ID: 1172126097

View in Genome Browser
Species Human (GRCh38)
Location 20:32626216-32626238
Sequence TGTGGTGACTAGCGCCCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172126089_1172126097 21 Left 1172126089 20:32626172-32626194 CCACCTTCTCAGTAGGCTGCGAG No data
Right 1172126097 20:32626216-32626238 TGTGGTGACTAGCGCCCACCCGG No data
1172126093_1172126097 -6 Left 1172126093 20:32626199-32626221 CCACTTCCCAGCATGCCTGTGGT No data
Right 1172126097 20:32626216-32626238 TGTGGTGACTAGCGCCCACCCGG No data
1172126091_1172126097 -5 Left 1172126091 20:32626198-32626220 CCCACTTCCCAGCATGCCTGTGG No data
Right 1172126097 20:32626216-32626238 TGTGGTGACTAGCGCCCACCCGG No data
1172126090_1172126097 18 Left 1172126090 20:32626175-32626197 CCTTCTCAGTAGGCTGCGAGCTT No data
Right 1172126097 20:32626216-32626238 TGTGGTGACTAGCGCCCACCCGG No data
1172126088_1172126097 22 Left 1172126088 20:32626171-32626193 CCCACCTTCTCAGTAGGCTGCGA No data
Right 1172126097 20:32626216-32626238 TGTGGTGACTAGCGCCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172126097 Original CRISPR TGTGGTGACTAGCGCCCACC CGG Intergenic
No off target data available for this crispr