ID: 1172136557

View in Genome Browser
Species Human (GRCh38)
Location 20:32690330-32690352
Sequence CATGAAGTCCACCACAAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 150}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172136552_1172136557 14 Left 1172136552 20:32690293-32690315 CCCTCTGTGCAATCCACCGGGCA No data
Right 1172136557 20:32690330-32690352 CATGAAGTCCACCACAAAGCGGG 0: 1
1: 0
2: 2
3: 10
4: 150
1172136555_1172136557 -2 Left 1172136555 20:32690309-32690331 CCGGGCAATGCAGTGATGCAGCA No data
Right 1172136557 20:32690330-32690352 CATGAAGTCCACCACAAAGCGGG 0: 1
1: 0
2: 2
3: 10
4: 150
1172136553_1172136557 13 Left 1172136553 20:32690294-32690316 CCTCTGTGCAATCCACCGGGCAA No data
Right 1172136557 20:32690330-32690352 CATGAAGTCCACCACAAAGCGGG 0: 1
1: 0
2: 2
3: 10
4: 150
1172136546_1172136557 23 Left 1172136546 20:32690284-32690306 CCCAGCCACCCCTCTGTGCAATC No data
Right 1172136557 20:32690330-32690352 CATGAAGTCCACCACAAAGCGGG 0: 1
1: 0
2: 2
3: 10
4: 150
1172136554_1172136557 1 Left 1172136554 20:32690306-32690328 CCACCGGGCAATGCAGTGATGCA No data
Right 1172136557 20:32690330-32690352 CATGAAGTCCACCACAAAGCGGG 0: 1
1: 0
2: 2
3: 10
4: 150
1172136548_1172136557 18 Left 1172136548 20:32690289-32690311 CCACCCCTCTGTGCAATCCACCG No data
Right 1172136557 20:32690330-32690352 CATGAAGTCCACCACAAAGCGGG 0: 1
1: 0
2: 2
3: 10
4: 150
1172136545_1172136557 26 Left 1172136545 20:32690281-32690303 CCACCCAGCCACCCCTCTGTGCA 0: 1
1: 0
2: 4
3: 83
4: 782
Right 1172136557 20:32690330-32690352 CATGAAGTCCACCACAAAGCGGG 0: 1
1: 0
2: 2
3: 10
4: 150
1172136551_1172136557 15 Left 1172136551 20:32690292-32690314 CCCCTCTGTGCAATCCACCGGGC No data
Right 1172136557 20:32690330-32690352 CATGAAGTCCACCACAAAGCGGG 0: 1
1: 0
2: 2
3: 10
4: 150
1172136547_1172136557 22 Left 1172136547 20:32690285-32690307 CCAGCCACCCCTCTGTGCAATCC No data
Right 1172136557 20:32690330-32690352 CATGAAGTCCACCACAAAGCGGG 0: 1
1: 0
2: 2
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172136557 Original CRISPR CATGAAGTCCACCACAAAGC GGG Intergenic
902080074 1:13814731-13814753 AATGGAGTCCAGCTCAAAGCTGG - Intronic
902400267 1:16153544-16153566 CATGACACCAACCACAAAGCAGG + Intronic
902825474 1:18970647-18970669 CATGAAGCCCCCCAGCAAGCTGG + Intergenic
906266713 1:44436675-44436697 CAAACAGTCCACAACAAAGCAGG + Intronic
908477516 1:64504754-64504776 CTTGCAGTCCACCTCAAAGTAGG - Intronic
909779108 1:79520455-79520477 CATAAAGTCCATCACAAAATAGG + Intergenic
911354864 1:96803720-96803742 TATGAAATGCACCAGAAAGCTGG + Intronic
911443927 1:97967091-97967113 CATGAATTTCACCAAAAACCTGG + Intergenic
920313915 1:205064691-205064713 CATGAAGTTCTCAGCAAAGCAGG - Exonic
