ID: 1172132521

View in Genome Browser
Species Human (GRCh38)
Location 20:32665058-32665080
Sequence GGGGAACTTACTTGGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172132521_1172132527 -7 Left 1172132521 20:32665058-32665080 CCAAGCTGCCAAGTAAGTTCCCC No data
Right 1172132527 20:32665074-32665096 GTTCCCCTGATGGAGCTTGGGGG No data
1172132521_1172132525 -9 Left 1172132521 20:32665058-32665080 CCAAGCTGCCAAGTAAGTTCCCC No data
Right 1172132525 20:32665072-32665094 AAGTTCCCCTGATGGAGCTTGGG No data
1172132521_1172132526 -8 Left 1172132521 20:32665058-32665080 CCAAGCTGCCAAGTAAGTTCCCC No data
Right 1172132526 20:32665073-32665095 AGTTCCCCTGATGGAGCTTGGGG No data
1172132521_1172132535 28 Left 1172132521 20:32665058-32665080 CCAAGCTGCCAAGTAAGTTCCCC No data
Right 1172132535 20:32665109-32665131 CTGGTTCTACCCACACAGCAGGG No data
1172132521_1172132534 27 Left 1172132521 20:32665058-32665080 CCAAGCTGCCAAGTAAGTTCCCC No data
Right 1172132534 20:32665108-32665130 CCTGGTTCTACCCACACAGCAGG No data
1172132521_1172132531 9 Left 1172132521 20:32665058-32665080 CCAAGCTGCCAAGTAAGTTCCCC No data
Right 1172132531 20:32665090-32665112 TTGGGGGAGACTTTGTGCCCTGG No data
1172132521_1172132524 -10 Left 1172132521 20:32665058-32665080 CCAAGCTGCCAAGTAAGTTCCCC No data
Right 1172132524 20:32665071-32665093 TAAGTTCCCCTGATGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172132521 Original CRISPR GGGGAACTTACTTGGCAGCT TGG (reversed) Intergenic
No off target data available for this crispr