ID: 1172152967

View in Genome Browser
Species Human (GRCh38)
Location 20:32803577-32803599
Sequence AGTGACATGCCGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172152961_1172152967 8 Left 1172152961 20:32803546-32803568 CCATTTTCATGGTTAAACACATC 0: 1
1: 0
2: 0
3: 21
4: 226
Right 1172152967 20:32803577-32803599 AGTGACATGCCGAAGGGGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 152
1172152959_1172152967 29 Left 1172152959 20:32803525-32803547 CCAGGCACTGTTACGCTGTTGCC 0: 1
1: 1
2: 0
3: 3
4: 82
Right 1172152967 20:32803577-32803599 AGTGACATGCCGAAGGGGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172152967 Original CRISPR AGTGACATGCCGAAGGGGGA GGG Intronic
901736026 1:11312726-11312748 AGTGCCATGCTGCAGGGTGAAGG + Intergenic
904014388 1:27408805-27408827 GGTGAGATGATGAAGGGGGAGGG + Intronic
904935305 1:34125959-34125981 AGTGATATTCAGAAGGGAGAGGG + Intronic
905458006 1:38101734-38101756 AGTGACTTGCCCAAGGTGGGTGG + Intergenic
907471782 1:54679031-54679053 GGTGACATGCGTAAGGGAGAAGG - Intronic
907709784 1:56868718-56868740 AGTGGTATGCCGAGTGGGGAAGG - Intronic
909501096 1:76336784-76336806 AGTGACATGGCCAAGGGCAAAGG + Intronic
917979399 1:180259796-180259818 AGTGACAAGCCCAAGGGGAAGGG + Intronic
922482969 1:225951786-225951808 AATGAAATGCCAAAGGGGGAAGG - Intergenic
1063957545 10:11280803-11280825 AGTGAGATGCCCAAGAGGCAGGG + Intronic
1069604472 10:69730981-69731003 AGTGGCCTGGAGAAGGGGGACGG - Intergenic
1074875556 10:117610535-117610557 AGGGACTTGCGGGAGGGGGAGGG + Intergenic
1076856324 10:133117073-133117095 AGGCACAGGCAGAAGGGGGAAGG + Intronic
1077249472 11:1554622-1554644 AGGGACAAGGGGAAGGGGGAAGG + Exonic
1077772898 11:5240097-5240119 AGTGACATTCAGAAGGGCAAGGG + Intergenic
1080154857 11:29097651-29097673 AGAGACATGCTGAACAGGGAAGG - Intergenic
1080769543 11:35327728-35327750 AATGACATCCCGGAGAGGGAAGG + Intronic
1082002865 11:47403341-47403363 ACTGAGATGGCGAAAGGGGAAGG + Intergenic
1085159998 11:74331826-74331848 AGGGGCATGATGAAGGGGGAAGG - Exonic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1091407918 12:220558-220580 AGTAACATGGGGAAGGGTGAAGG + Intergenic
1095611650 12:44135493-44135515 AGTGATATGGGGAAGGGAGAAGG - Intronic
1095999244 12:48115017-48115039 AGAGTCATGGAGAAGGGGGATGG + Intronic
1096242291 12:49965953-49965975 ATTGACATGGCTGAGGGGGAGGG - Intergenic
1097398434 12:59103054-59103076 AGAGACATGGAGAAGGGGTAGGG - Intergenic
1098843072 12:75501052-75501074 AGTGACACACTGAAGGGAGAGGG - Exonic
1100178716 12:92060142-92060164 AGTGCCATGCCGGAAGAGGAGGG + Intronic
1101450175 12:104768911-104768933 AGTGTCATGCCAAAGGAGCATGG - Intergenic
1103358785 12:120341838-120341860 AGGGACACACAGAAGGGGGATGG + Exonic
1103945476 12:124523822-124523844 AGTGACTTGCCCAAGGGGACGGG + Intronic
1106217412 13:27715522-27715544 AGTGACCTGCTGAAGGGGAGAGG + Intergenic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1109764412 13:66874968-66874990 AGAGATATGTAGAAGGGGGAGGG + Intronic