922162892 1:223091204-223091226 CACGCAGTCCATCACCAAGCTGG - Intergenic
922965562 1:229688213-229688235 CATTAAGTCTACCAAAAAGCGGG + Intergenic
923354531 1:233140927-233140949 CATGAAGCCCACAGCAGAGCTGG - Intronic
924646687 1:245884417-245884439 CATGCATTTCACCACAAAACCGG - Intronic
1063633130 10:7753535-7753557 CATGAAGTCCAGCACATAGTAGG - Exonic
1067324932 10:45258630-45258652 AGTGAAGCCCACGACAAAGCAGG - Intergenic
1067381512 10:45777943-45777965 ACTGAAGGCAACCACAAAGCTGG - Intronic
1067889211 10:50118577-50118599 ACTGAAGGCAACCACAAAGCTGG - Intronic
1071418110 10:85459922-85459944 CATGCATTTCACCACAAAACCGG + Intergenic
1071521723 10:86335694-86335716 CATGGAGACCTCCACACAGCAGG + Intronic
1074870124 10:117569725-117569747 CAAGAAGTCATCAACAAAGCCGG + Intergenic
1079796709 11:24812945-24812967 TATTAAGTGCACCACAAACCAGG - Intronic
1079983980 11:27180586-27180608 AATAAAGTCTACTACAAAGCAGG - Intergenic
1080813194 11:35726522-35726544 CATGAAGTAGAGCATAAAGCAGG + Intronic
1081780392 11:45706678-45706700 CATGCTGTCCAGCATAAAGCTGG - Intergenic
1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG + Exonic
1084736907 11:71111301-71111323 CATGGGGTTCACCACAAAGTGGG - Intronic
1085637567 11:78170241-78170263 CATGAGGCCCACCACCAAACAGG - Intergenic
1087281351 11:96214561-96214583 CATGAACTCAACTCCAAAGCAGG + Intronic
1087714802 11:101595445-101595467 CATGAGGTCTACCAAAAAGCAGG - Intronic
1093534893 12:20210878-20210900 CATGAAGTCCTCTCCAAATCTGG - Intergenic
1094827906 12:34286787-34286809 CCTGGAGTGCACCCCAAAGCAGG + Intergenic
1094836124 12:34322907-34322929 CATGAGGGGCACCCCAAAGCAGG - Intergenic
1096414698 12:51402997-51403019 CATGAAGTCCCCCAGTTAGCTGG + Intronic
1096545900 12:52340095-52340117 CATGAGATCCTTCACAAAGCAGG - Intergenic
1097419180 12:59352770-59352792 CATAAAGTCCCCTAGAAAGCAGG - Intergenic
1100062165 12:90592906-90592928 CCTGAATTCCACCACAAAAATGG + Intergenic
1101997116 12:109533449-109533471 CACGAACTGCAACACAAAGCAGG - Exonic
1109201576 13:59437174-59437196 AATGGACTCCTCCACAAAGCAGG + Intergenic
1109664274 13:65510440-65510462 CCTGAAGTCCAACTCAAAGCAGG + Intergenic
1115106870 14:29771867-29771889 CAATAAGTCCACAACAAAACAGG - Intronic
1115518946 14:34213575-34213597 CTTGAAGTCAATCAGAAAGCAGG + Intronic
1118359648 14:65045173-65045195 CATCAAGTACACCAGAAAGATGG - Intronic
1124636978 15:31371687-31371709 CCCTAAGTACACCACAAAGCAGG - Intronic
1124683928 15:31762376-31762398 CATAAAGTACAAGACAAAGCAGG + Intronic
1127279207 15:57474603-57474625 TATGAAGTCAATGACAAAGCTGG - Intronic
1127878751 15:63136667-63136689 CCTGAACTCCCCCAAAAAGCTGG - Intronic
1128070406 15:64792353-64792375 CAAGATGACCACCACACAGCAGG - Intergenic
