ID: 1172146785

View in Genome Browser
Species Human (GRCh38)
Location 20:32762832-32762854
Sequence ACCCAGCCGGGTCTCCAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 139}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172146785_1172146792 2 Left 1172146785 20:32762832-32762854 CCGGGTTGGAGACCCGGCTGGGT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1172146792 20:32762857-32762879 GCGGGGTGAGGAAACGTCCACGG 0: 1
1: 0
2: 0
3: 9
4: 88
1172146785_1172146798 23 Left 1172146785 20:32762832-32762854 CCGGGTTGGAGACCCGGCTGGGT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1172146798 20:32762878-32762900 GGACCCTGCTTGGGGTGGAACGG 0: 1
1: 0
2: 1
3: 21
4: 232
1172146785_1172146791 -10 Left 1172146785 20:32762832-32762854 CCGGGTTGGAGACCCGGCTGGGT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1172146791 20:32762845-32762867 CCGGCTGGGTTTGCGGGGTGAGG 0: 1
1: 0
2: 0
3: 19
4: 201
1172146785_1172146795 15 Left 1172146785 20:32762832-32762854 CCGGGTTGGAGACCCGGCTGGGT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1172146795 20:32762870-32762892 ACGTCCACGGACCCTGCTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 34
1172146785_1172146796 18 Left 1172146785 20:32762832-32762854 CCGGGTTGGAGACCCGGCTGGGT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1172146796 20:32762873-32762895 TCCACGGACCCTGCTTGGGGTGG 0: 1
1: 0
2: 1
3: 2
4: 131
1172146785_1172146793 13 Left 1172146785 20:32762832-32762854 CCGGGTTGGAGACCCGGCTGGGT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1172146793 20:32762868-32762890 AAACGTCCACGGACCCTGCTTGG 0: 1
1: 0
2: 0
3: 0
4: 43
1172146785_1172146794 14 Left 1172146785 20:32762832-32762854 CCGGGTTGGAGACCCGGCTGGGT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1172146794 20:32762869-32762891 AACGTCCACGGACCCTGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 41
1172146785_1172146800 25 Left 1172146785 20:32762832-32762854 CCGGGTTGGAGACCCGGCTGGGT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1172146800 20:32762880-32762902 ACCCTGCTTGGGGTGGAACGGGG 0: 1
1: 0
2: 0
3: 14
4: 115
1172146785_1172146799 24 Left 1172146785 20:32762832-32762854 CCGGGTTGGAGACCCGGCTGGGT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1172146799 20:32762879-32762901 GACCCTGCTTGGGGTGGAACGGG 0: 1
1: 0
2: 0
3: 9
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172146785 Original CRISPR ACCCAGCCGGGTCTCCAACC CGG (reversed) Intronic
900119431 1:1042172-1042194 ACCCCGCCTGGCCTCCACCCCGG - Intronic
901655610 1:10767566-10767588 ACCAAGCCTGGTCTCCGAGCAGG - Intronic
902198280 1:14814620-14814642 ACCCAGCAAGGGCTCCTACCTGG + Intronic
902624142 1:17666969-17666991 ACCCATCTGGGTCTCAAGCCAGG + Intronic
903420718 1:23216825-23216847 AGCCAGCCGGGGCTCCACACCGG + Intergenic
905340438 1:37274037-37274059 ACCCAGCCTGGGCTGGAACCTGG - Intergenic
905624313 1:39477430-39477452 GTCCAGGCTGGTCTCCAACCTGG + Intronic
906414887 1:45613695-45613717 GCCCAGGCTGGTCTCAAACCTGG + Intronic
911073131 1:93847633-93847655 ACTCCGCCGGGACTCGAACCCGG - Intergenic
914870837 1:151472701-151472723 GCCCAGTCTGGTCTCCAACCTGG + Intergenic
922501220 1:226098384-226098406 AGCCAACCTGCTCTCCAACCTGG - Intergenic
922575465 1:226658373-226658395 CCCCAGCCAGGTTTCTAACCAGG - Intronic
