ID: 1172132335

View in Genome Browser
Species Human (GRCh38)
Location 20:32664176-32664198
Sequence ACCTGGGAGGTGAGGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172132328_1172132335 -1 Left 1172132328 20:32664154-32664176 CCAGCGCTCTGGGTTTCTTCTAA No data
Right 1172132335 20:32664176-32664198 ACCTGGGAGGTGAGGGCCCTGGG No data
1172132323_1172132335 16 Left 1172132323 20:32664137-32664159 CCCTGGACTTTCTGATCCCAGCG No data
Right 1172132335 20:32664176-32664198 ACCTGGGAGGTGAGGGCCCTGGG No data
1172132327_1172132335 0 Left 1172132327 20:32664153-32664175 CCCAGCGCTCTGGGTTTCTTCTA No data
Right 1172132335 20:32664176-32664198 ACCTGGGAGGTGAGGGCCCTGGG No data
1172132324_1172132335 15 Left 1172132324 20:32664138-32664160 CCTGGACTTTCTGATCCCAGCGC No data
Right 1172132335 20:32664176-32664198 ACCTGGGAGGTGAGGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172132335 Original CRISPR ACCTGGGAGGTGAGGGCCCT GGG Intergenic
No off target data available for this crispr