1128854738 15:71000052-71000074 CTTCAAGGCCACCACCAAGCTGG + Intronic
1129076259 15:72998912-72998934 GATGAAGAGCACCACAAAACTGG + Intergenic
1130437582 15:83916816-83916838 CATGGAGTCTAACACAGAGCAGG - Intronic
1130709376 15:86264733-86264755 CTTGAAGTCCACCACAGAGCTGG - Exonic
1132150118 15:99453169-99453191 CATGAAGCCCATCAGAAAACAGG + Intergenic
1132988239 16:2779158-2779180 CAGGATGTCCACCAGAAACCAGG + Intergenic
1133455476 16:5938764-5938786 CCTGCAGCTCACCACAAAGCAGG + Intergenic
1134349619 16:13424505-13424527 AATGAAGGCCATCACAAAACAGG + Intergenic
1139581185 16:67874584-67874606 CATGAGGACAACCAAAAAGCAGG - Intronic
1141137796 16:81478011-81478033 CATGAATCCCACCCCACAGCAGG + Intronic
1143535902 17:7539310-7539332 CATGAATTCCACTAAAATGCAGG - Intergenic
1149066117 17:52481476-52481498 CATGAATTGCAACACAAAGTAGG + Intergenic
1150508552 17:65724776-65724798 AATGAAGTCCACCAACAGGCTGG + Intronic
1151065660 17:71146802-71146824 CATAAACTCCACAACACAGCTGG - Intergenic
1152348283 17:79768298-79768320 CATGTAGCGCAGCACAAAGCAGG + Intergenic
1153357159 18:4149924-4149946 CATGAATTCCCTCACAATGCTGG - Intronic
1153616067 18:6934857-6934879 CATGAAGTCCAGAAGACAGCAGG - Intergenic
1155448937 18:25943311-25943333 CATGCACTTCACCACAAAACCGG + Intergenic
1157419619 18:47535017-47535039 CATCATTTCCACCACAAAGTTGG + Intergenic
1159387175 18:67741815-67741837 CATGAAGTGCAAGAAAAAGCAGG + Intergenic
1161009490 19:1953406-1953428 CATCAAATCCATCACAAAGACGG - Intronic
1161598200 19:5163302-5163324 AATGATGTCCACCACAACTCAGG - Intronic
1161629683 19:5346698-5346720 CATGGAGCCCAGCACAGAGCAGG - Intergenic
1161685155 19:5698860-5698882 CCTGAAGTCCGCCACATGGCTGG + Intronic
1162237440 19:9320349-9320371 AATGAAGTCCACCATAACTCAGG - Intergenic
1163722509 19:18904956-18904978 CATGCAGTGGAGCACAAAGCAGG - Intronic
1167743235 19:51337251-51337273 CAGGGACTCCATCACAAAGCCGG - Exonic
1168547675 19:57267264-57267286 AATGAAGTCCACATGAAAGCAGG + Intergenic
925207192 2:2016912-2016934 CATGAATTTCACCACACAGATGG + Intronic
926387344 2:12349783-12349805 CATGAAATCCAGCACAGTGCTGG - Intergenic
927243260 2:20936804-20936826 CATGAAGTCCTGCAGAAAGCAGG - Intergenic
930234045 2:48872145-48872167 CAGCAAGTGCAGCACAAAGCAGG - Intergenic
933269726 2:80220591-80220613 CATGAAGGCCATCCCAAAGAAGG - Intronic
936485401 2:112921124-112921146 CATGAAGTCAACAACAAACAGGG - Intergenic
941052920 2:160755333-160755355 CATCATGCCCACCATAAAGCTGG - Intergenic
942125967 2:172825729-172825751 CATTAAATCCACCATAAACCTGG + Intronic
944729028 2:202499537-202499559 AATGATGTCCACCATAAATCAGG + Intronic
945085483 2:206127964-206127986 CATGATGTCCTGCACAAAGATGG + Exonic
947013648 2:225593192-225593214 CTTGAAGTCTAGCACAAGGCTGG + Intronic
