ID: 1172138992

View in Genome Browser
Species Human (GRCh38)
Location 20:32708521-32708543
Sequence GGAAGTAGCCACCTTCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172138992 Original CRISPR GGAAGTAGCCACCTTCTCAG AGG (reversed) Intronic
901423548 1:9166690-9166712 GGCAGGGGCCACCTACTCAGGGG - Intergenic
901513216 1:9728507-9728529 AGAAGTAGCCGCCCGCTCAGCGG + Exonic
901563347 1:10091042-10091064 GGAATTAGCAACCTTCTAGGCGG - Intronic
901827892 1:11874470-11874492 GGCAGTGGCCACCTTCACTGGGG - Intergenic
904577383 1:31513834-31513856 GGGAGGAGCCACCCTCTCCGAGG - Intergenic
911501038 1:98684508-98684530 GGTACTAGCCACCTTATAAGAGG - Intronic
911720690 1:101188143-101188165 GGCAATAGCAAGCTTCTCAGTGG - Intergenic
912711340 1:111952229-111952251 GCAAGCAGCCACCTCCTAAGAGG - Intronic
916258968 1:162821867-162821889 GGAAGTTGCCACCTCCTCCATGG + Intergenic
917609632 1:176673836-176673858 GGAAATTGCCACATTCTCAGTGG + Intronic
922949151 1:229543765-229543787 GGAGGTTGGCACCTTCACAGAGG + Intronic
1063230718 10:4063317-4063339 GGAAGAAGCCACCATGTCATTGG + Intergenic
1067250105 10:44578779-44578801 GGAAGGATCCCTCTTCTCAGGGG + Intergenic
1068171921 10:53404862-53404884 GGAGGTGTCCACCTTGTCAGAGG - Intergenic
1068750602 10:60587353-60587375 GAAAGTAGCCATAATCTCAGTGG - Intronic
1069623195 10:69850534-69850556 GGAGGAAGCCACCTACTGAGAGG + Intronic
1076885689 10:133261471-133261493 AGCAGAAGCCACCTCCTCAGAGG + Intergenic
1077223675 11:1428369-1428391 GCAAGCACCCACCTTCCCAGAGG - Intronic
1079364167 11:19794599-19794621 GGATGAAGCCACATTCTCTGTGG - Intronic
1080726540 11:34904018-34904040 GGAAGGAGTCACATTTTCAGGGG - Intronic
1081426373 11:42930551-42930573 GGAAGGGGCCACCTTGTCACGGG + Intergenic
1083104426 11:60344401-60344423 GGAAGGAGCCACCTGTTCAGGGG + Intronic
1083767954 11:64851180-64851202 GGAAGAAGCCTCCTCTTCAGAGG - Intergenic
1085521803 11:77143536-77143558 TGAACCAGCCACCTTCTCCGGGG - Intronic
1089508196 11:118979096-118979118 GGAAGATGCCAGCTGCTCAGAGG + Exonic
1091803888 12:3342496-3342518 GGAAATAGCCACCTTCAGGGAGG - Intergenic
1092322577 12:7493313-7493335 GACAGAAGACACCTTCTCAGAGG + Intronic
1094704253 12:32899061-32899083 GCAAGAAGGCACCTTCTCACAGG + Intergenic
1096140536 12:49239040-49239062 GGAACCAGCCACATTCCCAGAGG - Intronic
1097380711 12:58892929-58892951 GGAAGTAGCGGCCTTTTCAAGGG - Intronic
1101620131 12:106378256-106378278 TGAAGTAGCCACCTACCCAAAGG - Exonic
1103002146 12:117393241-117393263 GAAAGTAGCCATCTTAGCAGTGG - Intronic
1104405500 12:128513183-128513205 GGAGGGAGCCACCTGCTCACAGG + Intronic
1106387592 13:29302677-29302699 GGAGGCAGCCACCATCTCTGTGG + Intronic
1107654161 13:42574523-42574545 GTGAGTGGCCACCTTCCCAGGGG + Intronic
1108511552 13:51160645-51160667 GAAAGTAGACAATTTCTCAGTGG + Intergenic
