ID: 1172138976

View in Genome Browser
Species Human (GRCh38)
Location 20:32708445-32708467
Sequence CTCCAAAATCAGACTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172138971_1172138976 20 Left 1172138971 20:32708402-32708424 CCGGTAAAATCAACCATATAAAC 0: 1
1: 0
2: 1
3: 24
4: 223
Right 1172138976 20:32708445-32708467 CTCCAAAATCAGACTGAGCAAGG 0: 1
1: 0
2: 1
3: 12
4: 209
1172138975_1172138976 7 Left 1172138975 20:32708415-32708437 CCATATAAACAAAGGGAGGAAAT 0: 1
1: 0
2: 1
3: 29
4: 341
Right 1172138976 20:32708445-32708467 CTCCAAAATCAGACTGAGCAAGG 0: 1
1: 0
2: 1
3: 12
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172138976 Original CRISPR CTCCAAAATCAGACTGAGCA AGG Intronic
900952879 1:5867840-5867862 CTCCACAGTCAGGCAGAGCACGG + Exonic
901260233 1:7865645-7865667 CTCCAAATACAGGCTGAGCATGG + Intergenic
903027797 1:20442020-20442042 TTCCACAATCTGCCTGAGCAAGG - Intergenic
903728105 1:25467283-25467305 CTCTAAGATCAGGCAGAGCAGGG + Intronic
904029747 1:27526877-27526899 CTGCAAAATCAAACTGACCTAGG - Intergenic
904918876 1:33990856-33990878 ATCCAAAATCAGATTTAGCTGGG - Intronic
907956594 1:59233973-59233995 CTTCAGAATCAGACTGATCTGGG - Intergenic
909257531 1:73443336-73443358 CTCCAGACTCAGACTCAGTAAGG + Intergenic
912451908 1:109772623-109772645 CTCCTAAATCAGACTCTCCATGG - Intronic
913000017 1:114571029-114571051 CTCCAAGATCAGGCAGGGCATGG - Intronic
915262390 1:154686478-154686500 CTCCAATCCCAGACTAAGCAGGG + Intergenic
915859570 1:159429802-159429824 CTCCCAGATCTGACTGATCAGGG + Intergenic
916024347 1:160820860-160820882 TTCAAAAGTCAGACTGGGCACGG + Intronic
918361236 1:183760439-183760461 AACCAAAGTCAGGCTGAGCATGG + Intronic
919728310 1:200897788-200897810 CTCCAAAATGAAACTTAGCTGGG - Intronic
924785369 1:247192387-247192409 CTACAAAATCAGGTTGGGCATGG + Intergenic
1066458846 10:35595657-35595679 CTCCAGCATCACACAGAGCAAGG - Intergenic
1069699237 10:70409022-70409044 CTAAATGATCAGACTGAGCAGGG + Intronic
1073333463 10:102686752-102686774 TTTGATAATCAGACTGAGCACGG - Intronic
1074791916 10:116897784-116897806 CTCTAAAGTCAGACAGAGTAGGG - Intronic
1080475446 11:32585937-32585959 CTTTAAAACCAGGCTGAGCACGG + Intronic
1081600636 11:44490658-44490680 ATACAAAATTAGGCTGAGCACGG + Intergenic
1083150615 11:60789663-60789685 CTGCAAAATGAGAGTGAGGACGG + Intronic
1084887025 11:72217419-72217441 CTCCAAAAACTTACTGACCATGG - Intronic
1087344899 11:96959478-96959500 AGCCAAAATCAGAGTGAGGAAGG + Intergenic
1089960988 11:122617139-122617161 CTCCAGAATCAGACAGAACTGGG + Intergenic
1090810315 11:130234206-130234228 CTCCAAGATCATATTGAACAAGG + Exonic
1091639058 12:2220542-2220564 CTCCTACATCAGACTGATCTAGG - Intronic
1094356988 12:29588449-29588471 CTCCCAACCCAAACTGAGCAGGG + Intronic
