ID: 1172133686

View in Genome Browser
Species Human (GRCh38)
Location 20:32673230-32673252
Sequence CTGGAGCCACAGAGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172133670_1172133686 30 Left 1172133670 20:32673177-32673199 CCTGAGGAGCCCCAGGGCTGGTA No data
Right 1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG No data
1172133674_1172133686 19 Left 1172133674 20:32673188-32673210 CCAGGGCTGGTACAAACGGCAGG No data
Right 1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG No data
1172133672_1172133686 21 Left 1172133672 20:32673186-32673208 CCCCAGGGCTGGTACAAACGGCA No data
Right 1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG No data
1172133673_1172133686 20 Left 1172133673 20:32673187-32673209 CCCAGGGCTGGTACAAACGGCAG No data
Right 1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172133686 Original CRISPR CTGGAGCCACAGAGGCAGGA GGG Intergenic
No off target data available for this crispr