ID: 1172156770

View in Genome Browser
Species Human (GRCh38)
Location 20:32831614-32831636
Sequence CGCTTTAACCCGAGAGGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66600
Summary {0: 1, 1: 17, 2: 538, 3: 10614, 4: 55430}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172156770_1172156778 17 Left 1172156770 20:32831614-32831636 CCATCGCCTCTCGGGTTAAAGCG 0: 1
1: 17
2: 538
3: 10614
4: 55430
Right 1172156778 20:32831654-32831676 TCCCAAGCAGCTGGGACTACAGG 0: 1666
1: 47891
2: 161693
3: 235253
4: 536190
1172156770_1172156772 -8 Left 1172156770 20:32831614-32831636 CCATCGCCTCTCGGGTTAAAGCG 0: 1
1: 17
2: 538
3: 10614
4: 55430
Right 1172156772 20:32831629-32831651 TTAAAGCGATTCTCCTGCCTCGG 0: 19
1: 1623
2: 4586
3: 7768
4: 18759
1172156770_1172156775 8 Left 1172156770 20:32831614-32831636 CCATCGCCTCTCGGGTTAAAGCG 0: 1
1: 17
2: 538
3: 10614
4: 55430
Right 1172156775 20:32831645-32831667 GCCTCGGGTTCCCAAGCAGCTGG 0: 1
1: 6
2: 355
3: 10080
4: 115951
1172156770_1172156773 -7 Left 1172156770 20:32831614-32831636 CCATCGCCTCTCGGGTTAAAGCG 0: 1
1: 17
2: 538
3: 10614
4: 55430
Right 1172156773 20:32831630-32831652 TAAAGCGATTCTCCTGCCTCGGG 0: 9
1: 769
2: 2290
3: 2593
4: 2591
1172156770_1172156777 9 Left 1172156770 20:32831614-32831636 CCATCGCCTCTCGGGTTAAAGCG 0: 1
1: 17
2: 538
3: 10614
4: 55430
Right 1172156777 20:32831646-32831668 CCTCGGGTTCCCAAGCAGCTGGG 0: 1
1: 9
2: 465
3: 12358
4: 134993

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172156770 Original CRISPR CGCTTTAACCCGAGAGGCGA TGG (reversed) Intronic
Too many off-targets to display for this crispr