1110565689 13:76955508-76955530 AATGACATGCCAAAGAGGTATGG + Exonic
1111292692 13:86188413-86188435 AGTGATATGGAAAAGGGGGAAGG + Intergenic
1113288223 13:108877375-108877397 AGTGACAGGCCCAAGGGGACAGG - Intronic
1113627191 13:111856057-111856079 GGAGACATGGCCAAGGGGGATGG + Intergenic
1119294414 14:73521374-73521396 AGTGAGATGACGAAGGAGGTGGG - Intronic
1119540142 14:75432544-75432566 AGTGACAAGCCAAGGAGGGAGGG - Intronic
1120168041 14:81220954-81220976 AGAGACAGGGTGAAGGGGGAGGG + Intronic
1120618102 14:86732524-86732546 AGAGACATGGAGAAGGGGGTGGG - Intergenic
1126940858 15:53763514-53763536 AGTGACTTGCAGTAGGAGGAAGG - Intergenic
1130251832 15:82304835-82304857 AGTGTCATGCTGCAGGGGGTGGG - Intergenic
1131882979 15:96878278-96878300 GGTGACATTCCCAAGGGGAAGGG - Intergenic
1132323290 15:100943290-100943312 AGTGACTTGCCCAAGGGAGGGGG - Intronic
1136615501 16:31395881-31395903 AGTCACATGAGGAAGGGAGAGGG - Intronic
1137837552 16:51607644-51607666 AGTGTCAGCCCAAAGGGGGAAGG - Intergenic
1138630720 16:58292328-58292350 AGTGACATGCTGAAGAGTGATGG + Intronic
1139244593 16:65429130-65429152 AGTGAGATGCTGAAGGAAGAAGG + Intergenic
1139468661 16:67166966-67166988 AGTCACATGCTGGAGGTGGAAGG - Intronic
1140045691 16:71439180-71439202 AGTGACATGGTGGAGGAGGAGGG + Intergenic
1141400069 16:83739690-83739712 AGAGACCTGCCTATGGGGGAGGG + Intronic
1141617699 16:85219746-85219768 TGTGGCTTGCAGAAGGGGGAAGG - Intergenic
1144300508 17:13919329-13919351 AGTGAGAAGGGGAAGGGGGAAGG - Intergenic
1146401517 17:32503713-32503735 AGTGACATCCAGATGGAGGACGG - Intronic
1147658312 17:42103641-42103663 AGCGACCTGCGGAAGGTGGAGGG - Exonic
1147951970 17:44112470-44112492 TGTGACATCAGGAAGGGGGAGGG - Intronic
1152066692 17:78115986-78116008 AGTGAGTTGCAGAAGGGGGTCGG - Intronic
1153718166 18:7872313-7872335 AGTGATATGAGGAAGTGGGAAGG - Intronic
1155402780 18:25457370-25457392 AATGACATGCAGAAGGAGCAGGG + Intergenic
1155961790 18:32001452-32001474 AGAGACATGGAGAAGGGGGTGGG - Intergenic
1156854128 18:41762447-41762469 AGAGAGATGGCGGAGGGGGAGGG - Intergenic
1157169296 18:45387368-45387390 AGTGACATGGTGATGTGGGAGGG - Intronic
1161719254 19:5894179-5894201 AGTGACCTGCCGGATGGGGACGG + Intronic
1162386086 19:10361468-10361490 GGTGGCCTGCCAAAGGGGGATGG + Intronic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1165313737 19:35042501-35042523 AGTGACATGGCGCAGAAGGAGGG + Exonic
928641348 2:33303123-33303145 AGTGACATCCCAAGGTGGGAGGG + Intronic
934683661 2:96305144-96305166 AGTGACGTGTGGAAGGGGGAGGG + Intronic
935528328 2:104200534-104200556 AGTGACATGGCCACAGGGGAGGG - Intergenic
937384776 2:121418889-121418911 ACTGACGTGCCAACGGGGGAGGG + Intronic
938153828 2:128910656-128910678 AGGGACATGCCCAATAGGGACGG - Intergenic
939429974 2:142091633-142091655 AGTGGCATGCTGTAGGGGCAAGG - Intronic
941110539 2:161415606-161415628 AGCGACAAGCAGAAGGGGGGAGG - Intergenic
1171153378 20:22847442-22847464 TGAGACATGCTGAAGGGGGCTGG - Intergenic
1172152967 20:32803577-32803599 AGTGACATGCCGAAGGGGGAGGG + Intronic
