ID: 1172151103

View in Genome Browser
Species Human (GRCh38)
Location 20:32791034-32791056
Sequence CTCCTGATGTACCAAGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172151103_1172151105 -8 Left 1172151103 20:32791034-32791056 CCAGGGACTTGGTACATCAGGAG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 1172151105 20:32791049-32791071 ATCAGGAGACTTGTGGAATATGG 0: 1
1: 0
2: 0
3: 15
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172151103 Original CRISPR CTCCTGATGTACCAAGTCCC TGG (reversed) Intronic
900402324 1:2477647-2477669 CTCCTGCTGTAGCTTGTCCCAGG - Intronic
900991492 1:6100295-6100317 CTCCTCATAGACCAAGTCCCGGG + Exonic
906135251 1:43495263-43495285 CTCCTGCTGTTCCCAGTGCCTGG - Intergenic
915245799 1:154555672-154555694 CTCCTGATGGACCAATCCCAGGG + Intronic
920514774 1:206576626-206576648 CTCTTAATGTACCAGATCCCTGG - Intronic
1066124511 10:32327289-32327311 CTCCTGATATCCCCAGTCTCTGG - Intronic
1072325370 10:94292934-94292956 CTCCTGGTCTAACAACTCCCTGG - Intronic
1072653518 10:97313943-97313965 CTCCTGTAGTACCAAGTACTTGG - Intergenic
1074212473 10:111349534-111349556 CTGCAGATGGACCAAGTCCTCGG - Intergenic
1075023583 10:118968078-118968100 GGTCTGATGTACCAAGTGCCAGG - Intergenic
1078292329 11:10025315-10025337 CTTCTGATTTACCCACTCCCAGG + Intronic
1080282209 11:30570202-30570224 CTGCTGATGGCCCAATTCCCAGG + Intronic
1089973953 11:122716572-122716594 ATCCTGATGTCCCAAGTCTCTGG - Intronic
1095049911 12:37546094-37546116 CTCCTGCTTTGCCAAGTCTCAGG - Intergenic
1100501689 12:95180516-95180538 CACCTGTTGTCCCAAGTGCCTGG - Intronic
1104652393 12:130545211-130545233 CTCGAGATGTACCAAGTACCAGG - Intronic
1110947694 13:81443824-81443846 CACCTGATGAAGCCAGTCCCAGG + Intergenic
1113699845 13:112376221-112376243 GTCCTGATGTCACAGGTCCCTGG + Intergenic
1113907858 13:113828616-113828638 CTCCGGTTGGAACAAGTCCCCGG + Exonic
1117109334 14:52433693-52433715 CTGCTGATGTACCAATTACCAGG - Intronic
1117150623 14:52884001-52884023 CTCCTAAGTTACCAAGTCTCAGG + Intronic
1117734702 14:58756642-58756664 CTCATTATGTGCCAAGACCCTGG - Intergenic
1119388643 14:74275477-74275499 ATCCTGATGTACCACGGCCAGGG - Intergenic
1122740307 14:103868284-103868306 TTCCTGATCTACCTAGTCTCAGG + Intergenic
1125726159 15:41869299-41869321 CTCCTGGTCTGCCAGGTCCCAGG + Intronic
1127905718 15:63374322-63374344 CTCCTTATCTTCCAAGGCCCAGG + Intronic
1132376312 15:101330385-101330407 CTCCTGATGCACCATGACCATGG + Intronic
1132576495 16:666727-666749 CTCCTGATGTACGTGGGCCCCGG + Exonic
1132786179 16:1658124-1658146 CTGCTGATGGACCAACTCTCCGG - Intronic
1133891783 16:9886034-9886056 CTCCTTGTGTACCAGCTCCCTGG + Intronic
1134797665 16:17056751-17056773 CTCCTGATGGCCCAGGACCCAGG - Intergenic
1135255890 16:20941353-20941375 CTCCTCACGTTCCAACTCCCAGG + Intronic
1136912592 16:34157109-34157131 CTACTCATGTCCCACGTCCCGGG + Intergenic
1138128731 16:54460404-54460426 CTGCTGATGTAATAAGGCCCTGG - Intergenic
1139558636 16:67728202-67728224 CTCCAAATGTACGAAGGCCCTGG - Intronic
1139558970 16:67729749-67729771 CTCCCGAAGCCCCAAGTCCCAGG - Exonic
1140301886 16:73766019-73766041 CTCCTGACCTATCTAGTCCCTGG + Intergenic
1140917676 16:79508472-79508494 CTCCTGCTGTTGCCAGTCCCAGG + Intergenic
1141674502 16:85510534-85510556 CTGCTGAGGTACCAAGCCCAGGG - Intergenic
1142887645 17:2922666-2922688 CCCCATATGTACCAGGTCCCGGG - Intronic
