ID: 1172162403

View in Genome Browser
Species Human (GRCh38)
Location 20:32877843-32877865
Sequence GAGTGAATAAAGAGCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172162396_1172162403 13 Left 1172162396 20:32877807-32877829 CCTTACAGGGGCCTGAGTTTTAT 0: 1
1: 0
2: 1
3: 7
4: 121
Right 1172162403 20:32877843-32877865 GAGTGAATAAAGAGCTCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 122
1172162398_1172162403 2 Left 1172162398 20:32877818-32877840 CCTGAGTTTTATTATCCATAGGG 0: 1
1: 0
2: 0
3: 9
4: 145
Right 1172162403 20:32877843-32877865 GAGTGAATAAAGAGCTCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172162403 Original CRISPR GAGTGAATAAAGAGCTCCCA GGG Intronic
900838781 1:5030010-5030032 GAGGCAATAAAGAGTTTCCAAGG - Intergenic
901112368 1:6808813-6808835 GGGTGAGGAAAGAGCTCGCATGG + Intronic
902584458 1:17429832-17429854 GAGTGAAACAGGACCTCCCAGGG + Intronic
904391701 1:30190273-30190295 GTGTAAGCAAAGAGCTCCCACGG + Intergenic
908465079 1:64385758-64385780 AAGTGAGTAAGGAGCCCCCATGG - Intergenic
908702988 1:66922261-66922283 GAGGGACTGAAGAGCTCCAAAGG + Intronic
908973426 1:69865888-69865910 GAGTGAAAACAAAGCTCCCTAGG + Intronic
913099117 1:115546662-115546684 GAATAAATAATGTGCTCCCAGGG - Intergenic
914492944 1:148163862-148163884 GAGTGAATAAAGGCCTACCTGGG - Intergenic
916211617 1:162364369-162364391 AAGTGAATAAAGAGTTCTCCAGG - Intronic
917584116 1:176407848-176407870 GATTGAATAATTAGCTCTCATGG + Intergenic
920457874 1:206114954-206114976 AAGTGAGTCAAGAGCCCCCATGG + Intronic
922316689 1:224448857-224448879 GAGTGAATTTAGAGCTCCAGAGG + Intronic
922965675 1:229689051-229689073 AAGGGAATAAACAGCTGCCACGG - Intergenic
1064035301 10:11909247-11909269 GAGAGAATTAAGAGCTGACAGGG - Intergenic
1065682543 10:28251743-28251765 AAGTGAATAAAGAGGTGCCAGGG - Intronic
1070078478 10:73161944-73161966 GAGTGTCTCAAGAGCTGCCATGG + Intronic
1071959832 10:90799373-90799395 GAATGAATGAAGAGATCCCCAGG + Intronic
1075655363 10:124157514-124157536 GAGTGAAGAAAGAGCCTCCATGG + Intergenic
1075740171 10:124690564-124690586 GAGTGAAGACAGAGCTTCCCAGG - Intronic
1081552175 11:44123911-44123933 GAGGGAAGAAAGATCTCCAAGGG - Intronic
1081552194 11:44124068-44124090 GAGGGAAGAAAGATCTCCAAGGG - Intronic
1082794671 11:57370511-57370533 GAGAGAAGAATGAACTCCCAGGG + Exonic
1085551214 11:77374310-77374332 GAGTAAATAAAGACTTACCAAGG + Exonic
1086381735 11:86261843-86261865 CAGTGAATGTAGAGGTCCCATGG + Intronic
1089507583 11:118974136-118974158 CAGTAAATAAAGAGCTCCAAAGG + Intronic
1096531117 12:52243455-52243477 CAATGAATGATGAGCTCCCAGGG - Intronic
1097887304 12:64741914-64741936 AAGTTAATAAAAAGTTCCCATGG - Intronic
1097957139 12:65497508-65497530 GAGTGAACAAAGACATCCCAAGG - Intergenic
1098572449 12:72003965-72003987 CAGAGAATAAAGAGTTACCAAGG - Intronic
1112571999 13:100601545-100601567 GAGTCAAGAAAGTGCTCCCTGGG - Intergenic
1118477052 14:66127355-66127377 GAGTGACTAAAGATCTCAAAAGG - Intergenic
1119097897 14:71851167-71851189 GGGTGAAGAAAGAGCTTCCAAGG + Intergenic
1119133460 14:72195471-72195493 GAGAGAAAAAAGAGGGCCCAGGG + Intronic
1122015064 14:98788293-98788315 AAGTGGATAAAGAGCTGACAGGG + Intergenic
1122103951 14:99436963-99436985 GAATGAATGACCAGCTCCCATGG + Intronic
1122565165 14:102648924-102648946 GAGTGAAGACAGGGCTCCAAAGG + Intronic
1124952889 15:34339570-34339592 GAGAAAATAAAGAGATCCCTGGG - Intergenic
1131542329 15:93284952-93284974 GAGTGTATGATGAGCTCCCGCGG - Intergenic