1095464318 12:42474800-42474822 CTGCTAAATCAGGCTAAGCAGGG + Intronic
1098363840 12:69681709-69681731 CTACTAAATCAGACTCAGTAGGG + Intronic
1099070418 12:78039351-78039373 CTCCTAAATCAGACAGATTAAGG + Intronic
1100310579 12:93391272-93391294 TACGAAAATCAGACTGGGCATGG + Intronic
1102230783 12:111260807-111260829 CTCCAATGAGAGACTGAGCAAGG - Intronic
1102714417 12:114957472-114957494 CTTCAAAGCCAGACTCAGCACGG - Intergenic
1105302538 13:19149362-19149384 TTCTAAAATCGAACTGAGCATGG + Intergenic
1108568116 13:51721732-51721754 CTCCAAAATCATAGTTGGCAAGG - Intronic
1108923196 13:55702128-55702150 ATCCAAAATAAGCCTGGGCACGG - Intergenic
1109262921 13:60164428-60164450 ACCCAAAATCAGACAGAGCTAGG + Intergenic
1109461408 13:62663645-62663667 CTCAAAAAAGAGACTGAGGATGG + Intergenic
1110530563 13:76592559-76592581 CTCCAAGATCATATTGAACAAGG + Intergenic
1110555636 13:76856319-76856341 CTCCACAATCAGACTGATCTTGG - Intergenic
1111230072 13:85333839-85333861 CTCCAAACACTGACTCAGCATGG + Intergenic
1111405292 13:87796371-87796393 ATCCAAAATCAGGGTTAGCAGGG + Intergenic
1111500009 13:89106311-89106333 CTCCAAAATGAGTGTGAGTATGG - Intergenic
1112100917 13:96188322-96188344 TTTCAAAATCAGGCTGGGCATGG + Intronic
1114319811 14:21537928-21537950 CACAAAAATTAGGCTGAGCACGG + Intergenic
1114497570 14:23143580-23143602 CCCCAAAATCAGGCTCAGGAAGG - Intronic
1116325513 14:43528807-43528829 CTTCAAAATAAGACTGAAAATGG - Intergenic
1116916419 14:50530521-50530543 CTAAAAAATGAGACTGAGAAAGG + Intronic
1117966657 14:61213434-61213456 GTCCAAATTTAGACTCAGCAAGG - Intronic
1118850358 14:69578309-69578331 CTTCAGAATCAGACAGAGCCAGG - Intergenic
1123218623 14:106836464-106836486 CTCCAAAAACTTACAGAGCAAGG + Intergenic
1124105862 15:26737267-26737289 GTACAAAACAAGACTGAGCATGG + Intronic
1126074679 15:44897930-44897952 CCTTAAAATCAGACTGATCAGGG + Intergenic
1127017799 15:54708311-54708333 CTCCAAGATCAGAGCCAGCATGG + Intergenic
1129187005 15:73914378-73914400 CTCCATTGTCAGACTCAGCAAGG - Intergenic
1129798803 15:78397909-78397931 CTTCAAAATCAGACTGGGAAAGG + Intergenic
1131263156 15:90900047-90900069 CACCAAAATGAGGCTGAGCACGG + Intergenic
1131922707 15:97347380-97347402 CTTCAAAATCAGATTGAGACTGG - Intergenic
1133735370 16:8610994-8611016 CCACAGAATCAGACTGAGGATGG + Intergenic
1134270924 16:12732323-12732345 CTCAAAAAGTAGAGTGAGCAAGG + Intronic
1135010706 16:18875298-18875320 CTCCAAAATCCGGCTGGGCATGG + Intronic
1136314373 16:29442610-29442632 TTCCAAAATCCGGCTGGGCATGG + Intergenic
1136327812 16:29544375-29544397 TTCCAAAATCCGGCTGGGCATGG + Intergenic
1136442500 16:30284379-30284401 TTCCAAAATCCGGCTGGGCATGG + Intergenic
1139889306 16:70238093-70238115 TTCCAAAATCCGGCTGGGCATGG + Intergenic