1169395328 20:5223995-5224017 CAGGAACTGCACCACAGAGCTGG - Intergenic
1170794189 20:19532262-19532284 CCTCAAGTCAAGCACAAAGCAGG + Intronic
1171984627 20:31651068-31651090 CATGGAGTCCACCACCCAGTAGG + Intergenic
1172136557 20:32690330-32690352 CATGAAGTCCACCACAAAGCGGG + Intergenic
1172803191 20:37592636-37592658 CATGAAGTTCGGCACAGAGCAGG - Intergenic
1174565897 20:51464236-51464258 CACAAAGGCCACCACAAAGGAGG + Intronic
1179014355 21:37582635-37582657 CAGGAAGTGCACCACTAGGCCGG + Intergenic
1179085453 21:38212709-38212731 CATGAATTCAAGCACAAAACGGG - Intronic
1179150835 21:38806558-38806580 CAGGAAGTCACCCTCAAAGCCGG - Intronic
1181237327 22:21455626-21455648 CAGGAAGCCCCCCACAGAGCAGG + Intergenic
1182144741 22:27990537-27990559 CCTGAGGTCCACCAGACAGCAGG - Intronic
1184715444 22:46279337-46279359 CATGAAGTGCCACACAGAGCCGG - Intronic
1184813026 22:46850094-46850116 CATGCACTCCAGCACACAGCAGG - Intronic
949147739 3:723293-723315 CTTAAAGTCCACAACAAATCAGG - Intergenic
949388303 3:3530290-3530312 CTTGAAGTCCACCAACAAGGTGG - Intergenic
950411958 3:12844409-12844431 AATGAAGTTCCCCCCAAAGCTGG + Intronic
952202067 3:31140333-31140355 CATAAAGACAAGCACAAAGCAGG + Intergenic
954438339 3:50507924-50507946 CAACAAGTCCAGCACAAAGCAGG - Intergenic
960539117 3:118844914-118844936 AATGATGTCCACCAGAATGCAGG + Intergenic
960719979 3:120616312-120616334 CATGTAGCCCACGAAAAAGCTGG + Intergenic
960865524 3:122195427-122195449 CATCAAGAACACCACAAAGCTGG - Intronic
962010990 3:131390632-131390654 CCTGATGTCCACCACACAGCAGG + Intergenic
962176385 3:133160055-133160077 CCTGTAGTCCTCCACAAAGAAGG - Intronic
962886527 3:139632933-139632955 CATGAAGGCCCCCATAAAGAGGG + Intronic
963495363 3:146052925-146052947 CATGACTACCACCACAAAGTTGG - Intergenic
965781124 3:172287150-172287172 CATGAAGGGCACAGCAAAGCTGG - Intronic
967307886 3:188076553-188076575 TATGAAGGTCACCATAAAGCAGG + Intergenic
970227090 4:13870455-13870477 CATTAAGTCCATAACAAAGTGGG + Intergenic
971703574 4:30011665-30011687 CATGTAGGACACCATAAAGCAGG - Intergenic
974318567 4:60314217-60314239 CATTAAATACACCACAAACCTGG + Intergenic
977588733 4:98803572-98803594 CATGAATTGCACCACAGAGTTGG - Intergenic
978481852 4:109201351-109201373 AATGAAATCCACCACACAACAGG + Intronic
979494424 4:121368551-121368573 CATTAGGTCTACCAAAAAGCAGG + Intronic
983124392 4:163932591-163932613 CATGAAGGCCATGACCAAGCAGG + Intronic
984843489 4:184090391-184090413 CATGAAGCCCGGCACATAGCAGG - Exonic
985145446 4:186890306-186890328 CAAGAAATCCAGCACAGAGCCGG - Intergenic
985316057 4:188659766-188659788 CATGAAGAACAGAACAAAGCTGG + Intergenic
988592004 5:32557228-32557250 AATGATGTCCACCACAACTCAGG - Intronic
988602501 5:32652812-32652834 ATTGAAGACCACCACAAAACAGG - Intergenic