922846833 1:228692643-228692665 ACCCAGCCTGGTCTTGAACTGGG + Intergenic
1063396064 10:5688794-5688816 GCCCAGGCTGGTCTCAAACCTGG - Intronic
1064541985 10:16414603-16414625 ACCCAGGCTGGTCTCAAACTTGG + Intergenic
1067052347 10:43029147-43029169 ACCCAGCAGGGCCTCCGCCCGGG + Intergenic
1070779191 10:79127652-79127674 GCCCAGCCAGGACTCCAACCAGG + Intronic
1070917715 10:80165466-80165488 GACCAGCAGGGTCTCCAAACGGG - Intronic
1073297434 10:102449861-102449883 GCCTAGGCTGGTCTCCAACCTGG + Exonic
1075030227 10:119019456-119019478 ACCCAGGCTGGTCTTCAACTCGG - Intergenic
1075270264 10:121043220-121043242 ACCCAGCCGGATGGCCGACCTGG - Intergenic
1075638143 10:124044412-124044434 ACCCAGCAGGGTCTGGAACTCGG - Intronic
1076472020 10:130725541-130725563 ATCCAGCCCGGGCTCCAAACTGG - Intergenic
1076542539 10:131223273-131223295 GCCCAGCCGTGTCCCCACCCTGG + Intronic
1077355395 11:2114467-2114489 ACCCAGCACGGTCTCCTATCTGG + Intergenic
1077387126 11:2275345-2275367 GCCCAGCCGCTTCTCCAGCCAGG + Intergenic
1082722569 11:56696095-56696117 TCCCAGCAGGGTCTCCACTCTGG + Intergenic
1083705442 11:64511014-64511036 ACCCAGCCCGCTCTCTGACCTGG + Intergenic
1085051079 11:73380598-73380620 CCCCAGCCTGGTCTCCAGGCAGG + Intronic
1089286431 11:117410858-117410880 ACCCAGCCTGCTCTCCAGCGGGG - Exonic
1090056669 11:123430343-123430365 GCCAAGCCGGCTCCCCAACCTGG + Exonic
1090381178 11:126328644-126328666 ACCCAGCCGGGCTCCCAGCCTGG - Intronic
1091795538 12:3295605-3295627 ACCCAGCTGGGGCTGCATCCTGG + Intergenic
1092143944 12:6201827-6201849 ACCCAGGCTGGTCTTGAACCTGG - Intronic
1101939405 12:109088917-109088939 ACCCAGGCTGGTCTCAAACTCGG + Intronic
1105946963 13:25198379-25198401 ACCCACCCAGTTCTCCCACCTGG - Intergenic
1108269299 13:48743453-48743475 ACCCATCCCCGTCTCCAACAGGG - Intergenic
1116782710 14:49253756-49253778 ACCCAGGCTGGTCTCAAATCAGG - Intergenic
1120958490 14:90103768-90103790 AACCAGGCTGGTCTCAAACCCGG + Intronic
1122876112 14:104666136-104666158 CCCCAGCGGGGTCCCCAGCCAGG + Intergenic
1123032435 14:105458294-105458316 CCACACCTGGGTCTCCAACCTGG - Exonic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1123940649 15:25215024-25215046 ACAGAGCCGGGCCACCAACCAGG - Intergenic
1124345310 15:28918250-28918272 ACAGAGCCGGGTCTCAACCCAGG + Intronic
1127480491 15:59372649-59372671 ACCCAGAGGGGACTCCATCCAGG + Exonic
1129519910 15:76179017-76179039 ACCCAGTCAAGTCTCAAACCAGG - Intronic
1130050212 15:80478254-80478276 CCCCAGCTGGGTCTCCAGACTGG - Intronic
1132880033 16:2158112-2158134 ACCCCGCAGGGTGTCCATCCAGG - Intronic
1136596512 16:31253906-31253928 ACCAAGCCTGTGCTCCAACCCGG - Intergenic
1140469773 16:75207406-75207428 ACTCAGCTGGGGCTCAAACCCGG - Intergenic
1141665472 16:85463197-85463219 ACCCACCCGGGGCTGGAACCTGG + Intergenic
1142076467 16:88120839-88120861 AGCCAGCCGGGGCTCACACCTGG - Intergenic
1142808310 17:2383308-2383330 GCCCAGCCTGGTCTCCAGCAAGG + Intergenic
1143001922 17:3800071-3800093 ATCCAGCCTGGGCTCCAGCCTGG + Intronic
1143344677 17:6241116-6241138 ACCCACCAGAGTCTCCCACCTGG + Intergenic
1148377458 17:47161231-47161253 GCCCAGGCTGGTCTCAAACCTGG + Intronic
1149382279 17:56106198-56106220 ACACAGCCAGGACTCCAACCAGG + Intergenic
1150301513 17:64050923-64050945 ACCCACCCAGGTCTCCATCGGGG + Intronic
1151542038 17:74769566-74769588 ACCCAGCCGGGTATTCAGCTTGG + Intergenic
1155248972 18:23937705-23937727 ACCCAGCCTGGGCTCCTGCCTGG - Intronic
1156495532 18:37523117-37523139 GCCCAGCCGGGTGCCCAGCCAGG - Intronic
1158599826 18:58847548-58847570 ACACAGCCCAGTCTCCAACTGGG - Intergenic
1160490728 18:79334925-79334947 ACCCACCCCGCTCTCCTACCCGG - Intronic
1160684096 19:425425-425447 GCCCCGTCGGGGCTCCAACCAGG + Intronic
1161782347 19:6301564-6301586 ACCCAGCCAGGTCTGCAGCCTGG + Intergenic
1161991824 19:7688744-7688766 ACCCAGCCAGGCCTCCAAGAAGG + Intronic
1163346523 19:16746144-16746166 GCCCAGACTGGTCTCCAACTCGG - Intronic
1163675147 19:18651987-18652009 GCCCAGCTGGGTCCCCATCCAGG - Intronic
1164607609 19:29611293-29611315 ACCCAACCTGGGCTCCACCCGGG - Intronic
1165283540 19:34817887-34817909 GCCCAGCCTGGTCTCAAACTTGG + Intergenic
1166735877 19:45084320-45084342 GCCCAGGCTGGTCTCCAACCTGG - Intronic
1202648093 1_KI270706v1_random:159044-159066 GCGCTGCCGGGTCTCCAATCAGG - Intergenic
927078195 2:19601353-19601375 ACCCAGCCTTGTCTCCTCCCAGG + Intergenic
928711116 2:34006547-34006569 ACACAGCCAGGTCTACAACCTGG + Intergenic
929040435 2:37739207-37739229 ATCCAGCCTAGTCTCCAGCCTGG + Intergenic
932885967 2:75549517-75549539 TCCCAGCCAGGTCTCTCACCTGG - Intronic
937100100 2:119261989-119262011 GCCCAGCGGGGTTTCCACCCGGG + Intronic
938652868 2:133401751-133401773 TCCCAGTCAGGGCTCCAACCTGG + Intronic
939617041 2:144373289-144373311 ACAGAGCTGGGACTCCAACCAGG + Intergenic
941156854 2:161989457-161989479 ACCCAGGCTGGTCTCGAACTGGG + Intergenic
941797295 2:169613717-169613739 GCCCAGGCTGGTCTCAAACCTGG - Intronic
944495915 2:200306998-200307020 GCCCAGCCGAGTCTCCGTCCCGG - Intronic
948227681 2:236324457-236324479 ACCCAGCTAGGTGTCCAGCCTGG + Exonic
1169281929 20:4275413-4275435 ACCCAGGCTGGTCTCAAACCTGG + Intergenic
1171298471 20:24039335-24039357 ACCCTGCCTGCTGTCCAACCAGG - Intergenic
1172146785 20:32762832-32762854 ACCCAGCCGGGTCTCCAACCCGG - Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1175519134 20:59588505-59588527 ACCCAGGAGGGTCTTCAGCCAGG - Intronic
1175935231 20:62510945-62510967 ACCCAGCCCGGACTCCCACCTGG - Intergenic
1176121942 20:63458018-63458040 ACCCAGCCGGTGCACCAAGCAGG + Intronic
1178365678 21:31987156-31987178 ATCCAGCCAGGTATCCCACCTGG - Intronic
1178641734 21:34350134-34350156 GCCCAGGCTGGTCTCAAACCTGG + Intergenic
1179457577 21:41509484-41509506 GCCCAGACTGGTCTCCAATCTGG + Intronic
1180049750 21:45325731-45325753 ACCCGGGGGTGTCTCCAACCTGG + Intergenic
1180187359 21:46146168-46146190 ACTCAGCCGGGTCTCCACGCAGG + Intronic
1180346040 22:11705202-11705224 GCGCTGCCGGGTCTCCAATCAGG + Intergenic
1183299531 22:37052031-37052053 ACCCGGCCGGGTCCCCAGCCTGG - Intronic
1183743623 22:39681253-39681275 GCCCAGCCAGCACTCCAACCCGG + Intronic
1184288947 22:43487996-43488018 ACACAGCCAGGGCTCAAACCCGG - Intronic
1184604053 22:45562155-45562177 ACCCATCCCTGTCTCCACCCAGG + Intronic
1185125506 22:49008629-49008651 AGCCAGGCTGGTCTCAAACCAGG + Intergenic
1185385060 22:50527985-50528007 ACCCAGGCTGATCTCCAACTGGG + Intronic
1203292704 22_KI270736v1_random:10752-10774 ATCCAGCCTAGTCTCCAGCCTGG + Intergenic
950576497 3:13835163-13835185 ACCCCGCCGGCCCTCCAGCCTGG - Intronic
954328133 3:49874807-49874829 ACCTGGCCAGGTCTCCACCCAGG - Intergenic
954572842 3:51656492-51656514 ACCCAGATGGGTCTACAATCAGG - Intronic
