ID: 1172153914

View in Genome Browser
Species Human (GRCh38)
Location 20:32810461-32810483
Sequence CGGGCTAGGCTGGGACCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172153914_1172153919 -6 Left 1172153914 20:32810461-32810483 CCCTGTGGTCCCAGCCTAGCCCG No data
Right 1172153919 20:32810478-32810500 AGCCCGTGTCCTCTACCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172153914 Original CRISPR CGGGCTAGGCTGGGACCACA GGG (reversed) Intergenic
No off target data available for this crispr