GGGTCCTCAAAGCCCCCTGAAGG + Intronic
953292119 3:41675809-41675831 GGTTCCTTCAGGTGCCCTGAGGG - Intronic
953358952 3:42278338-42278360 GGCTCCTGGAGTTCCCCAGTAGG + Intergenic
954365087 3:50141352-50141374 GCCTCCTGCAGGCCCCATGATGG - Intergenic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
961442975 3:126963714-126963736 AGCTTCTGAAGCTGCCCTGAGGG - Intergenic
962191960 3:133319828-133319850 GACTCATGAAGGTCCCATGAAGG - Intronic
962669083 3:137686607-137686629 GGTTCCTGAAGCTTCCCTGTGGG + Intergenic
964003825 3:151807438-151807460 GGCTGCTGCAGTTCCCCTGGAGG + Intergenic
966175335 3:177132360-177132382 AGCTCCTTCAGGTCCACTGATGG + Intronic
966855491 3:184191112-184191134 ACCTCCTGCAGGTTCCCTGATGG + Exonic
968377226 4:53631-53653 GGCTCCTGTCGGTCCCCGCACGG + Intronic
968731280 4:2270486-2270508 GGCTCCTCCGGGTCCCCTGCTGG + Exonic
969284190 4:6192333-6192355 AGCTCCAGGAGGTCCCCTGGTGG + Intronic
969594385 4:8140703-8140725 GCCTCCTGAAGGTCCCACGGAGG + Intronic
972595463 4:40526085-40526107 GAATTCTGAAGGTCCCATGAAGG - Intronic
978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG + Intronic
981575730 4:146203023-146203045 GGCTGCAGAACGTCCCCTAAAGG - Intergenic
981679649 4:147381873-147381895 TTCTCCTATAGGTCCCCTGATGG - Intergenic
985347843 4:189025598-189025620 TTCTCCTGAAGGTCCCATGTGGG - Intergenic
985717801 5:1472352-1472374 GGTCCCTGAAGGTCTTCTGAGGG + Intronic
985758637 5:1733559-1733581 GGCTGCTGAGGGGCCCCTGAGGG - Intergenic
986306428 5:6520139-6520161 GGCACGGGAAGGACCCCTGAAGG + Intergenic
986741699 5:10710655-10710677 GGCTGGAGAAGGTGCCCTGAAGG + Intronic
994589386 5:101754675-101754697 GGCTTGTGAAGGAGCCCTGAAGG + Intergenic
996342177 5:122451167-122451189 GGCTGCTGAGGGTCACCAGAGGG - Exonic
1001329596 5:170752775-170752797 TGCTCCTGAAGGTGACGTGAGGG + Intergenic
1002971308 6:2023475-2023497 GCCTGCAGAAGGGCCCCTGAAGG - Intronic
1005164126 6:22899638-22899660 GTTCCCTGAAGGTGCCCTGATGG + Intergenic
1005876548 6:30014370-30014392 TCATCATGAAGGTCCCCTGAAGG + Intergenic
1006129221 6:31859306-31859328 GGCTGGTGAAAGTCCCCAGATGG - Exonic
1006439728 6:34046538-34046560 GTCTCCTGGAGGTCCCCAGCAGG - Intronic
1007693159 6:43715929-43715951 GGCTCCTGAGGATCCGCTCATGG - Intergenic
1018696611 6:166396237-166396259 GCCTCCTGAGGGACCCCTGCTGG - Intergenic
1018696621 6:166396279-166396301 GCCTCCTGAGGGACCCCTGCTGG - Intergenic
1018696632 6:166396321-166396343 GCCTCCTGAGGGACCCCTGCTGG - Intergenic
1018696642 6:166396363-166396385 GCCTCCTGAGGGACCCCTGCTGG - Intergenic
1018696652 6:166396405-166396427 GCCTCCTGAGGGACCCCTGCTGG - Intergenic
1018696663 6:166396447-166396469 GCCTCCTGAGGGACCCCTGCTGG - Intergenic
1018696674 6:166396489-166396511 GCCTCCTGAGGGACCCCTGCTGG - Intergenic
1019305542 7:332774-332796 GGGCCCTGCAGGTCCCCCGAGGG + Intergenic