1114698102 14:24646228-24646250 GGAAGTACCAGCCTTCACAGAGG - Intergenic
1118900757 14:69983522-69983544 GGAAGTTGCCACCTCTGCAGGGG + Intronic
1119849837 14:77859276-77859298 GGAGGTACCCACCTTTGCAGGGG + Exonic
1120714255 14:87823244-87823266 AGATAAAGCCACCTTCTCAGAGG + Intergenic
1120745231 14:88146169-88146191 GGAAGTAGCTAGGGTCTCAGGGG - Intergenic
1125341823 15:38683056-38683078 GGAAGTCCCCTCCTTCTCACTGG + Intergenic
1127222151 15:56891148-56891170 GGAAGTAGCTACCTAGCCAGGGG + Intronic
1127262621 15:57337259-57337281 GGAAGTCGCGACCTCCTCTGAGG + Intergenic
1128248106 15:66146835-66146857 GAAGGTAGGCACCTTCTCAGGGG + Intronic
1129150841 15:73686930-73686952 AGAAGTCGCCACCCACTCAGAGG - Intronic
1132596324 16:752165-752187 GGGAGAAGCCACCAGCTCAGGGG - Intronic
1135647533 16:24176074-24176096 GGAAGTGGGGACCTTGTCAGAGG + Intronic
1142198903 16:88751806-88751828 GGGAGGTGCCACCTTCTCTGGGG - Intronic
1143867107 17:9932013-9932035 GGAAGGAGCGACCATCTCTGAGG + Intronic
1145752859 17:27367673-27367695 GGCTGAAGCCACCGTCTCAGAGG + Intergenic
1149239215 17:54629433-54629455 GGAAGAAGCAACGTTCTCACTGG + Intergenic
1150195695 17:63296068-63296090 GGAAGTAGCTAACCACTCAGGGG - Intronic
1150423964 17:65062313-65062335 GTAAGTAGTCACCTTGGCAGGGG - Intergenic
1150849490 17:68691000-68691022 GGGTGGAGCCACCTTCTCAGAGG + Intergenic
1151386889 17:73760420-73760442 GGAAGCAGCCTCCATCTCATTGG - Intergenic
1152167407 17:78719029-78719051 TGAAGTCATCACCTTCTCAGTGG - Intronic
1154348403 18:13563395-13563417 TGCAATATCCACCTTCTCAGTGG - Intronic
1155374639 18:25142439-25142461 GGAACTGGCCTCATTCTCAGTGG + Intronic
1160012086 18:75113790-75113812 TGAAGCACCCACCTTCTCATGGG + Intergenic
1160086516 18:75781765-75781787 GGCAGTAGCGACCGCCTCAGAGG + Intergenic
1160088414 18:75802197-75802219 AGAAGCAGCCACCTTCCCACTGG + Intergenic
1161682736 19:5688028-5688050 GGCTGTGGCCACCCTCTCAGGGG - Exonic
1165831102 19:38730851-38730873 GGAGGTGGCCACCTTCTCCTAGG - Exonic
1166691261 19:44822431-44822453 GGATGGAGCCACCTCCTCTGGGG + Intergenic
927229201 2:20803340-20803362 GGGAGTAGCCACCTGGTCTGGGG - Intronic
929111014 2:38405084-38405106 ACATGTTGCCACCTTCTCAGAGG - Intergenic
929393808 2:41499529-41499551 GGAAGGAGCCACCTGTTGAGGGG - Intergenic
929739214 2:44585439-44585461 GGAAGTGGCCTGCTTCTCTGGGG + Intronic
934576617 2:95405774-95405796 GGGAGAGGCCACCCTCTCAGTGG + Exonic
934638839 2:96013942-96013964 GGGAGAGGCCACCCTCTCAGTGG + Intergenic
934794812 2:97091469-97091491 GGGAGAGGCCACCCTCTCAGTGG - Exonic
936989458 2:118347001-118347023 GGAAGATGCCACTTTCTCTGTGG + Intergenic
938882462 2:135605507-135605529 GGAATTAGAAGCCTTCTCAGTGG - Intronic
940989524 2:160083829-160083851 GGAAGGAGCCACCTATTGAGGGG + Intergenic