1140329384 16:74038923-74038945 CTTCAAATTCAGGCTGTGCAGGG + Intergenic
1142013890 16:87733444-87733466 CTGCAACATCAGGCTGAACAGGG + Intronic
1142069415 16:88082797-88082819 CTCCAGGATCAGGCTGACCATGG - Intronic
1143808265 17:9448343-9448365 CTCCTAACTGAGGCTGAGCAAGG + Intronic
1143948376 17:10614157-10614179 CTCCAAATTCAGAATGAACCTGG - Intergenic
1150753294 17:67886536-67886558 CTACAAAAGCACACAGAGCAGGG + Intronic
1151199650 17:72458314-72458336 CTCCAACACCACACTGTGCATGG + Intergenic
1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG + Intronic
1154466651 18:14649823-14649845 AGCCAACATCAGACTGAACAGGG + Intergenic
1155509707 18:26564187-26564209 ATGCTAACTCAGACTGAGCATGG + Intronic
1157175480 18:45448012-45448034 CTGCAAAACAAGACTGAGTATGG + Intronic
1157433231 18:47647633-47647655 TTCAAAAATCAGGCTGGGCACGG + Intergenic
1159946648 18:74448816-74448838 TTCCAAAATCAGGCTGAGCATGG + Intronic
1160670890 19:362475-362497 CTCCACATTCAGGCTGGGCATGG + Intronic
1162277417 19:9667400-9667422 GTCCAACATCATACTGAACAGGG + Intronic
1165168489 19:33873344-33873366 TTCCAAATCAAGACTGAGCATGG - Intergenic
1165206786 19:34195631-34195653 CACCAAAATAAGACTTAACAAGG - Intronic
1166570717 19:43795195-43795217 ATCCAAAATCTGGCTGGGCATGG + Intergenic
1166883231 19:45941535-45941557 ATCCAAAATCAGGCCCAGCATGG + Intronic
1167512316 19:49901878-49901900 ATCTAAAACCAGAGTGAGCAGGG + Exonic
1167886617 19:52505180-52505202 CTCAAAAACCAGAATGAGCTGGG - Intronic
1167892040 19:52548032-52548054 CTCAAAAACCAGAATGAGCTGGG - Intronic
1167912249 19:52713594-52713616 CTCAAAAACCAGAATGAGCTGGG + Intronic
925183454 2:1831551-1831573 CACCAAAACCAGACTGAGATAGG - Intronic
925763622 2:7210072-7210094 CTCCAACCTGAGACTGTGCAAGG - Intergenic
927650707 2:24911883-24911905 CTCCAAAATCCTACTGACCTGGG + Intronic
927669526 2:25057489-25057511 CACCATTATCAGGCTGAGCACGG + Intronic
927763182 2:25779386-25779408 ATACAAAATCAGGCTGGGCATGG - Intronic
927954580 2:27199644-27199666 CTCCAAAAGGAAACAGAGCACGG + Exonic
928071897 2:28225326-28225348 CTTCAGCATCAGACTGAACACGG + Intronic
928357202 2:30629267-30629289 ATACAAAATGAGGCTGAGCATGG + Intronic
932661263 2:73654786-73654808 CTCCAAAAGCACAGTAAGCAGGG - Intergenic
934944177 2:98525020-98525042 CACCAAAATCAGTGTTAGCAGGG + Intronic
937530876 2:122825576-122825598 CTACAAAATTAGAATGAGGATGG - Intergenic
939075256 2:137594127-137594149 TTTCAAAATCAGACTGAGTCTGG - Intronic
940411390 2:153367652-153367674 ATCCAAAATCAGTTTCAGCAGGG - Intergenic
942536517 2:176970071-176970093 CAGTTAAATCAGACTGAGCATGG + Intergenic
942969739 2:181943554-181943576 CTCCAAATGCATACTGAACAGGG - Intergenic