1172624012 20:36337148-36337170 AGTGACTTGCCCAAGGGACAAGG + Intronic
1172949824 20:38715779-38715801 GGTGAGATGCAGGAGGGGGAGGG - Intergenic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1177683898 21:24411593-24411615 AGTGACAGGACAAAGGGGCAGGG - Intergenic
1182485298 22:30635557-30635579 AATGCCAGGCCGATGGGGGAGGG + Intergenic
1184950988 22:47842488-47842510 AGTCTCATGCAGAAGGGGCAGGG - Intergenic
1185095181 22:48802561-48802583 AGTGACTGCCCGATGGGGGAGGG - Intronic
1185416692 22:50714577-50714599 AGTGACAGGACGAAGGGAAATGG + Intergenic
949319693 3:2795414-2795436 AGTGACATTCCCACGGAGGAAGG + Intronic
949586100 3:5439319-5439341 CGTGACATCCTGAAGGAGGATGG + Intergenic
950714700 3:14839437-14839459 AGAGTCATTCCAAAGGGGGAGGG - Intronic
953423374 3:42772470-42772492 AGTGGCAGGCCGATGGGGCAAGG - Intronic
953841354 3:46392458-46392480 AGAGACATGGAGAAGGGGGGAGG + Intergenic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
956736111 3:72239576-72239598 AGTGTAATGGCGAAGGGTGAGGG - Intergenic
958421794 3:93938948-93938970 AGAGACATGGAGAAGGGGGGTGG - Intronic
960303630 3:116034412-116034434 AGTGACTTGCCAAAGGCAGAGGG - Intronic
962025461 3:131542642-131542664 AGTGACATGCAGATGCTGGACGG - Exonic
963520282 3:146354747-146354769 AGAGACATGGAGAAGGGGGTGGG - Intergenic
966540826 3:181088096-181088118 AGTAAAATCCCGAAGAGGGAAGG + Intergenic
966883574 3:184362642-184362664 AGTGCCAGGCTGAAGGGGCACGG + Intronic
967210187 3:187161684-187161706 AGAGACTTGGGGAAGGGGGAGGG - Intronic
967643989 3:191899903-191899925 AGAGACATGGAGAAGGGGTAGGG + Intergenic
967951913 3:194847777-194847799 AGTTCCATGGAGAAGGGGGAAGG + Intergenic
969453696 4:7289039-7289061 AGTGCCAAGCCCAAGGGAGAGGG - Intronic
970556249 4:17235582-17235604 AGTGACATAAAAAAGGGGGAGGG + Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
975066372 4:70069835-70069857 AGTGACATGTTGGAGTGGGAAGG - Intergenic
975160944 4:71122744-71122766 AAGGAGATGCCGAGGGGGGATGG - Intergenic
978303393 4:107294970-107294992 AGAGACATGGAGAAGGGGGATGG + Intergenic
978870153 4:113566086-113566108 AGTTTCATGCTAAAGGGGGAAGG + Intronic
980734809 4:136870761-136870783 ATTGAGATGCGGAAAGGGGAGGG + Intergenic
982084116 4:151817099-151817121 AGAGACATGGAGAAGGGGTAGGG + Intergenic
983913241 4:173263990-173264012 AGTAACTTGCTAAAGGGGGAAGG - Intronic
984817190 4:183849735-183849757 AGTGAGATTGCGAAGGGAGAGGG + Intergenic
986134147 5:4958685-4958707 AGTGACCTGTCAAATGGGGAGGG + Intergenic
986345221 5:6828564-6828586 AGTGACAATCAGAAGGGGAAAGG - Intergenic
986798479 5:11235125-11235147 AGTGCCCCGCCGAAGTGGGATGG - Intronic
995483251 5:112613977-112613999 AGTGAAAAGCAGAAGGGGAATGG + Intergenic
999360701 5:150984273-150984295 AGTAACATTCTGAAGGAGGAGGG + Intergenic
1001021557 5:168187286-168187308 AGTGACAGGCTGGAGGGGGAGGG + Intronic
1002844100 6:931088-931110 AGTGATATGCAGAAGAGAGAAGG + Intergenic
1003050591 6:2777605-2777627 CGTGACATGCCTGAGAGGGAAGG - Intronic
