ID: 1172155112

View in Genome Browser
Species Human (GRCh38)
Location 20:32818959-32818981
Sequence GAGAATGTATGTACAGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172155107_1172155112 22 Left 1172155107 20:32818914-32818936 CCATCTCTTAAAAAAAAAAAAAA 0: 612
1: 3239
2: 113293
3: 97580
4: 161345
Right 1172155112 20:32818959-32818981 GAGAATGTATGTACAGCCATTGG No data
1172155106_1172155112 23 Left 1172155106 20:32818913-32818935 CCCATCTCTTAAAAAAAAAAAAA 0: 492
1: 2286
2: 9763
3: 37878
4: 74335
Right 1172155112 20:32818959-32818981 GAGAATGTATGTACAGCCATTGG No data
1172155105_1172155112 24 Left 1172155105 20:32818912-32818934 CCCCATCTCTTAAAAAAAAAAAA 0: 425
1: 1577
2: 7240
3: 21438
4: 74965
Right 1172155112 20:32818959-32818981 GAGAATGTATGTACAGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172155112 Original CRISPR GAGAATGTATGTACAGCCAT TGG Intergenic
No off target data available for this crispr