1020008194 7:4793199-4793221 GCCTCCTGGAGGCCACCTGAAGG - Intronic
1023290184 7:38660182-38660204 TCCACCTGTAGGTCCCCTGATGG - Intergenic
1024746852 7:52417254-52417276 GGCACCTGAAGGTTGCCTGAAGG + Intergenic
1025712948 7:63928247-63928269 TGCTCTGGAAGGACCCCTGAAGG - Intergenic
1027418582 7:77998141-77998163 GGCTCATTGAGGTCACCTGAGGG + Intergenic
1030628169 7:111866637-111866659 GGATCCTGGAGGTCCCCCTAAGG - Intronic
1033555067 7:142482194-142482216 GGCTCCTCATCCTCCCCTGATGG + Intergenic
1037578519 8:20230641-20230663 GGCTCCTGAGGGACCCAGGAAGG + Intergenic
1037787239 8:21910334-21910356 GGCTCCAGCAGTTCCCATGAAGG - Intronic
1038224080 8:25638638-25638660 GACTCCTGTAGGGACCCTGAAGG - Intergenic
1038450712 8:27637285-27637307 GGCACCTGAGTGTCCCCTTAGGG - Intronic
1038487929 8:27949823-27949845 GGCTCCTGAAGAGGCCCTGCAGG + Intronic
1038577626 8:28718163-28718185 GGCCACAGAAGGTCCTCTGATGG - Exonic
1039825777 8:41173047-41173069 CGCTCCTCAAGGTCACCAGAAGG - Intergenic
1040283068 8:46078302-46078324 GGCTCCTAAATGTCCACTCAAGG - Intergenic
1040946145 8:52886622-52886644 GGATCCTGAAGGGATCCTGAAGG - Intergenic
1041908048 8:63055003-63055025 GGCTCCTGAAAAACCCCTTAGGG + Intronic
1043496840 8:80810780-80810802 GATTCCTGTATGTCCCCTGAAGG - Intronic
1047459508 8:125048872-125048894 GGCTCCTGAAAGTACTCTGAAGG + Intronic
1048461159 8:134623028-134623050 GCCTCCTGTTGGTACCCTGATGG + Intronic
1049213843 8:141398851-141398873 GGCTCCTGCAGCTCCCCAGAGGG - Intronic
1049415483 8:142492980-142493002 GGCTCCTGAAGGCCACCAGCAGG - Intronic
1049796054 8:144497727-144497749 GGCTCCTGGGGGTCCACTCATGG - Intronic
1049865393 8:144932340-144932362 GGCTCCTTAGGGGCCCCTTAGGG - Exonic
1053432434 9:38051895-38051917 GCCTCCTTTAGGTCCCCAGAGGG - Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1056121601 9:83493823-83493845 GGTTCCTGAAGATTCCCTGAAGG - Intronic
1057123844 9:92600865-92600887 GGATGGTGCAGGTCCCCTGAGGG + Intronic
1060343491 9:122797182-122797204 GGCTCCTGAATGTCCCGAGTTGG + Intergenic
1061250694 9:129424730-129424752 GGGTGAGGAAGGTCCCCTGAGGG - Intergenic
1061362923 9:130155179-130155201 GGCTCCTGAGGTTCCACAGATGG - Intergenic
1062125136 9:134856166-134856188 GTCTCCAGAGGCTCCCCTGAGGG - Intergenic
1203572010 Un_KI270744v1:140615-140637 GGCTCCTGTCGGTCCCCGCACGG - Intergenic
1186584051 X:10852423-10852445 GGCTGCTGAAGCTTCCCTCATGG + Intergenic
1187522418 X:20025488-20025510 GTCTTCTGAGGGTCCCCTGGAGG - Intronic
1187830985 X:23380741-23380763 GTCTCCCAAAGGTCCCCTGTGGG - Intronic
1191579897 X:62749029-62749051 GGCTCCCAAATGTCCCCTCACGG + Intergenic
1197767210 X:130067011-130067033 GGTTCCTGAAGAGACCCTGAGGG - Exonic
1197772856 X:130100479-130100501 GTCTCCTCATGGTCCCCTGAGGG + Intronic
1200225007 X:154412369-154412391 GGCTCCTGCAGCATCCCTGAGGG + Intronic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic