ID: 1172126091

View in Genome Browser
Species Human (GRCh38)
Location 20:32626198-32626220
Sequence CCACAGGCATGCTGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172126091_1172126105 23 Left 1172126091 20:32626198-32626220 CCCACTTCCCAGCATGCCTGTGG No data
Right 1172126105 20:32626244-32626266 CCCAGGAGACCAGAGCCAAAAGG No data
1172126091_1172126097 -5 Left 1172126091 20:32626198-32626220 CCCACTTCCCAGCATGCCTGTGG No data
Right 1172126097 20:32626216-32626238 TGTGGTGACTAGCGCCCACCCGG No data
1172126091_1172126098 6 Left 1172126091 20:32626198-32626220 CCCACTTCCCAGCATGCCTGTGG No data
Right 1172126098 20:32626227-32626249 GCGCCCACCCGGAGCGCCCCAGG No data
1172126091_1172126107 24 Left 1172126091 20:32626198-32626220 CCCACTTCCCAGCATGCCTGTGG No data
Right 1172126107 20:32626245-32626267 CCAGGAGACCAGAGCCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172126091 Original CRISPR CCACAGGCATGCTGGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr