ID: 1172127033

View in Genome Browser
Species Human (GRCh38)
Location 20:32630593-32630615
Sequence CACAGCACGGAGGAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172127028_1172127033 -1 Left 1172127028 20:32630571-32630593 CCAGCTCACACACAGAACACTGC No data
Right 1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG No data
1172127027_1172127033 22 Left 1172127027 20:32630548-32630570 CCAGAGGGCAAATAAAGGATGGA No data
Right 1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172127033 Original CRISPR CACAGCACGGAGGAGGAGGC AGG Intergenic
No off target data available for this crispr