941124752 2:161571450-161571472 GGCAGTAGAGACCTTCCCAGAGG + Intronic
943882404 2:193163288-193163310 GGTAGTTGTCAGCTTCTCAGAGG - Intergenic
945026613 2:205625472-205625494 GAAGGTAGCAACTTTCTCAGTGG + Intergenic
946429112 2:219615208-219615230 CGAGGGAGGCACCTTCTCAGAGG - Exonic
946764646 2:223029269-223029291 AGGAAAAGCCACCTTCTCAGTGG - Intergenic
948904037 2:240969363-240969385 TGCAGAAGCCACCTCCTCAGAGG - Intronic
1170368317 20:15620696-15620718 GAGAGAACCCACCTTCTCAGAGG + Intronic
1172138992 20:32708521-32708543 GGAAGTAGCCACCTTCTCAGAGG - Intronic
1172193447 20:33076198-33076220 GGAATCAGCCAGCTTCTAAGTGG + Intergenic
1172692218 20:36797690-36797712 ACAAGGGGCCACCTTCTCAGTGG + Intronic
1173322072 20:41997471-41997493 GGCAGGAGCCTCCTTCTCTGGGG + Intergenic
1173689085 20:44945520-44945542 GGAAGAAGCCAACTACTCTGAGG + Intronic
1175763155 20:61574637-61574659 GGGAGGTGGCACCTTCTCAGTGG - Intronic
1175902393 20:62365251-62365273 GGAAGTGGCCACAGTTTCAGTGG - Intronic
1180000944 21:44995295-44995317 CGAAGCTGCCACCTGCTCAGAGG + Intergenic
1180841690 22:18961916-18961938 GGAAAAGGCCACCTTTTCAGTGG - Intergenic
1181059812 22:20276945-20276967 GGAAAAGGCCACCTTTTCAGTGG + Intronic
1182322990 22:29490354-29490376 GGCAGGAGCCTCCTTCTCTGGGG - Exonic
1184397948 22:44255972-44255994 GGATGAAGCCACCTGCACAGGGG - Intronic
952615938 3:35274151-35274173 GGAATTAGCCACCTTATGAAAGG + Intergenic
953391093 3:42534177-42534199 AGAAGTTGCCACCTTCTCTGGGG - Intronic
953544757 3:43856241-43856263 GGCAGCAGCCACCATCTCTGGGG - Intergenic
959393036 3:105800330-105800352 GGAAGCATCCTCCTACTCAGTGG - Intronic
963413023 3:144955800-144955822 GGAAGTAGCCACCCTCTTTATGG + Intergenic
969259371 4:6023847-6023869 AGAAGAAGCCACCTGCTCACAGG - Intergenic
969620296 4:8275514-8275536 GGAAGAAACCACCTTCAGAGTGG + Intronic
970156855 4:13150539-13150561 TGAAGTAGCCAACTTCTAGGTGG - Intergenic
977850741 4:101824430-101824452 GGAATTAGCCACTTTCCCAGAGG + Intronic
978643758 4:110903589-110903611 GGAAAAAGTCACTTTCTCAGGGG + Intergenic
981392687 4:144210172-144210194 GGAATTAGTCACCTTCAAAGTGG + Intergenic
983337806 4:166419015-166419037 TGAAGTGGCCACATTCTCTGGGG - Intergenic
987234705 5:15930964-15930986 GATAGTGGCCACATTCTCAGTGG + Intronic
990424926 5:55677872-55677894 GAAACTTGCCACCTTCTGAGGGG + Intronic
992569446 5:78040106-78040128 GGAAGAAGCCACCTTATCCTGGG - Intronic
995647408 5:114328683-114328705 GGAAGAAGCCACCTTTCCTGTGG + Intergenic
1000037050 5:157456789-157456811 GGAAGGGGCCTCCTTGTCAGGGG - Intronic
1001925098 5:175630515-175630537 GTAAGGAGTCACCTTCCCAGTGG + Intergenic
1003413115 6:5883284-5883306 GGAAGTCACAACCTTCTCACTGG + Intergenic
1006058606 6:31403605-31403627 CGACGTCGCCACCCTCTCAGCGG - Exonic
