ID: 1172157483

View in Genome Browser
Species Human (GRCh38)
Location 20:32838445-32838467
Sequence GTTCATATACGGCTTCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172157480_1172157483 15 Left 1172157480 20:32838407-32838429 CCCACTTTATGGCAGATAGGAAT 0: 1
1: 0
2: 1
3: 18
4: 139
Right 1172157483 20:32838445-32838467 GTTCATATACGGCTTCTGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 78
1172157481_1172157483 14 Left 1172157481 20:32838408-32838430 CCACTTTATGGCAGATAGGAATA 0: 1
1: 0
2: 0
3: 13
4: 228
Right 1172157483 20:32838445-32838467 GTTCATATACGGCTTCTGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172157483 Original CRISPR GTTCATATACGGCTTCTGTG TGG Intronic
900077647 1:830878-830900 GTTCACATGGGGCTGCTGTGGGG + Intergenic
907846624 1:58214275-58214297 GTTCAAATGGGGCTTCAGTGAGG - Intronic
908962123 1:69710675-69710697 GTTCATAAAGGGCTTCTGATGGG - Intronic
910850289 1:91643382-91643404 GTTCATCCACAGGTTCTGTGAGG - Intergenic
917019993 1:170575958-170575980 GTTCATATAAGTCTTATGTTGGG + Intergenic
918501387 1:185200415-185200437 CTTCAGATAGGGTTTCTGTGTGG + Intronic
918612720 1:186511579-186511601 CTTCATATATGGTTTCTGAGTGG + Intergenic
920860745 1:209704521-209704543 GTGCATGTAGGGCTTCTGGGGGG - Intronic
921179719 1:212622398-212622420 GTTCATGTACTGTTTCTTTGTGG + Intergenic
922396900 1:225210976-225210998 CTTCAGATGAGGCTTCTGTGTGG - Intronic
924038369 1:239958279-239958301 CTTCATATTCAGCTTCTGTGGGG + Intergenic
1063339973 10:5253744-5253766 CTTCATATACGACTTTGGTGGGG - Intergenic
1063343763 10:5292907-5292929 CTTCATATACGACTTTGGTGGGG + Intergenic
1066080286 10:31924233-31924255 GTTCATGTAAGGCCTTTGTGTGG - Intronic
1069270493 10:66520650-66520672 TGTCATCTACGGCTTCAGTGAGG + Exonic
1074989027 10:118685871-118685893 GTTTATCTACAGATTCTGTGAGG - Exonic
1080315178 11:30939229-30939251 GTTTATCTATGGCTTCAGTGGGG + Intronic
1081867275 11:46366757-46366779 GGTCATATACGGCATCCGCGGGG - Exonic
1085308214 11:75500385-75500407 GTTCAACAATGGCTTCTGTGTGG + Intronic
1088982563 11:114876697-114876719 GTTCCTATACAGCATCTGGGTGG + Intergenic
1091826587 12:3517410-3517432 GTTTGTCTATGGCTTCTGTGGGG - Intronic
1092663286 12:10764189-10764211 GTTCATCTAGAGATTCTGTGTGG + Intergenic
1093714610 12:22366903-22366925 CTTCAGATATGGTTTCTGTGTGG - Intronic
1093995671 12:25639830-25639852 GTTCACATATAGCTTTTGTGTGG - Intronic
1095885932 12:47188330-47188352 GTCCCTATAGGGCTTTTGTGTGG - Intronic
1102359871 12:112276158-112276180 GTTCCTCTTCGGCTACTGTGGGG - Intronic
1102497904 12:113332144-113332166 GGTCACAGATGGCTTCTGTGAGG - Intronic
1103395881 12:120606613-120606635 GTTCATGTATGCCTTTTGTGTGG + Intergenic
1105997840 13:25689166-25689188 TTTCTTATACAGCATCTGTGAGG + Intronic
1108926805 13:55759485-55759507 GTTCATAGATGGTTTCTCTGAGG + Intergenic
1110451171 13:75638179-75638201 GGTCATACATGGCTTCTGTGTGG + Intronic
1111459625 13:88521895-88521917 GTTCATATACTGCATCTTAGAGG + Intergenic
1111586182 13:90287632-90287654 GTTGATCTATGGCTTTTGTGGGG - Intergenic
1112527061 13:100159869-100159891 GTTCATATGCAGCCTCTGCGGGG + Intronic
1114825541 14:26073674-26073696 GTTCACATAAGTATTCTGTGTGG + Intergenic
1115865361 14:37740927-37740949 GATCAAATGCTGCTTCTGTGGGG + Intronic
1121382497 14:93485523-93485545 GTTCAAATTCAGCTTCTTTGGGG - Intronic