944169783 2:196761784-196761806 CTCCAACATAATACTGAACAGGG - Intronic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
947817120 2:233045076-233045098 CTCCAGAGACAGGCTGAGCAGGG - Intergenic
1169785851 20:9358602-9358624 TGCCAATAGCAGACTGAGCACGG + Intronic
1169914120 20:10671017-10671039 CTCCAAAATGAGCCTCAGCCAGG + Intronic
1171188273 20:23138985-23139007 CTCCAAAAGCTGTCTGATCAAGG + Intergenic
1172138976 20:32708445-32708467 CTCCAAAATCAGACTGAGCAAGG + Intronic
1173543241 20:43870103-43870125 TTCCAAAATCACTCTTAGCATGG + Intergenic
1173725850 20:45297185-45297207 CTCCAGAAACAGACTAAGTAGGG - Intronic
1175100511 20:56575718-56575740 TTCCTAAATCAGACTGTCCAGGG + Intergenic
1176070568 20:63224178-63224200 CTCCACACGCAGAGTGAGCAGGG - Intergenic
1176807864 21:13507741-13507763 AGCCAACATCAGACTGAACAGGG - Intergenic
1179796093 21:43784641-43784663 GTTCAAGATCAGACTGTGCAAGG + Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1184570577 22:45321701-45321723 TTCCAAAATCAGACCAGGCATGG - Intronic
1184576041 22:45367123-45367145 CTCCCAAAACAGACAAAGCAAGG - Intronic
949180859 3:1129570-1129592 CTCCAAAATAAGTGTGAGAAAGG - Intronic
949585563 3:5433481-5433503 CACCAGAATCACACTGACCAGGG - Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951462528 3:22966947-22966969 CACCATAAGCAGACTGATCAGGG + Intergenic
951722958 3:25721461-25721483 CTCCACAATTAGGCTGGGCACGG + Intronic
951792957 3:26506885-26506907 CTCCACAAGCAGAGAGAGCAGGG - Intergenic
952252649 3:31669801-31669823 CTCTAAATTCAGCCTGAGCTGGG - Intronic
952690892 3:36204340-36204362 CTGCAGAATTGGACTGAGCATGG - Intergenic
954079006 3:48201808-48201830 ATACAAAATTAGACTGGGCACGG + Intergenic
956003537 3:64754215-64754237 CTGCAAAATTAGAATGAGCTTGG - Intergenic
956583257 3:70837230-70837252 CTCCAAAATCAGATTGTACCAGG - Intergenic
957709649 3:83839273-83839295 CTTAAAAATTAAACTGAGCAGGG - Intergenic
959557175 3:107733894-107733916 CTACAAATGCAGACTGTGCATGG - Intronic
960058316 3:113292785-113292807 CTCTAAAATAAAAGTGAGCAAGG - Intronic
960667965 3:120129480-120129502 CTCCAAACTCAGGCTAGGCAAGG - Intergenic
960853471 3:122079405-122079427 TTCAAAAATCAGACTGAGGTGGG + Intronic
964130142 3:153277539-153277561 CACCAAAACCAAAATGAGCAGGG - Intergenic
964832854 3:160904948-160904970 CACCAAAATCACACCCAGCATGG - Intronic
964943106 3:162185758-162185780 ATTCAAAATGATACTGAGCATGG + Intergenic
966010026 3:175063776-175063798 TTCCAAAAACAGACTGGGCCGGG - Intronic
967464472 3:189787863-189787885 CTCCTGAATCAGACTCTGCAGGG - Intronic
967522328 3:190447438-190447460 CTCAAAAATCACAGTGACCAAGG - Intronic
968036692 3:195553780-195553802 CTCCTAAATCAGGCTGGGCATGG + Intergenic
968395513 4:233081-233103 CTCCAAAATGAGACAGATAAAGG + Intergenic
968414338 4:417211-417233 CTCCAAAATGAGACAGATAAGGG + Intergenic