961340377 3:126213285-126213307 TCCCCGCCGGGTCTCCCTCCAGG - Intergenic
964024151 3:152051525-152051547 ACCCATTCAGCTCTCCAACCAGG - Intergenic
967131354 3:186473586-186473608 ACCCAGGTGGGTCTCCACCAAGG + Intergenic
968051654 3:195658536-195658558 GCCCAGCCAGGACTCCACCCCGG - Intergenic
968104161 3:195989797-195989819 GCCCAGCCAGGACTCCACCCCGG + Intergenic
968302463 3:197627387-197627409 GCCCAGCCAGGACTCCACCCCGG + Intergenic
968433928 4:575554-575576 GCCGAGCCGGGGCTCGAACCTGG + Intergenic
968654188 4:1771616-1771638 ACCCAGCCTGGCCTCCAGACAGG - Intergenic
968693311 4:2008187-2008209 CCCCAGCGGGGTCTCCCATCGGG - Intronic
971371422 4:26022430-26022452 ACACAGCCAGGTTTCCAGCCTGG - Intergenic
978972815 4:114831339-114831361 ACCGCGCCCGGCCTCCAACCTGG + Intronic
985997629 5:3605649-3605671 ACCCAGCCGCCTCTCCCACCCGG + Intergenic
988869584 5:35374012-35374034 GCCCAGGCTGGTCTCAAACCTGG - Intergenic
992856029 5:80862546-80862568 ACCCAGGCTGGTCTTGAACCTGG - Intronic
994670144 5:102754677-102754699 ACTCAGCCAGGTCTCCAGGCTGG + Intronic
997550927 5:134752588-134752610 ACCCAGGCTGGTCTCAAACTGGG + Intergenic
1004205902 6:13591784-13591806 GCCCAGCCGGGTCTCACACTCGG - Exonic
1007420282 6:41715088-41715110 ACCCCACCTGGCCTCCAACCAGG + Intronic
1007559147 6:42791593-42791615 ACCCATCAGGGTCTCAAACAAGG - Intronic
1010999200 6:82568659-82568681 TCCCACCAGGGTCTCCCACCAGG + Intergenic
1015731464 6:136352394-136352416 ACTCAGGCTGGTCTCCAACTGGG + Intronic
1015773108 6:136789086-136789108 GCCCAGACAGGTCTCAAACCTGG - Intronic
1016742919 6:147547345-147547367 AGCCAGCCGGGGCTCCTATCTGG + Intronic
1019315343 7:381579-381601 ACCCGGCCGTCTCTCCCACCTGG - Intergenic
1020125168 7:5529516-5529538 ACCCAGCCAGCTCCCCTACCTGG + Exonic
1024896293 7:54265825-54265847 ACCTAGCTGGTTCACCAACCTGG + Intergenic
1025004809 7:55345225-55345247 ACCCGCCCGCGGCTCCAACCAGG + Intergenic
1025611633 7:63079762-63079784 GCCCAGGCTGGTCTCCAACTGGG - Intergenic
1025707986 7:63884720-63884742 GCCCAGGCTGGTCTCCAACTGGG + Intergenic
1025936739 7:66043993-66044015 GCCCAGCCTGGTATCCGACCCGG - Intergenic
1026607287 7:71826883-71826905 GCCCAGGCTGGTCTCCAACTAGG + Intronic
1034412060 7:150947036-150947058 ACTCAGCCGGGTCTCCAGCCTGG + Exonic
1036658579 8:10693108-10693130 ACCCAGCCTCATCTCCAGCCAGG + Intronic
1038404364 8:27310752-27310774 GCCGAGCCGGGTCTGGAACCCGG - Intronic
1043889029 8:85635889-85635911 ACAAAGCGGGGTCTCCACCCTGG - Intergenic
1049016014 8:139920569-139920591 ACACAGCTGGGGCTCCAACAGGG + Intronic
1049223782 8:141440124-141440146 ACAGAGCCGGGATTCCAACCCGG + Intergenic
1049595611 8:143481941-143481963 AGCCAGCTGGGTCTCCGCCCTGG + Intronic
1052741232 9:32394878-32394900 ACCCAGCCACCTCACCAACCTGG - Intronic
1057748725 9:97772831-97772853 ACCCAGCCTGGTCTGCTGCCAGG - Intergenic
1061497176 9:130981682-130981704 ACTCAGCCACGTCTCAAACCTGG + Intergenic
1061624010 9:131830162-131830184 TCCCAGGCTGCTCTCCAACCTGG - Intergenic
1062206721 9:135341675-135341697 CCTCAGCTGGGTCTCCCACCAGG - Intergenic
1187520062 X:20005161-20005183 GCCCAGGCTGGTCTTCAACCAGG - Intergenic
1189537242 X:41948258-41948280 ACCCACCCGGTTCTCCTGCCTGG + Intergenic
1190053968 X:47171278-47171300 ACCCAGCCTGGCCTCCTGCCCGG - Intronic
1195371046 X:104173176-104173198 ACCCAGACTGGTCTCAAACCAGG + Intronic