1124193952 15:27604320-27604342 GTACATGTACGGGTTGTGTGGGG + Intergenic
1129367277 15:75064055-75064077 GTTTGTCTATGGCTTCTGTGGGG - Intronic
1131851398 15:96547467-96547489 TGACATATATGGCTTCTGTGAGG - Intergenic
1138331427 16:56218845-56218867 GTTCAAAGAAGGCTTCCGTGAGG - Intronic
1139811898 16:69626395-69626417 GATCATAGACAGATTCTGTGGGG - Exonic
1152208028 17:78986587-78986609 GTTCATATCCCCCTTCTGTGGGG - Intergenic
1158539461 18:58339722-58339744 GTTAACATACTGCTTCTCTGTGG + Intronic
1159593926 18:70364336-70364358 GCCCATATACTGCTTCTGTTAGG - Intergenic
1164905002 19:31960022-31960044 CTTCATATAGGGCTACTGTCAGG + Intergenic
932146336 2:69321030-69321052 GTTCATAAAAGGATTCTGTAAGG + Exonic
938203379 2:129396113-129396135 GTTGATATACTGTATCTGTGTGG - Intergenic
940610541 2:155985712-155985734 GTTCAAATGAGGCTTCTCTGAGG - Intergenic
945816246 2:214608516-214608538 GTTCAAATACCACTTCTCTGGGG + Intergenic
947304746 2:228731882-228731904 ATTCATTTCCTGCTTCTGTGAGG + Intergenic
1172157483 20:32838445-32838467 GTTCATATACGGCTTCTGTGTGG + Intronic
1173013156 20:39200697-39200719 CTTCAGATACGGGTTCTGGGAGG + Intergenic
1179182635 21:39058805-39058827 GCTCATAAAAAGCTTCTGTGTGG + Intergenic
1181444050 22:22955012-22955034 ATATATATATGGCTTCTGTGCGG - Intergenic
1182874169 22:33675741-33675763 GGTCATAAACGCCTTTTGTGAGG - Intronic
962634677 3:137318750-137318772 CTTCATATGCGGTTTATGTGTGG + Intergenic
963928080 3:150972709-150972731 GATGAGAAACGGCTTCTGTGAGG + Intronic
966035572 3:175410388-175410410 GTTCATACAGAGCTTCTCTGTGG - Intronic
979339851 4:119509596-119509618 TTTCATACACGACTTCTCTGGGG - Intronic
981544600 4:145881255-145881277 GTTCATAAACTGTCTCTGTGAGG + Intronic
989364051 5:40635429-40635451 CTTCAGATAGGGCTTCTGTGTGG - Intergenic
990079107 5:51890669-51890691 GTTCAAATGCTGATTCTGTGAGG - Intergenic
991066872 5:62433406-62433428 GTTCGTATATTGGTTCTGTGTGG + Intronic
993260173 5:85647573-85647595 GTTTATCTATGGCTTCTGTGGGG + Intergenic
995144304 5:108769202-108769224 GGTCATATAAGGCTCCTCTGAGG + Intronic
1003555549 6:7136888-7136910 GTTCATATCCCCCTTATGTGAGG + Intronic
1004561118 6:16751908-16751930 TTTCTTATAGGGCTGCTGTGAGG - Intronic
1015369134 6:132430784-132430806 GTTCCTCTCAGGCTTCTGTGTGG - Intergenic
1018065710 6:160123954-160123976 GATCATAGACGTCTTCTGGGAGG + Intronic
1023311480 7:38891393-38891415 GTTTATATATGGATTTTGTGGGG + Intronic
1035527977 8:328759-328781 GTTCACATGGGGCTGCTGTGGGG - Intergenic
1039241260 8:35559268-35559290 GGTCATTTACTGCTTCTGTATGG + Intronic
1042106897 8:65337736-65337758 GGTCAGAGAAGGCTTCTGTGAGG + Intergenic
1044746545 8:95376561-95376583 GATAATACAAGGCTTCTGTGGGG + Intergenic
1047111854 8:121799452-121799474 TTTCATATACTTCTTCTGAGGGG - Intergenic
1047442775 8:124893287-124893309 CTTCATATACGGCTTTTCTCAGG - Intergenic
1053033115 9:34799792-34799814 ATACATATAGGACTTCTGTGTGG + Intergenic
1188910525 X:35841415-35841437 TTTCATATATGGGTTCTGTGGGG - Intergenic
1191725678 X:64278398-64278420 GTTCAGATGGGGTTTCTGTGTGG + Intronic
1192373568 X:70535964-70535986 TTTCTTATACAGCTTCTGAGTGG + Intronic
1193685543 X:84572453-84572475 CTTCAGATAGGGTTTCTGTGTGG - Intergenic
1195440634 X:104894948-104894970 GTTCAGATGGGGATTCTGTGTGG + Intronic
1195576667 X:106459463-106459485 ATTTATATGAGGCTTCTGTGTGG - Intergenic
1196631368 X:117943996-117944018 CTTCAGATGCGGTTTCTGTGTGG + Intronic