969841560 4:9886780-9886802 GTCCAAGGTCAGACTGAGAAGGG - Intronic
970378235 4:15480181-15480203 CTCCAAACTCAGACTGACTGTGG - Intronic
971715434 4:30169506-30169528 GGGCAAAATAAGACTGAGCAAGG + Intergenic
972247765 4:37263344-37263366 CTGCCAAGCCAGACTGAGCAAGG - Intronic
972467166 4:39368254-39368276 ACCCAAAATAGGACTGAGCATGG + Intergenic
972649612 4:41004001-41004023 ATCCAAAATCAGGCTGGGCGTGG - Intronic
974884192 4:67795988-67796010 CTCCAAACTCAGGCTGTGCTAGG - Intergenic
975927045 4:79469630-79469652 CTCCATAATGATATTGAGCAAGG + Intergenic
977142459 4:93390338-93390360 CCGAAAAATGAGACTGAGCAAGG + Intronic
980928873 4:139166045-139166067 CTCTAAAAACAGGCTGGGCATGG + Intronic
981335795 4:143567791-143567813 GTCCAATCTGAGACTGAGCATGG - Intergenic
982301014 4:153879570-153879592 ATCCATAAGCACACTGAGCAAGG - Intergenic
985721083 5:1489439-1489461 CTCCAAAATCACACTGCACCAGG + Intronic
986456290 5:7923891-7923913 CTCCAAAATAAAACTGATGAAGG - Intergenic
988672416 5:33396212-33396234 CTCCAAATTCAGCACGAGCAAGG + Intergenic
990334823 5:54762203-54762225 TTTCAAAATCAGAATGAACATGG + Intergenic
991622010 5:68554993-68555015 CTGCAAAATCAAAGTGAGCGTGG - Intergenic
992696867 5:79297898-79297920 ATCAAAAATCAAACTGAGAAAGG - Intronic
994086307 5:95762991-95763013 CTACAAAACCAGCCTGAGGAAGG - Intronic
994741926 5:103629905-103629927 CTCCATAATCATACTGAGAGTGG - Intergenic
996312400 5:122121677-122121699 CTCCAACATCAGACTCGGAATGG - Intergenic
996354244 5:122578909-122578931 CTGCAAAATCACTGTGAGCAAGG + Intergenic
996746753 5:126852757-126852779 CTCCAAAATCAGGCTGGGCGCGG - Intergenic
996819129 5:127606363-127606385 CTGCAAAGTCAGACTGTGGAGGG - Intergenic
997034194 5:130167923-130167945 ATCCAATATCAGACTGGGAATGG + Intronic
997593451 5:135090302-135090324 CTCCAACCCCAGCCTGAGCACGG - Intronic
998658774 5:144212154-144212176 ATCCAATATCTGCCTGAGCATGG - Intronic
1003200868 6:3959017-3959039 TTCTATAATTAGACTGAGCAGGG + Intergenic
1003794610 6:9586936-9586958 CTCAAAAATAAGTCAGAGCATGG - Intergenic
1005980640 6:30833955-30833977 GTTCAAAATCAGGCTGGGCACGG + Intergenic
1007214717 6:40228157-40228179 CTCCAAAATTGGAGCGAGCACGG - Intergenic
1009033284 6:58086215-58086237 CTCAAAAATGAGATTGAGCAAGG + Intergenic
1009208894 6:60837990-60838012 CTCAAAAATGAGATTAAGCAAGG + Intergenic
1011464393 6:87640466-87640488 CTCCAAGAGTTGACTGAGCAAGG - Intronic
1011847303 6:91582121-91582143 CACTAACATCAGACTGAACAAGG - Intergenic
1012411180 6:98959019-98959041 CTCCAAAGTAAATCTGAGCAAGG + Intergenic
1014237333 6:118972992-118973014 CACCAAACTCAGAGTGACCAGGG + Intronic
1014750723 6:125252995-125253017 CTCAGAAATCAGGCTGGGCATGG - Intronic
1015137515 6:129890562-129890584 CTCCAAATGCAGAGTGAGCAGGG + Intergenic