1007031931 6:38636283-38636305 GGGAGTAGCAACCTTCTAGGAGG - Intronic
1007700103 6:43761430-43761452 GGGAGCAGTCACCTTCCCAGGGG + Intergenic
1010259702 6:73801172-73801194 GGCATTAGCCAACTTCTCACTGG - Intronic
1010442774 6:75917537-75917559 GGGAGATGGCACCTTCTCAGAGG + Intronic
1017014215 6:150087138-150087160 TGAAGTAGCCACGTTTACAGAGG - Intergenic
1017217722 6:151929675-151929697 GGAGGCAGCCAGCTACTCAGGGG + Intronic
1021905578 7:25329933-25329955 GGCAATGGCCACCTTCTCTGAGG - Intergenic
1022271467 7:28811894-28811916 GGAATTTGCCACCATCTCTGAGG + Intronic
1023870363 7:44260150-44260172 AGACGTAGCCACCTTCTCCTAGG + Intronic
1023931514 7:44709150-44709172 GGAAGCAGCCCCCTCCTCATTGG + Intergenic
1024251713 7:47510409-47510431 TAAACTAGCCACCTTCTCAGGGG + Intronic
1025783471 7:64622594-64622616 GGAAGGAGCCACCTGTTCAGTGG - Intergenic
1031662525 7:124443615-124443637 GGGATTAGCCACCTTCTAAAAGG - Intergenic
1032528069 7:132594816-132594838 TGAAGTAGCCACCTTCTCCCAGG - Intronic
1032565730 7:132940974-132940996 CCAAGAAGCCACTTTCTCAGTGG + Intronic
1036185657 8:6620535-6620557 GGATGAAGGGACCTTCTCAGAGG - Intronic
1037212939 8:16414160-16414182 GGCAGAAGCCACCTACTCACAGG - Intronic
1037288012 8:17321470-17321492 GGAAGAAAACACCCTCTCAGTGG - Intronic
1038326610 8:26577266-26577288 GGAAGCAGCCGCCCTCTCCGGGG + Intronic
1041695668 8:60733500-60733522 GGTGCTGGCCACCTTCTCAGTGG + Intronic
1042569172 8:70144014-70144036 GGTAGTAGTCACTGTCTCAGTGG - Intronic
1042760506 8:72267161-72267183 GGAAGGAGCCACCTGTTGAGGGG + Intergenic
1043324551 8:79034002-79034024 GGACTTAGCCCCCTTCCCAGGGG - Intergenic
1044828884 8:96225706-96225728 GGAATCAGCCACATTATCAGAGG + Intergenic
1047896624 8:129373570-129373592 GCAATTAGCCACCTTCTCAGAGG - Intergenic
1047998979 8:130361128-130361150 GGAAGGAACCACCACCTCAGTGG - Intronic
1048366582 8:133743755-133743777 GGGAGTAGGCACCTTATCATGGG + Intergenic
1049740661 8:144239430-144239452 GGAAGGGGTTACCTTCTCAGTGG + Intronic
1052904032 9:33817910-33817932 TGAAGTAGCCGCCTTCGTAGAGG - Exonic
1053376112 9:37607943-37607965 TGAAATAGCAAGCTTCTCAGAGG - Intronic
1056590733 9:87964062-87964084 CCAAGTAGCCATCTTCCCAGTGG + Intergenic
1056789861 9:89618375-89618397 GTTAGCAGCCACGTTCTCAGGGG - Intergenic
1061222066 9:129258078-129258100 TGAAGGATCCACCCTCTCAGAGG - Intergenic
1062163997 9:135096511-135096533 GGCAGAAGCCACCTTGACAGGGG + Intronic
1062201548 9:135305580-135305602 GGGAGTGGCCTCCTTCCCAGAGG + Intergenic
1062524641 9:136973311-136973333 GGCAGGAGCCCCCATCTCAGGGG + Intergenic
1193352659 X:80480658-80480680 GGAAGGAGCCGCCTGTTCAGGGG - Intergenic
1198869436 X:141160332-141160354 GACGGTAGCCACCATCTCAGAGG + Intergenic
1199802026 X:151261161-151261183 AGAAGGAGCCAACTTCTGAGAGG - Intergenic