ID: 1172136360

View in Genome Browser
Species Human (GRCh38)
Location 20:32689414-32689436
Sequence GTGTCTATAAGGAGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172136351_1172136360 27 Left 1172136351 20:32689364-32689386 CCAGGGATGGGGGTGAGAGCCTT No data
Right 1172136360 20:32689414-32689436 GTGTCTATAAGGAGAGAGGAAGG No data
1172136357_1172136360 2 Left 1172136357 20:32689389-32689411 CCTGTAGTGAATGGGTTGGGAGC No data
Right 1172136360 20:32689414-32689436 GTGTCTATAAGGAGAGAGGAAGG No data
1172136348_1172136360 30 Left 1172136348 20:32689361-32689383 CCCCCAGGGATGGGGGTGAGAGC No data
Right 1172136360 20:32689414-32689436 GTGTCTATAAGGAGAGAGGAAGG No data
1172136354_1172136360 8 Left 1172136354 20:32689383-32689405 CCTTCACCTGTAGTGAATGGGTT No data
Right 1172136360 20:32689414-32689436 GTGTCTATAAGGAGAGAGGAAGG No data
1172136349_1172136360 29 Left 1172136349 20:32689362-32689384 CCCCAGGGATGGGGGTGAGAGCC No data
Right 1172136360 20:32689414-32689436 GTGTCTATAAGGAGAGAGGAAGG No data
1172136350_1172136360 28 Left 1172136350 20:32689363-32689385 CCCAGGGATGGGGGTGAGAGCCT No data
Right 1172136360 20:32689414-32689436 GTGTCTATAAGGAGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172136360 Original CRISPR GTGTCTATAAGGAGAGAGGA AGG Intergenic
No off target data available for this crispr