1015439464 6:133231706-133231728 CTCCATGAGCAGACAGAGCATGG + Intergenic
1015549234 6:134394776-134394798 GTCCAAAACCACAATGAGCAGGG - Intergenic
1015827942 6:137335576-137335598 CACCAAAATCAGACGTAGGAAGG - Intergenic
1021284283 7:18760208-18760230 ATCTAAAATTGGACTGAGCAGGG - Intronic
1021345938 7:19528664-19528686 CTCAAAAATAAGACTGCACATGG - Intergenic
1023574589 7:41612874-41612896 CTCTAAATTCAGAGTGAGGAAGG - Intergenic
1024212324 7:47216594-47216616 CTCCCAGAACAGACTGAGTATGG - Intergenic
1029796257 7:102897533-102897555 TTCCATAATCAGTCTGTGCAGGG - Intronic
1031000116 7:116405269-116405291 CTCCTAAATCAGGCTGGGCACGG - Intronic
1031422877 7:121570190-121570212 CTCCAAGGTTGGACTGAGCATGG - Intergenic
1033304015 7:140211086-140211108 CTAAAACATCTGACTGAGCATGG + Intergenic
1033506136 7:142002607-142002629 AGCCAAAATCATACTGAACAGGG + Intronic
1036673969 8:10813800-10813822 CTCCGAAACCAGAGTGAGGATGG - Intronic
1038112298 8:24513166-24513188 CTCCCAATTCAGCCAGAGCATGG + Intronic
1039679250 8:39711435-39711457 CTCAAAAATCAGACTTACAACGG + Intronic
1042727163 8:71890521-71890543 CACCAAAACCAGGCTGGGCACGG + Intronic
1044338667 8:91020994-91021016 TTCAAAAACTAGACTGAGCATGG - Intronic
1047390799 8:124449414-124449436 CTCCATAATAAGACTGAGGCAGG - Intergenic
1047478047 8:125254433-125254455 CTTCAGAATCTGAATGAGCATGG - Intronic
1048318159 8:133377201-133377223 CTGCAAAGTCAGGCTGTGCAAGG + Intergenic
1055166147 9:73196477-73196499 TTGAAAAATCATACTGAGCATGG - Intergenic
1055202476 9:73683816-73683838 CTCCACAAACAGACAAAGCAAGG - Intergenic
1056683729 9:88742483-88742505 ACCCATAATCAGCCTGAGCAAGG - Intergenic
1059136444 9:111811176-111811198 ATCCAAAATCAGATTGTGTAGGG - Intergenic
1059417749 9:114172412-114172434 CTACAAAAACAGGCTCAGCATGG - Intronic
1059472379 9:114515616-114515638 CTCCAAAATCAGATTCTGAAAGG - Intergenic
1061143460 9:128782611-128782633 GTTCGAAATCAGCCTGAGCAAGG + Intergenic
1061270061 9:129534977-129534999 AACCAACATAAGACTGAGCACGG + Intergenic
1187395539 X:18916117-18916139 ATCAAAAATCAGAATGAGCCGGG + Intronic
1188135931 X:26495011-26495033 CACCAAATTCAGACTCAGCAGGG + Intergenic
1189345520 X:40238253-40238275 TTTTAAAACCAGACTGAGCAGGG - Intergenic
1189614693 X:42770924-42770946 CTCCAAAATAAACCTGAGAAGGG - Intergenic
1192457944 X:71293288-71293310 AGCAAAAATTAGACTGAGCATGG + Intronic
1192728523 X:73778318-73778340 ATCCACAGTCAGACTGAGCTTGG + Intergenic
1195514472 X:105757594-105757616 CTTTAAAATCAGACTGAGTAGGG + Intronic
1196088894 X:111717410-111717432 CTCCAAACTCAGACTAAGGGAGG - Intronic
1200001733 X:153065613-153065635 CTCCAAAGTCAAAGTGAGGAGGG + Intergenic
1200846135 Y:7833773-7833795 CTCCAAAATCCTCCTGAGCCAGG + Intergenic