ID: 1172126107

View in Genome Browser
Species Human (GRCh38)
Location 20:32626245-32626267
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172126099_1172126107 -8 Left 1172126099 20:32626230-32626252 CCCACCCGGAGCGCCCCAGGAGA No data
Right 1172126107 20:32626245-32626267 CCAGGAGACCAGAGCCAAAAGGG No data
1172126091_1172126107 24 Left 1172126091 20:32626198-32626220 CCCACTTCCCAGCATGCCTGTGG No data
Right 1172126107 20:32626245-32626267 CCAGGAGACCAGAGCCAAAAGGG No data
1172126094_1172126107 17 Left 1172126094 20:32626205-32626227 CCCAGCATGCCTGTGGTGACTAG No data
Right 1172126107 20:32626245-32626267 CCAGGAGACCAGAGCCAAAAGGG No data
1172126096_1172126107 8 Left 1172126096 20:32626214-32626236 CCTGTGGTGACTAGCGCCCACCC No data
Right 1172126107 20:32626245-32626267 CCAGGAGACCAGAGCCAAAAGGG No data
1172126100_1172126107 -9 Left 1172126100 20:32626231-32626253 CCACCCGGAGCGCCCCAGGAGAC No data
Right 1172126107 20:32626245-32626267 CCAGGAGACCAGAGCCAAAAGGG No data
1172126095_1172126107 16 Left 1172126095 20:32626206-32626228 CCAGCATGCCTGTGGTGACTAGC No data
Right 1172126107 20:32626245-32626267 CCAGGAGACCAGAGCCAAAAGGG No data
1172126093_1172126107 23 Left 1172126093 20:32626199-32626221 CCACTTCCCAGCATGCCTGTGGT No data
Right 1172126107 20:32626245-32626267 CCAGGAGACCAGAGCCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172126107 Original CRISPR CCAGGAGACCAGAGCCAAAA GGG Intergenic
No off target data available for this crispr