1003093759 6:3126149-3126171 ACTGAAATGCAGAAGGGGTATGG - Intronic
1003174416 6:3744527-3744549 AGTGAGATGGGGAAGGTGGAGGG + Intronic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1014115506 6:117664229-117664251 AGAGACATGGAGAAGGGGGGTGG + Intergenic
1017814249 6:158005454-158005476 ACTGACATGGCAAAGAGGGAAGG - Intronic
1019049264 6:169170510-169170532 AGTGACTTGCTGGAGGGCGAGGG - Intergenic
1020794041 7:12660758-12660780 AGAGACATGGAGAAGGGGGGTGG - Intergenic
1021063576 7:16144373-16144395 AGAGACATGCCCAAGGGAGCTGG + Intronic
1022621741 7:31991505-31991527 AGTTACCTGCAGAAGGGGAATGG + Intronic
1022807166 7:33833957-33833979 AGAGTCATGCCGGAGGGGTAGGG + Intergenic
1027158067 7:75782459-75782481 AGAGACATGGAGAAGGGGGGTGG - Intronic
1030645143 7:112052746-112052768 AGAGACATATCAAAGGGGGATGG - Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1031296451 7:120010069-120010091 AGAGACATGGAGAAGGGGGTGGG - Intergenic
1031418183 7:121518138-121518160 AGTGACAGTTCCAAGGGGGATGG - Intergenic
1035037331 7:155903802-155903824 AGTGACATAGTGAAGGCGGAGGG - Intergenic
1038718990 8:30016399-30016421 AGTGACTTGCCGAAGCTGAAAGG + Intergenic
1039301418 8:36213198-36213220 AATGAGATGCCGAAAGTGGAAGG - Intergenic
1041917698 8:63152847-63152869 AGAGACATGGAGAAGGGGGGTGG + Intergenic
1042680731 8:71380493-71380515 ATAGACATGCCGCAGGGGCAGGG - Intergenic
1045540640 8:103081030-103081052 TGTGGCATGCAGAAGGGGCAGGG - Intergenic
1047710326 8:127545278-127545300 AGTGACTTGCCCAAGGGATATGG + Intergenic
1049071169 8:140357229-140357251 AGTCACATGGTGAAGGGGCAGGG + Intronic
1051297746 9:15614844-15614866 AGTTAGATGGGGAAGGGGGAAGG - Intronic
1055080187 9:72261170-72261192 AGTGTCATGCCAAAGGAGCATGG - Intergenic
1058785268 9:108380873-108380895 AGTGACATATGGAAGGGGTAAGG - Intergenic
1061149204 9:128819306-128819328 AGTGACATCCCGTGGCGGGAGGG + Intronic
1061534476 9:131239099-131239121 AGTTAGATGCGGAAGGGGGCAGG - Intergenic
1186631641 X:11355769-11355791 AGTGATATGAGGAAGAGGGAGGG + Intronic
1186807852 X:13157862-13157884 TGTGACATGATGAAGTGGGAAGG - Intergenic
1187103931 X:16221342-16221364 AGAGACATGGAGAAGGGGGTTGG + Intergenic
1188539931 X:31238475-31238497 AGTGACAGGCCGATGGCAGAAGG + Intronic
1189142348 X:38620036-38620058 AGGGACATGGCGAGGGTGGATGG + Intronic
1189291855 X:39891901-39891923 AGTAACATGGCAAAGGGGAACGG - Intergenic
1190308410 X:49100058-49100080 AGTCACATGCTGAAGGGACAGGG - Intronic
1192319400 X:70077347-70077369 ATTGGCAGGCCTAAGGGGGAGGG - Intergenic
1194260286 X:91685927-91685949 AGTCACATCCCCAAGGGAGAGGG + Intergenic
1195017119 X:100790965-100790987 AGAGACATGGAGAAGGGGGGTGG + Intergenic
1196584951 X:117418831-117418853 AGAGACATGGGGAAGGGGGGTGG - Intergenic
1196873491 X:120135669-120135691 AGTGACTTGCGGAGTGGGGAGGG - Intergenic
1197275296 X:124472102-124472124 AGTGGCATACTAAAGGGGGATGG - Intronic
1200578980 Y:4924985-4925007 AGTCACATCCCCAAGGGAGAGGG + Intergenic
1201147899 Y:11075494-11075516 AGTGACATGCCCAAGGTAAAAGG + Intergenic