1145294063 17:21574423-21574445 CTCCTGCTTTGCCAAGCCCCAGG + Intronic
1145306571 17:21678769-21678791 CTCCTGCTGTGCCAAGCCTCAGG + Intergenic
1145306810 17:21679933-21679955 CTCCTGCTGTGCCAAGCCTCAGG + Intergenic
1145307040 17:21681095-21681117 CTCCTGCTGTGCCAAGCCTCAGG + Intergenic
1145307268 17:21682260-21682282 CTCCTGCTGTGCCAAGCCTCAGG + Intergenic
1145307955 17:21685755-21685777 CTCCTGCTGTGCCAAGCCTCAGG + Intergenic
1145775704 17:27526902-27526924 CTCCTGAGTAACCAAGTCCTAGG - Intronic
1149380921 17:56093110-56093132 CTCATGATGTTCACAGTCCCAGG + Intergenic
1153040888 18:812254-812276 CTCCTGAAGTAACGCGTCCCGGG - Intronic
1155436220 18:25815694-25815716 CTCCTGAGGTCCCTAGTTCCTGG - Intergenic
1161980663 19:7628609-7628631 CTCCTTAGATACCAAGGCCCTGG + Intronic
1161981707 19:7633443-7633465 CTCCTGATCCATCATGTCCCTGG + Exonic
1165395654 19:35562352-35562374 CCCCTCTTGTCCCAAGTCCCAGG + Intronic
1165596579 19:37014759-37014781 CTCCTGATCTGCCAAGCCTCTGG - Intronic
1166431747 19:42733554-42733576 CTGCTGAAGTACCCAGTCCCAGG - Intronic
1166434867 19:42758769-42758791 CTGCTGAAGTACCCAGTCCCAGG - Intronic
1166444742 19:42848792-42848814 CTGCTGAAGTACCCAGTCCCAGG - Intronic
1166452178 19:42911350-42911372 CTGCTGAAGTACCCAGTTCCAGG - Intronic
1166454632 19:42930212-42930234 CTGCTGAAGTACCCAGTCCCAGG - Intronic
1166464432 19:43019540-43019562 CTGCTGAAGTACCCAGTCCCAGG - Intronic
1166470585 19:43076124-43076146 ATGCTGAAGTACCCAGTCCCAGG - Intronic
1166481708 19:43179648-43179670 ATGCTGAAGTACCCAGTCCCAGG - Intronic
1166484179 19:43198765-43198787 ATGCTGAAGTACCCAGTCCCAGG - Intronic
1167217611 19:48175272-48175294 CTCATCATCTACCCAGTCCCAGG - Intronic
1167573868 19:50308416-50308438 CTGCTGATGTGCCAAGTGCCAGG + Intronic
925128064 2:1475966-1475988 CTCCTGATGGACCCAGGCACAGG - Intronic
925208738 2:2028762-2028784 GTCCTGATGTCCCTAGTTCCTGG - Intronic
942144534 2:173013882-173013904 CTCCTGCTGTACCAATTCTCTGG - Intronic
948797393 2:240411993-240412015 GTCATGGTGTGCCAAGTCCCTGG - Intergenic
1169587122 20:7097252-7097274 GTCCTGTTGTAACAACTCCCTGG - Intergenic
1172151103 20:32791034-32791056 CTCCTGATGTACCAAGTCCCTGG - Intronic
1172303553 20:33865903-33865925 CTCCTGATGTAAAAACTCCAAGG + Intergenic
1174008422 20:47428849-47428871 CCACTGATGTACCCAGTGCCTGG + Intergenic
1174700762 20:52606171-52606193 CTCCAGATGTACCTATTCACAGG + Intergenic
1174703996 20:52637193-52637215 CTCCTGATGTTCCAACCACCTGG - Intergenic
1177190073 21:17840997-17841019 CTCCTGGTGCACCCATTCCCAGG - Intergenic
1178784245 21:35637778-35637800 CTCCTGGTTTCCCAAGTCCTTGG - Intronic
1178876140 21:36415590-36415612 CTCCTGCTGAACCCACTCCCTGG - Intronic
1183329765 22:37212861-37212883 CTCCAGATGTAACCAATCCCAGG - Intergenic
949358207 3:3203840-3203862 CACCTGATGTACATAGTCACAGG - Intergenic
954190510 3:48956819-48956841 CTCCTGATTTCCCAAGTAGCTGG + Intronic
960024823 3:112996607-112996629 CTCATTATATATCAAGTCCCAGG + Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
962015173 3:131431790-131431812 CTCCTGAGGTACCCAATTCCAGG + Intergenic
962755912 3:138465339-138465361 TTCATGGTGTACGAAGTCCCTGG + Exonic
964563927 3:158028851-158028873 CTCCAGATCCACCAATTCCCAGG - Intergenic
967340209 3:188389237-188389259 CACCTGATGTCCCAATACCCTGG + Intronic
969564100 4:7967528-7967550 CTCCTGGGCTACGAAGTCCCGGG - Intronic
971317045 4:25576293-25576315 CTCCCTCTGTACCTAGTCCCTGG + Intergenic