1131629137 15:94157557-94157579 GAGTGAAAACAGAGCTCCCAAGG - Intergenic
1132669463 16:1096691-1096713 GAGGGAATGAAGAGACCCCACGG - Intergenic
1139197364 16:64935408-64935430 GAGTCAATAAAGAAATCCCAAGG + Intergenic
1139582006 16:67879373-67879395 GGGAGAATAAAGTGCTCCAAGGG - Intronic
1140992522 16:80227730-80227752 GAATGTATAAAGAGCTGGCATGG + Intergenic
1141881437 16:86862736-86862758 GGGTGAATAAACACCTCCAAAGG - Intergenic
1143253748 17:5540871-5540893 GTGTGAACAAAGATCTCGCAAGG + Intronic
1143319849 17:6061179-6061201 GAATAAATAAAGAGCTCCTCTGG - Intronic
1144007382 17:11113505-11113527 GAGACAATAATCAGCTCCCAAGG - Intergenic
1145929617 17:28675655-28675677 GAGTGCAGAGACAGCTCCCAGGG - Intronic
1150154349 17:62838799-62838821 GAGTCAAAAAAGAGATCTCAAGG + Intergenic
1154044296 18:10889856-10889878 CATAGAAGAAAGAGCTCCCAAGG + Intronic
1155112282 18:22727861-22727883 GAGTTAAAAAAGAGATCACAGGG + Intergenic
1156218821 18:35030228-35030250 GAGAGAATAAAAAGGACCCAGGG - Intronic
1157195583 18:45617789-45617811 GAGTGAAGCCAGTGCTCCCAGGG + Intronic
1158024454 18:52879246-52879268 GAGGGAATAAAGTGCCCCCTGGG + Intronic
1159095705 18:63899058-63899080 GAGTGTTTAAGGAGCTCCAAGGG - Intronic
1160429760 18:78803414-78803436 GAGTGCAGAAGGGGCTCCCAGGG + Intergenic
1162353020 19:10162858-10162880 GTGTGCCTATAGAGCTCCCATGG - Intronic
1163227594 19:15975568-15975590 AAGTGAGTAAAGAGACCCCATGG + Intergenic
1163716133 19:18873394-18873416 GAGTAAATAAAGGGCTTCAAGGG + Intronic
1166670477 19:44706794-44706816 GAGTGGATACAGTGCCCCCAAGG + Intronic
925328249 2:3039304-3039326 GGGTGAAGAAAGACCTCCCAGGG + Intergenic
925607104 2:5670777-5670799 TACTGAATAAAGAGCACCCAGGG + Intergenic
927452224 2:23218737-23218759 GAGTGAATAAAGGGCTGTCTGGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
935334656 2:102005398-102005420 GAGTTTATAAAAAGATCCCAGGG - Intronic
935875601 2:107503688-107503710 AACTGGATAAAGAACTCCCAGGG + Intergenic
938411198 2:131066114-131066136 GAGTGATGAAATAGCTTCCATGG - Intronic
940080988 2:149800993-149801015 GATTGAACAAAGAAATCCCAGGG - Intergenic
941162706 2:162053588-162053610 GAGTCAATGATGAGGTCCCATGG - Intronic
941438070 2:165496574-165496596 GTATGAATAGAGTGCTCCCAAGG - Intronic
942667055 2:178330787-178330809 AAGAGAACAAACAGCTCCCAGGG - Intronic
942839459 2:180341477-180341499 GTGCAAATAAAGAGCTCCCAAGG - Intergenic
946465398 2:219907422-219907444 GAATGCATAAATAGGTCCCATGG + Intergenic
1168846968 20:951960-951982 GACTGAATAGAGATCTGCCATGG + Intergenic
1169513741 20:6294321-6294343 GGGTGAATAAAAAGGACCCAAGG - Intergenic
1169851777 20:10060314-10060336 GTGTGAAGGAAGTGCTCCCAGGG + Intergenic
1170229803 20:14033284-14033306 GAGTTAATAAACAGATCGCAAGG - Intronic
1172162403 20:32877843-32877865 GAGTGAATAAAGAGCTCCCAGGG + Intronic
1174424465 20:50422360-50422382 GAGTGAATGAAGTGCTCAGAAGG - Intergenic
1175119813 20:56709087-56709109 GATTGAAGAATGAGCTCACAGGG - Intergenic
1183083058 22:35469539-35469561 GAGAGAATAAATAACTCCCCAGG + Intergenic
1183342009 22:37286713-37286735 GAGTGAATGAAGGGCAGCCAGGG + Intronic
1184335056 22:43848089-43848111 GAGTGAATAAAAGGCTCGCTGGG - Intronic
950141391 3:10618589-10618611 GAGAGACTAAAGAGCTGGCAGGG - Intronic
951605709 3:24432543-24432565 GAAAAAATAAAGAGCTTCCAGGG + Intronic
952310001 3:32180079-32180101 GAGTGTCTCCAGAGCTCCCACGG + Intergenic
958569169 3:95857733-95857755 GATTGAAAAAAAATCTCCCAAGG + Intergenic
