ID: 1172126098

View in Genome Browser
Species Human (GRCh38)
Location 20:32626227-32626249
Sequence GCGCCCACCCGGAGCGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172126096_1172126098 -10 Left 1172126096 20:32626214-32626236 CCTGTGGTGACTAGCGCCCACCC No data
Right 1172126098 20:32626227-32626249 GCGCCCACCCGGAGCGCCCCAGG No data
1172126095_1172126098 -2 Left 1172126095 20:32626206-32626228 CCAGCATGCCTGTGGTGACTAGC No data
Right 1172126098 20:32626227-32626249 GCGCCCACCCGGAGCGCCCCAGG No data
1172126093_1172126098 5 Left 1172126093 20:32626199-32626221 CCACTTCCCAGCATGCCTGTGGT No data
Right 1172126098 20:32626227-32626249 GCGCCCACCCGGAGCGCCCCAGG No data
1172126090_1172126098 29 Left 1172126090 20:32626175-32626197 CCTTCTCAGTAGGCTGCGAGCTT No data
Right 1172126098 20:32626227-32626249 GCGCCCACCCGGAGCGCCCCAGG No data
1172126091_1172126098 6 Left 1172126091 20:32626198-32626220 CCCACTTCCCAGCATGCCTGTGG No data
Right 1172126098 20:32626227-32626249 GCGCCCACCCGGAGCGCCCCAGG No data
1172126094_1172126098 -1 Left 1172126094 20:32626205-32626227 CCCAGCATGCCTGTGGTGACTAG No data
Right 1172126098 20:32626227-32626249 GCGCCCACCCGGAGCGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172126098 Original CRISPR GCGCCCACCCGGAGCGCCCC AGG Intergenic
No off target data available for this crispr