975654054 4:76623224-76623246 CTCCTGCTGCACCAAGTCTGTGG + Intronic
975664841 4:76725582-76725604 GTCCTCATGTACCACATCCCTGG + Intronic
976072660 4:81259552-81259574 ATTCTGCTGTAGCAAGTCCCTGG - Intergenic
976451770 4:85199112-85199134 TTCCTGCTGTAACAACTCCCTGG + Intergenic
979509526 4:121536447-121536469 TTCCTGATGTAACAGCTCCCTGG - Intergenic
981298011 4:143155765-143155787 GTCCTGCTGTAACAACTCCCTGG + Intergenic
983702307 4:170612735-170612757 CTCCTGCTGTTCTAACTCCCTGG - Intergenic
985546039 5:509676-509698 CACCTGCTGTGCCAGGTCCCTGG - Intronic
994176209 5:96714086-96714108 CTATTGATGTACCATGTGCCAGG + Intronic
994428639 5:99627730-99627752 GGCCTGATGTACCCACTCCCTGG + Intergenic
998697669 5:144658594-144658616 ATCCTGATGTCCTAATTCCCAGG - Intergenic
999671751 5:153964662-153964684 CTCCTGTGGAACCAAGTGCCAGG - Intergenic
1000419730 5:161025043-161025065 CTTCTGATCTACCAAGTGGCAGG - Intergenic
1001796948 5:174510175-174510197 CTTCTGATGTCTCAAGTCCATGG + Intergenic
1003952362 6:11127970-11127992 CTCCTGATGTCCCCAATTCCAGG - Intronic
1005973568 6:30780045-30780067 CACCTGATTTAGCAAGGCCCAGG + Intergenic
1012862319 6:104574446-104574468 CTCCTGACTTACCAAATTCCAGG + Intergenic
1019892887 7:3960624-3960646 CTCCTACTGAACCAAGTCCCGGG - Intronic
1021070991 7:16240291-16240313 CTGCTGATGTAGTAAGTCTCAGG - Intronic
1022026438 7:26452220-26452242 TACCTGATGCACAAAGTCCCTGG - Intergenic
1022953683 7:35362483-35362505 CTCATGATGGACCAAGGCCCTGG + Intergenic
1027570682 7:79862591-79862613 CTCCAGATGTATCAACTCACAGG + Intergenic
1032192452 7:129772664-129772686 CTCCTAATTTACCTAGTTCCGGG - Intergenic
1034357751 7:150466067-150466089 CTCGTGATGCACCCAGTGCCAGG - Intronic
1034688759 7:152997249-152997271 CTGCTGCTGTGCCAAGTTCCTGG - Intergenic
1035286909 7:157812453-157812475 CTCTTGATGAAAGAAGTCCCTGG - Intronic
1036148368 8:6275485-6275507 CACCTGAAGTTCCATGTCCCAGG + Intergenic
1037617409 8:20531887-20531909 CTCCTGAGGTCCCAAGGCCATGG - Intergenic
1040469742 8:47727362-47727384 CACCTGAGGTAGCAAGGCCCAGG - Intronic
1042818909 8:72909038-72909060 CTGGTCATGTACCAAGTCCTGGG + Intronic
1042872402 8:73410741-73410763 CTACTGATTTAGCAAGTCCAGGG + Intergenic
1048251159 8:132867872-132867894 CTCATGAGGCACCAAGTCTCAGG - Intronic
1048722230 8:137339009-137339031 CTCCTGCTGTACCCAGTGCTGGG + Intergenic
1049344719 8:142132654-142132676 CTCCTGATCTCCCAAGTAGCTGG - Intergenic
1049851146 8:144831265-144831287 CTGCTGCTGTGCCAAGTCACAGG + Intronic
1052797729 9:32939061-32939083 CTCCTTATGTTCCACCTCCCAGG - Intergenic
1056317787 9:85408235-85408257 CTCCTGAAGTGTCAACTCCCTGG - Intergenic
1058241696 9:102569914-102569936 CGCCTGCTGTACCCACTCCCTGG - Intergenic
1059347028 9:113636066-113636088 CTCCTGATGTGCCAAGCACTGGG - Intergenic
1061883715 9:133580384-133580406 CTCCTGCTGCACCCCGTCCCCGG - Intronic
1062554407 9:137107459-137107481 CTCCTGATGGACCCTGACCCAGG - Intronic
1185676261 X:1851714-1851736 CTCCTGACTCACCAAGTCCCGGG - Intergenic
1185807037 X:3067582-3067604 CTCCTGCTGCCCCAAGTCCTGGG - Intronic
1186907345 X:14125909-14125931 TTCCTGATGATCCAAGTGCCAGG - Intergenic
1187420925 X:19133085-19133107 CTCTGGATGGACCACGTCCCCGG + Intergenic
1197123059 X:122914184-122914206 CTCCTAATGCCCCAAGACCCAGG - Intergenic
1202175955 Y:22099108-22099130 CTCCTTCTCTACCAAGCCCCAGG + Intergenic
1202215406 Y:22487276-22487298 CTCCTTCTCTACCAAGCCCCAGG - Intergenic