988629493 5:32913559-32913581 CATGCATTTCACCACAAAACCGG + Intergenic
989957360 5:50372972-50372994 AATGATGTCCACCACAACTCAGG + Intergenic
989964356 5:50450952-50450974 AATGAAGTCCACCATAACTCAGG - Intergenic
995566048 5:113433903-113433925 CAAGAAGTCTGCCACCAAGCTGG - Exonic
999495763 5:152095375-152095397 GGTTAAGTCAACCACAAAGCGGG - Intergenic
1001908079 5:175489760-175489782 CAGGAGGTCCAGCACAAGGCTGG + Intronic
1006358436 6:33574079-33574101 CATGAAGTCGACCACGAAGCGGG + Exonic
1007648985 6:43405450-43405472 CATGAATTATTCCACAAAGCTGG + Intergenic
1007851039 6:44803072-44803094 CATGCAGTCCATCACAGAGAGGG + Intergenic
1011288469 6:85750510-85750532 CATGAAGTCAAAAAGAAAGCTGG + Intergenic
1013907841 6:115238510-115238532 AATGATGTCCACCATAAATCAGG - Intergenic
1014793415 6:125701140-125701162 CATGCAGTCCATCAGGAAGCTGG - Intergenic
1016935647 6:149447487-149447509 CATGAAGCCCACCAAAGTGCTGG + Intergenic
1022862066 7:34377461-34377483 CATGAAGTCCAAAACCCAGCAGG - Intergenic
1026214712 7:68338140-68338162 GATGAACTTCACCACAAAGCCGG - Intergenic
1027187640 7:75981513-75981535 GATGAAGTCCTCCTCCAAGCTGG - Exonic
1031155581 7:118106978-118107000 CATACAGTCTACCACAAAGTTGG - Intergenic
1033650867 7:143342380-143342402 CATGATGTCCTCAACAAAGATGG - Exonic
1039006811 8:33047710-33047732 CATGAAGCAAACAACAAAGCTGG + Intergenic
1039961601 8:42252297-42252319 CATGCATTCCACCACAGAACCGG + Intergenic
1043784481 8:84380826-84380848 CATGCTGCCCACCACAAGGCAGG - Intronic
1047519348 8:125582635-125582657 CATGAATGGCACCACAGAGCTGG + Intergenic
1047808095 8:128379862-128379884 AATGATGTCCACCATAACGCAGG - Intergenic
1048081139 8:131128564-131128586 CATGATGTCCAACACACAGCAGG + Intergenic
1051592302 9:18788646-18788668 AATGGAATCTACCACAAAGCGGG - Intronic
1057950539 9:99366086-99366108 CATCAAGTCCTCCAAGAAGCAGG + Intergenic
1059757650 9:117308800-117308822 TATGAAGTCCAGCACAGAGAAGG - Intronic
1061060245 9:128246646-128246668 CATGATGTCTAGCTCAAAGCAGG - Intronic
1061936151 9:133858751-133858773 CATGAGGTCCACAGCTAAGCAGG + Intronic
1062724093 9:138061504-138061526 CATGAAGTGTATCACCAAGCCGG + Intronic
1185867992 X:3639725-3639747 AAAGAATTCCACCACAAAACCGG - Intronic
1186059267 X:5686200-5686222 CAAGAAATCCACCTGAAAGCTGG + Intergenic
1186353740 X:8768213-8768235 TATGCACTCCACCACAAAACTGG - Intergenic
1186397821 X:9227574-9227596 CATCAAAACCACCACAAATCAGG + Intergenic
1193042664 X:77019994-77020016 AATCATGGCCACCACAAAGCTGG + Intergenic
1195063901 X:101221648-101221670 CTTCAAGTCCACCATAAAGGAGG + Intronic
1195637700 X:107136302-107136324 CATAAAGTCAACCACTTAGCAGG + Intronic
1202136090 Y:21664151-21664173 TATGCAGTCCACCACTAAGATGG + Intergenic