ID: 1172155507

View in Genome Browser
Species Human (GRCh38)
Location 20:32820863-32820885
Sequence CCATCGGAGAAGCGGATGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172155507_1172155512 25 Left 1172155507 20:32820863-32820885 CCGGGCATCCGCTTCTCCGATGG 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1172155512 20:32820911-32820933 ATAGCAGCTCTTTGTTAGTTGGG 0: 1
1: 0
2: 0
3: 10
4: 321
1172155507_1172155511 24 Left 1172155507 20:32820863-32820885 CCGGGCATCCGCTTCTCCGATGG 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1172155511 20:32820910-32820932 AATAGCAGCTCTTTGTTAGTTGG 0: 1
1: 0
2: 0
3: 9
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172155507 Original CRISPR CCATCGGAGAAGCGGATGCC CGG (reversed) Intronic
904575415 1:31502172-31502194 CCTTGGGAGAAGAGGATGCCAGG - Intergenic
905259390 1:36706716-36706738 CAATCGGGGAAGGGGCTGCCTGG + Intergenic
907512228 1:54970263-54970285 GCATTGGAGAAGAGGAAGCCAGG + Intergenic
916491752 1:165308247-165308269 CCCTCTGAGAACCAGATGCCAGG + Intronic
919683516 1:200459159-200459181 CCATCTTAGAAGTGGAAGCCAGG + Intergenic
919808216 1:201393336-201393358 CCACAGGAAAAGCAGATGCCAGG + Intronic
1070714844 10:78711986-78712008 ACATCAGGGAAGAGGATGCCTGG - Intergenic
1075618613 10:123909474-123909496 CCACCTGACAAGCGGAAGCCCGG + Intronic
1077452815 11:2661103-2661125 TCATCCGAGCAGCAGATGCCAGG - Intronic
1084000817 11:66294514-66294536 CCATCGGAGCAGGGGCTGGCCGG - Exonic
1104872767 12:132012368-132012390 CCATCTGGGAAGCGGAAACCAGG - Intronic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1122035500 14:98946365-98946387 AGATCGGAAAAGGGGATGCCAGG + Intergenic
1133326465 16:4945092-4945114 TCATCGGAGCAGCGGCTCCCTGG - Intronic
1134001388 16:10785744-10785766 AGATCTGAGAAGCAGATGCCTGG - Intronic
1140701533 16:77586078-77586100 TCATCTGAGAAACCGATGCCAGG - Intergenic
1146675071 17:34767763-34767785 CCATCTGAGAAGTGGAAGGCTGG + Intergenic
1148143160 17:45342544-45342566 CCATCGTACAGGCGGATGCATGG + Intergenic
1156418678 18:36926871-36926893 CCTTAGAAGAAGCAGATGCCGGG - Intronic
1161209555 19:3059116-3059138 CCACCGGAGAAGAGTGTGCCGGG + Intronic
1164156918 19:22602700-22602722 CCATCGGTGAGGCGGAGGCCAGG + Intergenic
1166085571 19:40472603-40472625 CCATCGGGGAAGGTGAGGCCTGG - Exonic
1166182741 19:41120343-41120365 CCACTGGAGAAGGCGATGCCTGG - Exonic
926224717 2:10958905-10958927 CCATCAGAGCAGCAGATACCTGG + Intergenic
927884624 2:26710762-26710784 CCAGCTGAGAATCGGGTGCCAGG - Intronic
929803613 2:45125426-45125448 CCATATGAGAAGAGGATGCCAGG + Intergenic
936439821 2:112542007-112542029 TCAACGAAAAAGCGGATGCCGGG - Intronic
1172155507 20:32820863-32820885 CCATCGGAGAAGCGGATGCCCGG - Intronic
1177526196 21:22293349-22293371 TCCTCAGAGAAGCAGATGCCAGG - Intergenic
1179923623 21:44520920-44520942 CCATGGCAGACGCTGATGCCCGG - Intronic
1183070610 22:35393519-35393541 CCATCGGAGAAGCGGAGCCTGGG - Exonic
1184032937 22:41905434-41905456 CCACAGGAGAGGTGGATGCCTGG + Exonic
1185109709 22:48894155-48894177 CCAGGGAAGAAGCGGAGGCCAGG - Intergenic
955768726 3:62369818-62369840 CCCCAGGAGAAGCGGAGGCCTGG + Exonic
956786079 3:72643531-72643553 CAATCCAAGAAGCAGATGCCAGG + Intergenic
961363051 3:126380181-126380203 GCCTGGGAGAAGAGGATGCCGGG - Intergenic
962748184 3:138413137-138413159 CCATCTGAGAAGTCGAGGCCAGG + Intergenic
969695935 4:8734904-8734926 CCATCGGAGTGGTGGAGGCCAGG - Intergenic
971471062 4:27027629-27027651 CCATGTGGGAAGCGGATGCTTGG - Intergenic
992977098 5:82131857-82131879 CTATCCCAGAAGCAGATGCCAGG - Intronic
994167792 5:96626108-96626130 TTATTGGAGAAGCAGATGCCAGG - Intronic
994269295 5:97758263-97758285 CCATCTGGGAGGCGGAGGCCAGG - Intergenic
997531507 5:134584290-134584312 GCATCGGAGAAAGGGATGACGGG + Intergenic
1018401096 6:163420968-163420990 ACATCTGAGAAGTGTATGCCAGG - Intronic
1019712875 7:2525374-2525396 CCATCGGGGGAGGGCATGCCGGG - Intronic
1029118618 7:98251846-98251868 CCATAGGAGAAGCGGATCGCGGG - Intronic
1029552489 7:101244856-101244878 CCCTCGGCCAAGCCGATGCCGGG + Intronic
1049472475 8:142782642-142782664 CCACCGGAGAGCCGGGTGCCGGG - Intergenic
1057418386 9:94886175-94886197 CCAAAGGAGAAGCAGAAGCCAGG + Intronic
1060290697 9:122299951-122299973 TCTTCTGAGAAGCAGATGCCAGG + Intronic
1192736313 X:73852359-73852381 CCATCGGGGCTGCGGATACCTGG - Intergenic
1199736525 X:150691519-150691541 CCATAGGAGAAGAGGAGGTCAGG - Intergenic
1199846104 X:151694224-151694246 CCCTCGGAGAAGGGGATGCTGGG - Intergenic
1201789792 Y:17826976-17826998 CCATGGGAGAAGCGCATATCTGG - Intergenic
1201811762 Y:18079013-18079035 CCATGGGAGAAGCGCATATCTGG + Intergenic