ID: 1172123216

View in Genome Browser
Species Human (GRCh38)
Location 20:32610631-32610653
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172123209_1172123216 22 Left 1172123209 20:32610586-32610608 CCATACACTTGAAGGGGATGGCT No data
Right 1172123216 20:32610631-32610653 CGAGCGAGTGAGCGGGTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172123216 Original CRISPR CGAGCGAGTGAGCGGGTGCC CGG Intergenic
No off target data available for this crispr