960082458 3:113555724-113555746 AAGGGAATAAACAGCTCCCAAGG + Intronic
960211571 3:114973806-114973828 TTGTGTATAAAGAGCTCACAGGG - Intronic
965722584 3:171678003-171678025 CTGTGAATAAAGAACTCACAAGG + Intronic
974941308 4:68471813-68471835 GAGTTAATAAAAAGCTTGCATGG - Intronic
976934418 4:90611475-90611497 GAGAGAATAAAATGATCCCAGGG + Intronic
978069547 4:104450403-104450425 GAATGAATAAAGAACTCTGATGG - Intergenic
982401127 4:154968939-154968961 GAGTGAATAATGAATTGCCATGG + Intergenic
985159422 4:187028762-187028784 GAGAGAATGAAGAGCTTACAGGG - Intergenic
985245549 4:187976642-187976664 GTGTGATTAACCAGCTCCCAGGG - Intergenic
985313530 4:188630466-188630488 GTGTGATTAACCAGCTCCCAGGG + Intergenic
985553387 5:544359-544381 GAGTGAACAAACAGCACCCCGGG + Intergenic
985912468 5:2895273-2895295 GACTGCATAAAGAGATCCCAGGG + Intergenic
986583590 5:9291518-9291540 GAGAGAATAAAGAGATGACATGG + Intronic
987023885 5:13903694-13903716 CAGTGAATAAAGATCTTCTAAGG + Intronic
991019368 5:61964005-61964027 TAGTGAAGAAAGTGCTCCCTTGG - Intergenic
993647515 5:90478360-90478382 CATTGAATAAAGACCTCCCTGGG + Intronic
997751397 5:136349560-136349582 TAATGAATAACGACCTCCCAGGG - Intronic
1001683323 5:173574988-173575010 GATTGAAATAAGAGCTCCCAAGG - Intergenic
1006450507 6:34103276-34103298 GACTGAATAAAGAGCTTTCTGGG - Intronic
1007681509 6:43636742-43636764 GAGAGAATAAGCAGCTTCCAGGG + Intronic
1008285788 6:49648095-49648117 GAGTGAATAATGAGATTACAGGG - Intergenic
1010443542 6:75926345-75926367 CAGTGGAGAAAGAGCTCCAAAGG + Intronic
1011495853 6:87936133-87936155 GAGAGAATAAAGGGCTGCAAAGG + Intergenic
1015639661 6:135317491-135317513 GAGTCCATGAAGAGTTCCCAAGG - Intronic
1017576349 6:155809001-155809023 TAGTGAATAATGAGATACCAGGG + Intergenic
1018163377 6:161069798-161069820 GAGGGGAGAAATAGCTCCCATGG + Intronic
1019914190 7:4122005-4122027 GCTGGAATAACGAGCTCCCAGGG + Intronic
1023250556 7:38256116-38256138 GAGTGTATAAAGACCTCTCTTGG + Intergenic
1031678146 7:124636382-124636404 AAGTATACAAAGAGCTCCCACGG + Intergenic
1035052650 7:156010090-156010112 GTGTAAATAAAGAAATCCCAAGG - Intergenic
1036049440 8:5179551-5179573 GAGTGAATGTTGAGCCCCCAAGG - Intergenic
1040416892 8:47203280-47203302 GAGGGAAGAAAATGCTCCCAAGG - Intergenic
1041984366 8:63903576-63903598 GGGTGAATGAATAGGTCCCATGG - Intergenic
1043063745 8:75539830-75539852 GAGTGACTTAAGAGCTGCAATGG - Intronic
1043317912 8:78944208-78944230 GAGTAAAGAGAGAGCTCTCAAGG + Intergenic
1043416254 8:80053629-80053651 GGGATTATAAAGAGCTCCCATGG - Intronic
1044111519 8:88281339-88281361 GGGTTAAGAGAGAGCTCCCAAGG + Intronic
1044496741 8:92896128-92896150 CAGTGAATACAGAGGTCCCCTGG - Intronic
1044931395 8:97255174-97255196 AAGAGAATAAAGAGCTCACTGGG - Intergenic
1050780962 9:9334808-9334830 GAGAAAATAAAGATCTTCCAAGG + Intronic
1051179599 9:14396420-14396442 GACTCAATGGAGAGCTCCCATGG - Intronic
1051186719 9:14468236-14468258 GAATGAATATAGAGCTTTCAAGG + Intergenic
1053424929 9:38004413-38004435 GAGTGAATAAAGATCTGCTGAGG + Intronic
1057489798 9:95511641-95511663 GAGTTGATAAAGAGCTCAGACGG + Intronic
1057631432 9:96722002-96722024 GAATGAATAAAGAGCTGCCTGGG - Intergenic
1193336164 X:80292040-80292062 AAGTAAATAAATAGCTCACATGG + Intergenic
1196210007 X:112985829-112985851 GAGTTAATAAAGAGATATCATGG - Intergenic
1198561614 X:137856481-137856503 GAGAGGATGAAGAGTTCCCAGGG - Intergenic
1200716918 Y:6557099-6557121 GAGTGAATGAAAAGCTACCCTGG - Intergenic